Application of mdphy7 gene or mdphy7 protein related to apple anthocyanin biosynthesis in regulating apple anthocyanin synthesis

Abstract

The application provides application of MdPHY7 protein or MdPHY7 gene related to apple anthocyanin biosynthesis in regulation of apple anthocyanin synthesis, and belongs to the technical field of plant genetic engineering. Exogenous ALA treatment can induce MdPHY7 gene expression, thereby promoting anthocyanin synthesis increase, finally causing apple anthocyanin accumulation and promoting fruit coloring. It has been verified that overexpression of MdPHY7 gene can promote apple anthocyanin accumulation, while interference with MdPHY7 gene expression can inhibit anthocyanin accumulation and further inhibit fruit appearance quality improvement. It can be seen that MdPHY7 is a new key gene for regulating apple anthocyanin accumulation, and plays a key role in ALA regulation of apple anthocyanin accumulation, which has far-reaching significance for agricultural and forestry production, and lays a solid theoretical foundation for application of ALA in the field of agricultural production.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to the application of the MdPHY7 protein or MdPHY7 gene, which is related to the biosynthesis of apple anthocyanins, in regulating the synthesis of apple anthocyanins. Background Technology

[0002] Anthocyanins play a crucial role in the coloring process of apples, and their content directly affects the vibrancy of the apple peel color. Furthermore, in terms of nutritional value, anthocyanins are natural antioxidants with significant health benefits, including anti-cancer, cardiovascular protection, and improvements in obesity and diabetes. Therefore, in-depth research into the biosynthetic regulatory mechanisms of anthocyanins is of great significance for improving apple fruit quality, promoting the sustainable development of the apple industry, and contributing to rural revitalization.

[0003] 5-Aminolevulinic acid (ALA), a novel natural plant growth regulator, has been shown to significantly promote anthocyanin accumulation in fruits such as apple (Malus domestica), pear (Pyrus spp.), and peach (Prunus persica). This substance has enormous potential for application in fruit production.

[0004] However, there are currently no reports on the involvement of phytochrome (PHY) members in ALA regulation of apple anthocyanin accumulation. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the MdPHY7 protein or MdPHY7 gene, which is related to the biosynthesis of apple anthocyanins, in regulating the synthesis of apple anthocyanins. Exogenous ALA treatment can induce the expression of the MdPHY7 gene, thereby promoting the increase of anthocyanin synthesis.

[0006] This invention provides the application of MdPHY7 protein or MdPHY7 gene in regulating apple anthocyanin synthesis; the amino acid sequence of the MdPHY7 protein is shown in SEQ ID NO.1; the nucleotide sequence of the MdPHY7 gene is shown in SEQ ID NO.2.

[0007] Preferably, the regulation of apple anthocyanin synthesis includes positive regulation to promote apple anthocyanin synthesis or negative regulation to inhibit apple anthocyanin synthesis.

[0008] Preferably, the sites regulating apple anthocyanin synthesis include one or more of the apple peel, leaves, or callus tissue.

[0009] The present invention also provides a method for promoting the synthesis of apple anthocyanins, comprising the following steps: infecting apple tissue with recombinant Agrobacterium containing an overexpression vector; wherein the overexpression vector is inserted with the MdPHY7 gene; and the nucleotide sequence of the MdPHY7 gene is shown in SEQ ID NO.2.

[0010] The present invention also provides an MdPHY7 gene fragment related to the biosynthesis of apple anthocyanins, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0011] The present invention also provides an interfering recombinant plasmid, which inserts the MdPHY7 gene fragment described in the above scheme.

[0012] This invention also provides the application of the MdPHY7 gene fragment or the interfering recombinant plasmid described above in inhibiting apple anthocyanin synthesis.

[0013] The present invention also provides a method for inhibiting the synthesis of apple anthocyanins, comprising the following steps: infecting apple tissue with recombinant Agrobacterium containing the interference recombinant plasmid described above.

[0014] This invention also provides the application of the MdPHY7 protein, MdPHY7 gene, MdPHY7 gene fragment, interference recombinant plasmid, or the method thereof related to apple anthocyanin biosynthesis in creating apple germplasm with different anthocyanin contents.

[0015] This invention also provides the application of 5-aminolevulinic acid in enhancing the transcriptional activity of the MdPHY7 promoter and / or promoting the expression of the MdPHY7 gene; the nucleotide sequence of the MdPHY7 gene is shown in SEQ ID NO.2.

[0016] This invention provides the application of the MdPHY7 protein or gene in regulating anthocyanin synthesis in apples. The MdPHY7 protein or gene can positively regulate the accumulation of anthocyanins in apples. Exogenous ALA treatment can induce MdPHY7 gene expression, thereby promoting increased anthocyanin synthesis and ultimately leading to the accumulation of anthocyanins in apples, thus promoting fruit coloring. Verification showed that overexpression of the MdPHY7 gene (OE-MdPHY7) can promote the accumulation of anthocyanins in apples, while interference with MdPHY7 gene expression (RNAi-MdPHY7) can inhibit anthocyanin accumulation, thereby inhibiting the improvement of fruit appearance quality. Therefore, MdPHY7 is a novel key gene regulating the accumulation of anthocyanins in apples and plays a crucial role in the regulation of anthocyanin accumulation by ALA. This discovery has profound implications for agricultural and forestry production and lays a solid theoretical foundation for the application of ALA in agricultural production. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Figure showing the effect of ALA treatment on apple peel coloring.

[0019] Figure 2 The diagram shows the activation effect of ALA treatment on the MdPHY7 promoter; where A: ProMdPHY7: GUS vector structure; B: ALA promotes GUS staining enhancement; C: ProMdPHY7: LUC vector structure; D: ALA promotes LUC fluorescence enhancement.

[0020] Figure 3 Figure 1 shows the subcellular localization analysis results of MdPHY7-GFP under dark and light conditions;

[0021] Figure 4 The results show the effects of MdPHY7 overexpression or inhibition on anthocyanin accumulation in apple fruits, leaves, and callus. In A, the empty vector (EV) and OE-MdPHY7 fruits were continuously illuminated in a light incubator for 3 days, while P4 and RNAi-MdPHY7 were continuously illuminated for 5 days. In B, the leaves were illuminated for 3 days, and in C, the callus tissue was illuminated for 14 days.

[0022] Figure 5 This is a schematic diagram of the Gateway BP recombination reaction principle. Detailed Implementation

[0023] This invention provides the application of the MdPHY7 protein or MdPHY7 gene in regulating apple anthocyanin synthesis.

[0024] In this invention, the amino acid sequence of the MdPHY7 protein is as shown in SEQ ID NO.1, specifically:

[0025]

[0026] The MdPHY7 protein of this invention contains 1120 amino acids, is located on chromosome 16 of the apple genome, has a molecular weight of 124.06 kDa, an isoelectric point of 5.5, an extinction coefficient of 0.812, and an instability coefficient of 41.63. Leucine (Leu) and alanine (Ala) are the most abundant amino acids, accounting for 10.3% and 7.4%, respectively. The overall average hydrophilicity index is -0.124, indicating it is a hydrophilic protein. Subcellular localization analysis showed that the MdPHY7 protein is localized in the cytoplasm under darkness and in the nucleus under light.

[0027] In this invention, the nucleotide sequence of the MdPHY7 gene is as shown in SEQ ID NO.2, specifically:

[0028]

[0029] In studying ALA-induced anthocyanin accumulation in apples, this invention isolated, cloned, and screened the gene encoding the plant photoreceptor protein phytosalicylate 7 (MdPHY7) from apple peel. The MdPHY7 gene of this invention can promote anthocyanin synthesis in apples. The MdPHY7 gene has the accession number MD16G1153800 and a CDS length of 3363 bp in the Genome Database for Rosaceae (GDR).

[0030] In this invention, the regulation of apple anthocyanin synthesis preferably includes positive regulation to promote apple anthocyanin synthesis or negative regulation to inhibit apple anthocyanin synthesis.

[0031] In this invention, the preferred sites for regulating anthocyanin synthesis in apples include one or more of the following: apple peel, leaves, or callus tissue. The MdPHY7 gene can be used to regulate the accumulation of anthocyanins in apple peel, thereby improving the appearance quality of apple fruits.

[0032] The present invention also provides a method for promoting the synthesis of apple anthocyanins, comprising the following steps: infecting apple tissue with recombinant Agrobacterium containing an overexpression vector; wherein the overexpression vector is inserted with the MdPHY7 gene; and the nucleotide sequence of the MdPHY7 gene is shown in SEQ ID NO.2.

[0033] In this invention, the overexpression vector is named OE-MdPHY7; the backbone plasmid of the overexpression vector is preferably pCAMBIA1300; the insertion site of the MdPHY7 gene on the backbone plasmid is preferably between XbaI and BamHI; and the promoter for MdPHY7 gene expression is preferably the 35S promoter.

[0034] In this invention, the original strain of the recombinant Agrobacterium is preferably Agrobacterium EHA105 or LBA4404.

[0035] In this invention, the overexpression is preferably transient.

[0036] This invention transforms an overexpression vector into apple material using Agrobacterium, which can promote the accumulation of apple anthocyanins.

[0037] This invention also provides an MdPHY7 gene fragment related to the biosynthesis of apple anthocyanins, the nucleotide sequence of which is shown in SEQ ID NO.3, specifically:

[0038] atggcgtcaggagctcagtcgtcgggcacgagcaatatcaaggctcaccacaacacggagtctgtgagcaaagccattgctcagtacactgtagatgctcggctgcacgccgtgttcgagcagtc cggggagtccggcaagtcgttcgactactcgcagagcatgaaaaccaccaaagattccgtcccggagcagcagattacggcgtacctgtcgaagattcagaggggcggccatgtccaacctttcg ggtgcatgatggccgtggacgaagccacgttcggagtcattgcgtatagcgagaacgcacgcgacatgctcgacctaacgccgcagtcagtgccgatccttgaaaagccggagatctcacaatt gggacgacgtccgtacgctattcacaccgtcgagcgcggtgttgctggagaaggcatttggggctcgggagataacccttttgaacccgatttggatccactctaagatttctggaaagccctt.

[0039] The present invention also provides an interfering recombinant plasmid, which inserts the MdPHY7 gene fragment described in the above scheme.

[0040] In this invention, the backbone plasmid of the interfering recombinant plasmid is preferably the RNA interference vector pHELLSGATE4; the insertion site of the MdPHY7 gene fragment on the backbone plasmid is preferably between attP1 and attP2. Interfering with the expression of the MdPHY7 gene (RNAi-MdPHY7) can inhibit anthocyanin accumulation, thereby inhibiting the improvement of fruit appearance quality.

[0041] This invention also provides the application of the MdPHY7 gene fragment or the interfering recombinant plasmid described above in inhibiting apple anthocyanin synthesis.

[0042] The present invention also provides a method for inhibiting the synthesis of apple anthocyanins, comprising the following steps: infecting apple tissue with recombinant Agrobacterium containing the interference recombinant plasmid described above.

[0043] This invention transforms the interference expression vector RNAi-MdPHY7 into apple material, which can inhibit the accumulation of apple anthocyanins.

[0044] This invention also provides the application of the MdPHY7 protein, MdPHY7 gene, MdPHY7 gene fragment, interference recombinant plasmid, or the method thereof related to apple anthocyanin biosynthesis in creating apple germplasm with different anthocyanin contents.

[0045] In this invention, the apple variety is preferably 'Wanglin' ​​or 'Gala'.

[0046] This invention also provides the application of 5-aminolevulinic acid in enhancing the transcriptional activity of the MdPHY7 promoter and / or promoting the expression of the MdPHY7 gene; the nucleotide sequence of the MdPHY7 gene is shown in SEQ ID NO.2.

[0047] In GUS and LUC detection analysis, exogenous ALA treatment significantly activated the MdPHY7 promoter, promoting the expression of ProMdPHY7:GUS and ProMdPHY7:LUC. ALA is located upstream of the MdPHY7 gene; exogenous ALA can activate MdPHY7 promoter activity, promote MdPHY7 gene transcription, promote apple anthocyanin accumulation, and thus promote fruit coloring.

[0048] To further illustrate the present invention, the application of the MdPHY7 protein or MdPHY7 gene related to the biosynthesis of apple anthocyanins provided by the present invention in regulating the synthesis of apple anthocyanins is described in detail below with reference to the accompanying drawings and embodiments. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] Previous studies have found that ALA can significantly promote anthocyanin accumulation in apple fruit (Wang Liangju et al., Journal of Fruit Science, 2004, 21: 512-515), but the relationship between ALA-promoted anthocyanin accumulation and phytochrome has not been elucidated. In this example, bagged 'Huashuo' apples that had not yet colored 120 days after full bloom were first harvested and treated with 200 mg·L⁻¹. -1 Soak in ALA solution or water (Control) for 1 minute, allow to air dry slightly, wrap in absorbent paper, place in a plastic box, and incubate overnight (8–12 hours) in the dark at room temperature. Then, remove the absorbent paper and transfer to a 17°C, 200 μmol / L solution. -2 s -1 The incubator was continuously illuminated for 72 hours. Samples were taken and photographed every 24 hours. The results showed that ALA treatment significantly promoted the accumulation of apple anthocyanins (Table 1). Figure 1 ).

[0051] Table 1. Anthocyanin content in apple peel at different time points after ALA treatment (unit: nmol·g) -1 FW)

[0052] Processing time (h) 24 48 72 Control group 1.51±0.06e 7.79±0.86d 29.62±0.50b Processing Group (ALA) 1.94±0.22e 22.01±0.09c 52.08±1.54a

[0053] Note: Anthocyanin content in the table is the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0054] 200 mg·L⁻¹ of light was extracted after 24, 48, and 72 hours of illumination. -1 Total RNA from apple peels in ALA solution or water (Control) was reverse transcribed into cDNA. The relative expression levels of seven members of the apple phytochrome gene family (MdPHY1-7) were then measured. It was found that only the relative expression level of MdPHY7 in apple peels showed a sustained increase after ALA treatment, while the expression levels of other members remained unchanged (Table 2). These results suggest that MdPHY7 may be involved in ALA-induced anthocyanin accumulation in apple peels, promoting fruit coloring, while other members are not related to ALA-induced anthocyanin accumulation.

[0055] Table 2. Relative expression levels of apple phytochrome gene family members (MdPHY1-7) after ALA treatment for different time periods.

[0056]

[0057] Note: Gene expression levels in the table are the mean ± standard error of three biological replicates. The same lowercase letter after each data point in the same column indicates no significant difference at the P=0.05 level.

[0058] The promoter of the apple MdPHY7 gene obtained through cloning and screening was ligated to the β-glucuronidase (GUS) gene and the luciferase reporter gene (LUC) to construct ProMdPHY7:GUS. Figure 2 (A) and ProMdPHY7:LUC vector ( Figure 2 The C in the sample is then transformed into Agrobacterium.

[0059] Agrobacterium containing the ProMdPHY7:GUS vector was transformed into 'Wanglin' ​​apple callus to obtain transgenic positive callus. The transgenic 'Wanglin' ​​callus was then cultured on Murashige & Skoog (MS) medium, half of which contained 0.25 mg / L of the medium. -1 ALA, the other half does not contain ALA (Control), and it is stored in the dark overnight. Then it is transferred to 17℃, 200 μmol m -2 s -1The callus tissues were continuously illuminated in a light incubator for 3 days. Apple callus tissues treated with different methods were immersed in GUS staining solution [containing 100 mM phosphate buffer, pH 7, with 0.1% (v / v) Triton X-100, 10 mM EDTA, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6, and 1 mM 5-bromo-4-chloro-3-indole-β-D-glucuronide] and kept at 37°C for 24 h. The callus tissues were then placed in centrifuge tubes for photographing. In addition, total RNA was extracted from the callus tissues under different treatments, reverse transcribed into cDNA, and the expression level of the GUS gene was measured. The results showed that exogenous ALA treatment activated the MdPHY7 promoter, upregulating GUS expression by 141% (Table 3), and the callus tissues showed a deeper blue color after histochemical staining. Figure 2 (B in the original text). These results demonstrate that exogenous ALA can enhance MdPHY7 promoter activity, thereby significantly increasing GUS expression. This result proves that MdPHY7 transcription in apples is positively regulated by exogenous ALA.

[0060] Table 3. Relative expression levels of ProMdPHY7-GUS gene under different treatments.

[0061] deal with Relative expression level of GUS gene Standard error 1% difference 5% difference Control group 1.03 0.09 B b Processing Group (ALA) 2.41 0.10 A a

[0062] Note: Gene expression levels in the table are the mean and standard error of three biological replicates. Different capitalization letters represent significant differences at the P=0.01 and 0.05 levels, respectively.

[0063] Agrobacterium containing the ProMdPHY7:LUC vector was injected into whole leaves of Nicotiana benthamiana. Half of the leaf was treated with water as a control group, while the other half was treated with 0.5 mg L... -1 ALA solution was evenly applied as ALA treatment. The different treatment groups were cultured at room temperature for approximately 3 days. Tobacco leaves were observed and photographed using a live imaging system, and the fluorescence intensity of different parts was measured. The results showed that the MdPHY7 promoter activity in the control group was relatively weak, but after ALA treatment, the fluorescence intensity increased several times over. Figure 2 (See D in Table 4). These results further demonstrate that ALA is a positive regulator of the MdPHY7 promoter, promoting its transcriptional activity.

[0064] Table 4. Relative fluorescence intensity of ProMdPHY7LUC under different treatments.

[0065] deal with LUC relative fluorescence intensity Standard error 1% difference 5% difference Control group 1.00 0.03 B b Processing Group (ALA) 2.09 0.03 A a

[0066] Note: The fluorescence intensities in the table are the mean and standard error of three biological replicates. Different capitalization letters represent significant differences at the P=0.01 and 0.05 levels, respectively.

[0067] The stop codon of the screened apple MdPHY7 gene was removed, and the green fluorescent protein (GFP) gene was ligated into it. This ligation was initiated by the 35S promoter, forming a 35S::MdPHY7-GFP fusion vector, which was transformed into Agrobacterium and injected into Tobacco Benzoenta leaves. Two days later, fluorescence distribution was observed under a laser confocal microscope. It was found that in darkness, the MdPHY7-GFP protein was distributed in the cytoplasm (…). Figure 3 After 6 hours of light treatment, the MdPHY7-GFP protein was localized in the cell nucleus, indicating that light causes MdPHY7 to translocate into the cell nucleus, transmitting light signals from the external environment to the cell nucleus and inducing gene expression and photomorphogenesis in plants.

[0068] This invention utilizes molecular biology techniques to screen a phytochrome gene, MdPHY7, from ALA-treated apple fruits that responds to ALA treatment. Through quantitative fluorescence analysis, transient transformation of apple fruits and leaves, and stable transformation of apple callus tissue, it was found that MdPHY7 can regulate the accumulation of apple anthocyanins. Rational utilization of this gene can regulate the full coloring of apple peel, which is beneficial to the development of the apple industry.

[0069] Example 2: Overexpression of MdPHY7 promotes anthocyanin accumulation and exogenous ALA treatment effects in apple materials.

[0070] 1. Construction of MdPHY7 overexpression vector (OE-MdPHY7)

[0071] The pCAMBIA1300 vector was linearized by double digestion with XbaI and BamHI restriction endonucleases. The MdPHY7 gene was inserted into the pCAMBIA1300 expression vector to construct 35S::MdPHY7 (OE-MdPHY7) promoted by the 35S promoter. This vector was then transformed into Agrobacterium EHA105 or LBA4404 strains using the freeze-thaw method.

[0072] 2. OE-MdPHY7 transient conversion in apples promotes anthocyanin accumulation in the peel.

[0073] Agrobacterium containing the empty vector (EV) and overexpression of the 35S::MdPHY7 vector was inoculated into a solution containing 100 mg·L⁻¹ of [amount missing]. -1 Kan (kanamycin) and 100 mg / L -1 In LB (rifampicin) liquid medium, incubate with shaking at 28°C and 200 rpm until the bacterial culture reaches OD500. 600nmThe value reached approximately 0.5. The bacterial cells were separated by centrifugation, the supernatant was removed, and the cells were resuspended in a buffer solution containing 10 mM magnesium chloride, 10 mM 2-(N-morpholino)ethanesulfonic acid, and 120 μM acetosyringone. Agrobacterium was injected into the peel of 'Asus' apples using a disposable syringe. After injection, the apples were placed in the dark for 24 hours. Afterwards, they were transferred to a light source with an intensity of 200 μmol / m². - 2 s -1 The cells were continuously exposed to light in a photoculture chamber for 3 days. During this period, the accumulation of anthocyanins at the injection site was observed and photographed every 24 hours. The relative expression level of the MdPHY7 gene was detected by RT-PCR to obtain a transiently overexpressing MdPHY7 transgenic apple material (OE-MdPHY7). Samples were taken from the peel of the fruit after the transient injection of bacterial solution, and anthocyanins were extracted using 1% (v / v) hydrochloric acid-methanol solution. The OD value was then measured. 530 OD 620 and OD 650 The absorbance values ​​were measured, and the anthocyanin content was calculated. It was found that OE-MdPHY7 increased the anthocyanin content by 65% ​​(Table 5). This result indicates that overexpression of the MdPHY7 gene can significantly increase the anthocyanin content in apple peel.

[0074] Table 5. Anthocyanin content and relative expression level of MdPHY7 after transient transformation of apple peel with OE-MdPHY7 vector.

[0075]

[0076] Note: Anthocyanin content and gene expression levels in the table are the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0077] 3. The effect of OE-MdPHY7 transient infection on apple tissue culture seedling leaves on promoting anthocyanin accumulation and exogenous ALA treatment.

[0078] Using the same infection solution as for the injected fruit peel, leaves from 1-month-old 'Gala' tissue culture seedlings were placed in the infection solution containing Agrobacterium. A vacuum pump was used to forcefully inject Agrobacterium into the apple leaves (pressure set to -0.1 MPa, 5 minutes per extraction, repeated twice). Excess moisture was then blotted dry with filter paper. The leaves were then laid flat on a substrate containing 0.25 mg·L⁻¹ Agrobacterium. -1 Apple leaves treated with ALA were incubated overnight in dark MS solid medium, with MS medium without ALA as a control. The next day, apple leaves treated with different conditions were transferred to 17°C and 200 μmol / L MS medium. -2 s -1In a light-incubated culture chamber, the anthocyanin content of different leaves was measured after three days of continuous illumination. The results (Table 6) showed that the anthocyanin content of apple leaves transformed with OE-MdPHY7 was 76.8% higher than that of EV, while ALA treatment of EV leaves increased the anthocyanin content by 78.7%. Furthermore, treatment of OE-MdPHY7 leaves with exogenous ALA resulted in an anthocyanin content 291.6% higher than the EV control. These results indicate that the MdPHY7 gene can promote anthocyanin accumulation in apples, and exogenous ALA can further enhance anthocyanin accumulation by increasing MdPHY7 expression.

[0079] Table 6. Effects of ALA treatment on anthocyanin content in apple leaves transiently transformed by OE-MdPHY7 vector.

[0080]

[0081] Note: Anthocyanin content in the table is the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0082] 4. The effects of OE-MdPHY7 stable inheritance in 'Wang Lin' apple callus on promoting anthocyanin accumulation and exogenous ALA.

[0083] The OE-MdPHY7 recombinant plasmid was transformed into Agrobacterium LBA4404 and infected 'Wanglin' ​​apple callus. After kanamycin selection, stably genetically transformed OE-MdPHY7 apple callus was obtained. These callus tissues were then transformed into cells containing or without 0.25 mg / L... -1 In MS medium containing ALA, the sample was placed at 17°C under a light intensity of 200 μmol / m². -2 s -1 The cells were cultured continuously for 14 days in an incubator. The results (Table 7) showed that after transformation with the OE-MdPHY7 gene, the anthocyanin content in apple callus tissue was 101% higher than the EV control, while the anthocyanin content in callus tissue treated with exogenous ALA alone was 102% higher than that in EV. If OE-MdPHY7 was treated with ALA, the anthocyanin content in callus tissue was 528.7% higher than that in the EV control. These results indicate that ALA is located upstream of the MdPHY7 gene and regulates anthocyanin accumulation in apple fruit, leaves, and callus cells. Properly utilizing this characteristic can further enhance the fruit quality-improving effect of ALA, which has important application value in modern fruit tree production.

[0084] Table 7. Effects of ALA treatment on the anthocyanin content of apple callus stably transformed by OE-MdPHY7 vector.

[0085]

[0086] Note: Anthocyanin content in the table is the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0087] Example 3: Interference with MdPHY7 gene expression inhibits the accumulation of apple anthocyanins and the effect of exogenous ALA treatment.

[0088] 1. Preparation of interference-type recombinant plasmid P4-MdPHY7

[0089] To construct the RNAi-MdPHY7 vector, a specific sequence of the MdPHY7 gene was selected using the SMART online database based on the nucleotide sequence of the MdPHY7 gene:

[0090] atggcgtcaggagctcagtcgtcgggcacgagcaatatcaaggctcaccacaacacggagtctgtgagcaaagccattgctcagtacactgtagatgctcggctgcacgccgtgttcgagcagtc cggggagtccggcaagtcgttcgactactcgcagagcatgaaaaccaccaaagattccgtcccggagcagcagattacggcgtacctgtcgaagattcagaggggcggccatgtccaacctttcg The sequence is: ggtgcatgatggccgtggacgaagccacgttcggagtcattgcgtatagcgagaacgcacgcgacatgctcgacctaacgccgcagtcagtgccgatccttgaaaagccggagattctcacaattgggaccgacgtccgtacgctattcacaccgtcgagcgcggtgttgctggagaaggcatttggggctcgggagataacccttttgaacccgatttggatctggaaagccctt. Add attB1 and attB2 sequences (29 bp each) before the 5' end of the forward and reverse primers of this sequence. These sites undergo recombination with donor vectors containing attP1 and attP2 under the action of BP recombinase. Then, the gene fragment was recombined into the RNA interference vector P4 (pHELLSGATE4), replacing the ccdB gene, which is lethal to common E. coli strains, to obtain the recombinant plasmid RNAi-MdPHY7 expressing interference. This plasmid was then transformed into Agrobacterium EHA105 or LBA4404. However, when recombination occurs between the attB candidate gene fragment and the attP donor vector, two construction results can occur. One is the correct recombination required for the experiment, where the intron orientation remains unchanged. After transformation into plants, it can form hairpin structures and perform splicing functions. Figure 5 (Left side). Another is the trans-intron reaction between attB2 and attP2, which leads to an intron orientation reversal, resulting in erroneous recombination that loses its splicing function. Figure 5 (Right side). Therefore, the obtained recombinant plasmid should be verified by double enzyme digestion before transforming Agrobacterium. After the interference recombinant plasmid RNAi-MdPHY7 was verified to be correct by enzyme digestion, it was transformed into Agrobacterium EHA105 and LBA4404.

[0091] 2. RNAi-MdPHY7 transformation of apples inhibits anthocyanin accumulation in the pericarp.

[0092] Agrobacterium containing the empty vector (pHELLSGATE4, P4) and the interfering recombinant plasmid RNAi-MdPHY7 was inoculated into a solution containing 100 mg·L⁻¹. -1 Kan (kanamycin) and 100 mg / L -1 In LB broth containing rifampicin, the culture was incubated with shaking at 28°C and 200 rpm until the bacterial culture reached OD500. 600nm The value reached 0.5. Bacterial cells were separated by centrifugation, and the supernatant was removed. The cells were resuspended in a buffer containing 10 mM magnesium chloride, 10 mM 2-(N-morpholino)ethanesulfonic acid, and 120 μM acetosyringone. Agrobacterium was injected into the peel of 'Asus' apples using a disposable syringe. After injection, the apples were placed in the dark for 24 hours, and then transferred to a light source with an intensity of 200 μmol / m². -2 s -1 The apples were continuously treated with light in a photoincubator. After 5 days, the anthocyanin accumulation at the injection site was observed, photographed, and analyzed. The relative expression level of MdPHY7 was detected by RT-PCR to verify that MdPHY7 expression had been interfered with. The results showed that the anthocyanin content in the pericarp after RNAi-MdPHY7 injection was only 41% of that after injecting the empty P4 vector. Similarly, the relative expression level of MdPHY7 was only 37% of that of P4 (Table 8). This result indicates that interfering with the expression of the MdPHY7 gene will inhibit anthocyanin accumulation in apple pericarp.

[0093] Table 8. Anthocyanin content and relative expression level of MdPHY7 in apple peel transiently transformed with RNAi-MdPHY7 vector.

[0094]

[0095] Note: Anthocyanin content and gene expression levels in the table are the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0096] 3. Transient RNAi-MdPHY7 infection of apple tissue culture seedling leaves inhibits anthocyanin accumulation and exogenous ALA effects.

[0097] Using the same infection solution as for the injected fruit peel, leaves from 1-month-old 'Gala' tissue culture seedlings were cut and placed in an infection solution containing Agrobacterium. The solution was then forcefully injected into the apple leaves using a vacuum pump (pressure set to -0.1 MPa, 5 minutes each time, repeated twice). Excess moisture was then absorbed with filter paper, and the leaves were laid on a substrate containing 0.25 mg·L⁻¹ Agrobacterium. -1Leaves from different treatment groups were cultured overnight in dark on MS solid medium containing ALA, with MS medium without ALA as a control. The leaves were then placed at 17°C and 200 μmol / L. -2 s -1 The samples were continuously exposed to light in a photoculture chamber for 3 days. As shown in Table 9, the anthocyanin content in apple leaves after RNAi-MdPHY7 infection was only 53.8% of that of the uninfected vector, and exogenous ALA treatment could not reverse the decrease in anthocyanin content after MdPHY7 interference. This result indicates that interfering with the MdPHY7 gene can inhibit anthocyanin accumulation in apple leaves and completely block the ALA-induced anthocyanin accumulation effect, thus proving that MdPHY7 is a key gene for ALA-induced anthocyanin accumulation in apples. Fully utilizing this gene will contribute to the application of ALA in improving apple fruit quality.

[0098] Table 9. Effects of ALA treatment on anthocyanin content in apple leaves transiently transformed with RNAi-MdPHY7 vector.

[0099]

[0100] Note: Anthocyanin content in the table is the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

[0101] 4. The effect of RNAi-MdPHY7 infection on 'Wanglin' ​​apple callus inhibiting anthocyanin accumulation and ALA.

[0102] The RNAi-MdPHY7 recombinant plasmid was transformed into Agrobacterium LBA4404 and used to infect 'Wanglin' ​​apple callus. After kanamycin selection, stably transformed callus was obtained. These transgenic apple callus were then transferred to a culture medium containing or without 0.25 mg / L of [a specific culture medium]. -1 In MS medium containing ALA, the sample was placed at 17°C under a light intensity of 200 μmol / m². -2 s -1 The apple callus tissue was cultured under continuous light for 14 days in an incubator. The results showed that when the expression of the RNAi-MdPHY7 gene was interfered with, the anthocyanin content was only 25.7% of the unexpressed control. Even with exogenous ALA treatment, although the anthocyanin content in the callus tissue was slightly increased, the difference was not statistically significant (Table 10). These results further demonstrate that ALA is upstream of MdPHY7 and regulates anthocyanin accumulation in apples. This has important application value in improving fruit quality with ALA.

[0103] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

[0104] Table 10. Effects of ALA treatment on the anthocyanin content of apple callus stably transformed with RNAi-MdPHY7 vector.

[0105]

[0106] Note: Anthocyanin content in the table is the average of three biological replicates ± standard error. Different lowercase letters after the data indicate significant differences at the P=0.05 level.

Claims

1. MdPHY7 protein or MdPHY7 The application of genes in the positive regulation of apple anthocyanin synthesis; The amino acid sequence of the MdPHY7 protein is shown in SEQ ID NO.1; The MdPHY7 The gene nucleotide sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The sites that positively regulate and promote the synthesis of apple anthocyanins are one or more of the apple peel, leaves, or callus tissue.

3. A method for promoting the synthesis of apple anthocyanins, characterized in that, Includes the following steps: Apple tissue was infected with recombinant Agrobacterium containing an overexpression vector; the overexpression vector was inserted with... MdPHY7 Genes; the stated MdPHY7 The gene nucleotide sequence is shown in SEQ ID NO.

2.

4. MdPHY7 Application of gene fragments or interfering recombinant plasmids in inhibiting apple anthocyanin synthesis; The MdPHY7 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.3; The interfering recombinant plasmid insert contains the aforementioned MdPHY7 Gene fragments.

5. A method for inhibiting the synthesis of apple anthocyanins, characterized in that, Includes the following steps: Apple tissue was infected with recombinant Agrobacterium containing interfering recombinant plasmids; The interference-type recombinant plasmid insertion contains MdPHY7 Gene fragments; The MdPHY7 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.

3.

6. MdPHY7 protein associated with apple anthocyanin biosynthesis, MdPHY7 Gene, MdPHY7 The application of gene fragments, interfering recombinant plasmids, or the method described in claim 3 or 5 in the creation of apple germplasm with different anthocyanin contents; The amino acid sequence of the MdPHY7 protein is shown in SEQ ID NO.1; The MdPHY7 The gene nucleotide sequence is shown in SEQ ID NO.2; The MdPHY7 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.3; The interfering recombinant plasmid insert contains the aforementioned MdPHY7 Gene fragments; MdPHY7 protein associated with apple anthocyanin biosynthesis MdPHY7 The gene or the method described in claim 3 is used to promote the synthesis of apple anthocyanins; MdPHY7 Gene fragments, interfering recombinant plasmids, or the method described in claim 5 are used to inhibit apple anthocyanin synthesis.

Images