A molecular marker for detecting the oxidative stress ability of Tibetan sheep and its application
By discovering and verifying the SNP molecular marker at the 2157396 base of chromosome 19 in Tibetan sheep, the problem of lack of effective molecular markers in the existing technology is solved, and effective evaluation and improvement of the oxidative stress ability of Tibetan sheep is achieved, providing new resources and methods for auxiliary breeding of Tibetan sheep.
Patent Information
- Application Number
- CN202411253536.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-09
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-09-09
AI Technical Summary
In the prior art, there are not many molecular markers related to the oxidative stress ability of Tibetan sheep for assisted breeding. The lack of effective molecular markers makes it difficult to achieve the improvement of oxidative stress ability of Tibetan sheep.
A SNP molecular marker is provided, located at base 2157396 on chromosome 19, Oar_v4.0 version of the International Sheep Genome, and the mutated base is G or A. By detecting the genotype of this site, the antioxidant stress indicators of MDA, NO and T-AOC of Tibetan Sheep can be evaluated.
Through the analysis of the association between different genotypes and antioxidant stress indicators, it was found that the MDA of individuals with GG and GA genotypes was significantly higher than that of the AA genotype, and the NO and T-AOC of individuals with AA genotypes were significantly higher than that of the GG and GA genotypes, providing new methods for marker-assisted selection of antioxidant stress traits and assisted breeding of Tibetan sheep for non-diagnostic purposes.
Smart Images

Figure CN118853908B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology detection, and particularly relates to a molecular marker for detecting the oxidative stress ability of Tibetan sheep and its application. Background Art
[0002] Tibetan sheep is an important part of the grassland animal husbandry in the alpine pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau region are: high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, etc. Due to the harsh environment in the Qinghai-Tibet Plateau region, a series of non-specific reactions of Tibetan sheep will be caused, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one.
[0003] The antioxidant system is the main means to cope with the oxidative stress state. The antioxidant system consists of a series of antioxidant enzymes and non-enzyme antioxidants, including superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione-S-transferase (GST), glutathione peroxidase (GPx) and vitamin C (VC), etc. When an organism is under oxidative stress, a large amount of reactive oxygen species (ROS) are generated. The body regulates the antioxidant system to resist the oxidative damage brought by ROS and maintains normal physiological and life activities by scavenging excess ROS in the body. Environmental stress will trigger the generation of ROS in Tibetan sheep, damage the normal physiological functions and immune defense capabilities of body cells and tissues, and lead to oxidative stress or damage of the body. Tibetan sheep has a relatively perfect antioxidant system to resist the oxidative damage brought by ROS.
[0004] MDA, NO, and T-AOC are important indicators for detecting oxidative stress reactions. These indicators can evaluate the oxidative stress ability and health status of Tibetan sheep. By detecting the indicators of antioxidant stress, the oxidative stress response ability of Tibetan sheep can be timely discovered, and certain measures can be taken to improve its oxidative stress ability, so that it can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, providing a basis for the assisted breeding of Tibetan sheep.
[0005] Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material among individuals, and are a direct reflection of DNA-level genetic polymorphisms. The molecular marker technology can search for variant sites in genes at the gene level, discover the relationship between genes and traits through the association analysis between them and traits, and conduct early selection, thereby improving the selection efficiency and accuracy. It can fundamentally improve the oxidative stress ability of Tibetan sheep and has broad application value.
[0006] Therefore, molecular markers have laid a foundation for people to study the genetic mechanism of the oxidative stress ability of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in the breeding of Tibetan sheep is an important issue in this field. There are not many studies on using molecular markers related to the oxidative stress ability of Tibetan sheep for assisted breeding in the existing technology. It is particularly important to provide a molecular marker related to the oxidative stress ability of Tibetan sheep for use in molecular marker-assisted breeding of Tibetan sheep to screen Tibetan sheep with strong antioxidant stress ability. Summary of the Invention
[0007] The object of the present invention is to provide a molecular marker for detecting the oxidative stress ability of Tibetan sheep and its application.
[0008] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:
[0009] The present invention provides an SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 2,157,396th base on chromosome 19 of the international sheep genome version Oar_v4.0, and the mutated base is G or A.
[0010] Preferably, the genotype of Tibetan sheep with the mutated base G is GG or GA;
[0011] The genotype of Tibetan sheep with the mutated base A is AA;
[0012] The antioxidant stress index MDA of Tibetan sheep individuals with the GG genotype is significantly higher than that of GA and AA genotype individuals;
[0013] The antioxidant stress index MDA of Tibetan sheep individuals with the GA genotype is significantly higher than that of AA genotype individuals;
[0014] The antioxidant stress index NO of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals;
[0015] There is no significant difference in the antioxidant stress index NO between Tibetan sheep individuals with the GG and GA genotypes;
[0016] The antioxidant stress index T-AOC of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals;
[0017] The antioxidant stress index T-AOC of Tibetan sheep individuals with the GA genotype is significantly higher than that of GG genotype individuals.
[0018] The present invention also provides the application of the SNP molecular marker in marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.
[0019] The present invention also provides the application of the SNP molecular marker in the assisted breeding of Tibetan sheep.
[0020] The present invention also provides a primer pair for amplifying the SNP, and the primer pair is shown as SEQ ID NO.2-3.
[0021] The present invention also provides the application of the primer pair in the preparation of a product for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes.
[0022] The present invention also provides the application of the primer pair in the preparation of a product for the assisted breeding of Tibetan sheep.
[0023] The present invention also provides a method for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps:
[0024] (1) Extracting the genomic DNA of Tibetan sheep;
[0025] (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, and amplifying with the primer pair to obtain an amplification product;
[0026] (3) Performing genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; correlating the genotypes of Tibetan sheep with antioxidant stress indexes;
[0027] The antioxidant stress indexes include MDA, NO and / or T-AOC.
[0028] Preferably, the amplification system in step (2) is: 22 μL of GoldMix (green), 1 μL of each of the upstream and downstream primers, and 1 μL of template DNA;
[0029] The amplification program in step (2) is: 98 °C for 2 min; 98 °C for 10 s, 56 °C for 10 s, 72 °C for 10 s, a total of 40 cycles; 72 °C for extension for 2 min.
[0030] The present invention also provides a kit for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes and / or assisted breeding of Tibetan sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0031] Compared with the prior art, the present invention has the following beneficial effects:
[0032] In summary, the SNP molecular marker of the present invention is located at the 2,157,396th base on chromosome 19 of the international sheep reference genome version Oar_v4.0; the mutation type is G / A, named g2157396G>A, and there are three genotypes. When the 2,157,396th base on chromosome 19 is G, the genotype is GG or GA; when the 2,157,396th base on chromosome 19 is A, the genotype is AA. Through the correlation analysis of different genotypes with the antioxidant stress indexes MDA, NO, and T-AOC contents, it is found that the antioxidant stress index MDA of Tibetan sheep individuals with the GG genotype is significantly higher than that of GA and AA genotype individuals (p<0.05), and the antioxidant stress index MDA of Tibetan sheep individuals with the GA genotype is significantly higher than that of AA genotype individuals (p<0.05); the antioxidant stress index NO of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals (p<0.05), and there is no significant difference in the antioxidant stress index NO between GG and GA genotype Tibetan sheep individuals (p>0.05); the antioxidant stress index T-AOC of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals (p<0.05), and the antioxidant stress index T-AOC of Tibetan sheep individuals with the GA genotype is significantly higher than that of GG genotype individuals (p<0.05). By detecting the base at the 2,157,396th nucleotide site on chromosome 19 of Tibetan sheep, the contents of antioxidant stress indexes MDA, NO, and T-AOC of Tibetan sheep individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 It is the amplification product of the SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of replicates;
[0034] Figure 2 It is the peak map and sequence obtained after the PCR amplification product is purified and sequenced. DETAILED DESCRIPTION OF THE INVENTION
[0035] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0036] Example 1
[0037] 1 Sample collection
[0038] The samples were from Tibetan sheep populations under natural grazing conditions, including 58 from Gannan Tibetan Autonomous Prefecture, Gansu Province, 71 from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 49 from Shigatse City, Tibet Autonomous Region. 5 mL of fasting Tibetan sheep blood samples were collected from 178 sheep into clean coagulant-promoting vacuum blood collection tubes, left standing for 30 min, then centrifuged at 3500 r / min for 15 min. The supernatant was aspirated into a clean PE tube, sealed and stored in a -20°C low-temperature refrigerator. Another 5 mL of blood samples were collected into blood collection tubes containing EDTA-K2 anticoagulant, quickly mixed after blood sample collection, placed in a sampling box with ice packs for temporary storage, and frozen in a -20°C refrigerator after being transported back to the laboratory for genomic DNA extraction.
[0039] 2 Main Reagents and Instruments
[0040] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; Blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; Gold Medal Mix (green) was purchased from Beijing Tsingke Biotechnology Co., Ltd.; Electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Kits for detecting malondialdehyde MDA (A003-1-2), NO (A012-1-2), and T-AOC (A015-2-1) were purchased from Nanjing Jiancheng Bioengineering Institute.
[0041] 3 Methods
[0042] 3.1 Detection of MDA, NO, and T-AOC in Serum
[0043] The determination of MDA was carried out by the TBA method according to the MDA detection kit of Nanjing Jiancheng Bioengineering Institute. The determination steps were as follows: (1) Add 0.2 mL of absolute ethanol and 0.2 mL of Reagent 1 to the blank tube, 0.2 mL of 10 nmo / mL standard product and 0.2 mL of Reagent 1 to the standard tube, 0.2 mL of the serum to be tested and 0.2 mL of Reagent 1 to the determination tube, and 0.2 mL of the serum to be tested and 0.2 mL of Reagent 1 to the control tube, and shake well; (2) Add 3 mL of Reagent 2 and 1 mL of Reagent 3 to the blank tube, standard tube, and determination tube, and add 3 mL of Reagent 2 and 1 mL of 50% glacial acetic acid to the control tube. After vortex mixing, water bath at 95°C for 40 minutes, take out and cool with running water, then centrifuge at 4000 revolutions per minute for 10 minutes; (3) Take the supernatant and measure the absorbance value of each tube at 532 nm; (4) Calculate the MDA content according to the formula provided in the kit instruction manual.
[0044] The NO detection kit of Nanjing Jiancheng Bioengineering Research Institute was used for determination by the nitrate reductase method. The determination steps were as follows: (1) Add 0.1 mL of double-distilled water and 0.4 mL of mixed reagent (reagent one and reagent two were mixed at a ratio of 1:1) to the blank tube, add 100 μmol / L standard product application solution and 0.4 mL of mixed reagent to the standard tube, and add 0.1 mL of the serum to be tested and 0.4 mL of mixed reagent to the determination tube. After mixing, incubate in a water bath at 37 °C for 60 min; (2) Add 0.2 mL of reagent three and 0.1 mL of reagent four to the blank tube, standard tube and determination tube, vortex thoroughly for 30 s, let stand at room temperature for 40 min, and centrifuge at 3500 r / min for 10 min; (3) Take 0.5 mL of the supernatant, add 0.6 mL of the chromogenic agent, mix well and let stand at room temperature for 10 min, and measure the absorbance value of each tube at a wavelength of 550 nm; (4) Calculate the NO content according to the formula provided in the kit instruction manual.
[0045] The T-AOC detection kit of Nanjing Jiancheng Bioengineering Research Institute was used for determination by the ABTS method. The determination steps were as follows: (1) Add 10 μL of double-distilled water and 20 μL of reagent four application solution (reagent one and peroxidase were mixed at a ratio of 9:1) to the blank tube, add 10 μL of MTrolox solutions with different concentrations and 20 μL of reagent four application solution to the standard tube, and add 10 μL of the serum to be tested and 20 μL of reagent four application solution to the determination tube; (2) Add 170 μL of ABTS working solution (reagent one: reagent two: reagent three application solution = 76:5:4) to the blank tube, standard tube and determination tube; (3) React at room temperature for 6 min, and use a microplate reader to read the OD value of each well at a wavelength of 405 nm; (4) Make a standard curve with the OD of the standard product and obtain the curve formula, and substitute the OD measured in the sample determination tube into the calculation formula to obtain the result.
[0046] 3.2 Extraction of blood genomic DNA
[0047] The blood genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood sample. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. When the concentration > 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, it met the experimental requirements and was stored at -20 °C for standby.
[0048] 3.3 Primer design
[0049] Referring to the gene sequence of chromosome 19 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019476.2), a pair of specific primers containing the g2157396G>A SNP locus was designed using the primer premier 5.0 software.
[0050] Primer sequence:
[0051] F: 5'-GCACATTTACTGTCCGTCCA-3';
[0052] R: 5'-TTCCCGTGTTTTCAGTCTCA-3'.
[0053] (as shown in SEQ ID No.2 and 3)
[0054] The amplified fragment length is 359 bp, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.
[0055] 3.4 PCR Amplification and Sequencing
[0056] The PCR amplification system was 25 μL: 22 μL of GoldMix (green), 1 μL each of the upstream and downstream primers, and 1 μL of the template.
[0057] The PCR amplification program was: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; 72°C for 2 min of extension.
[0058] The PCR products were detected by 1.5% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, direct sequencing was used for sequencing, which was completed by Beijing Tsingke Biotechnology Co., Ltd. The amplified nucleotide sequence is as shown in SEQ ID No.1, and the SNP marker is located at position 229 of the nucleotide sequence shown in SEQ ID No.1.
[0059] The sequencing results of the PCR products were aligned using the biological analysis software MEGA 6.0, and the sequencing peak maps were analyzed to complete the genotyping.
[0060] SEQ ID No.1
[0061] GCACATTTACTGTCCGTCCACCATGTGCTGGACACTGTGCTAAGTGTTGAGGTTGTAGTGATGAGGAAAACAGTGGGGGGAATAATGCCTTTCAAATAAACATATATTTAAATGCATAATTAATGACATGATAAGGACACTGTGGGCAAGTACAGGGATCACTGGCAGAGCTATCTGGCT TATTTGAGAGGTTAGTAAACATTCTTTGAGAATGAAATCTTGGAATCAGGATCTGCTAGGCAAGGGGACTTATGGAAAAGAGCTTGTGCAAAGGTCCTGGGACAAGGAGAATCTTCAGTCTTTGGAGCAAAGACTGGCCAAAGCAAGAGTGATAGGAGATGAGACTGAAAACACGGGAA.
[0062] 4 Statistical analysis
[0063] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g2157396G>A gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphisminformation content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the antioxidant stress indicators MDA, NO, and T-AOC, and the results were expressed as "mean ± standard error".
[0064] 5 Results
[0065] 5.1 PCR amplification and sequencing results
[0066] The amplified product of the g2157396G>A SNP site on chromosome 19 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 359 bp, which was in line with the expected size, so the next step of the experiment could be carried out.
[0067] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the GA mutation occurred at the g2157396G>ASNP site, and there are three genotypes: GG, GA, and AA.
[0068] 5.2 Statistical analysis results
[0069] The genotypes and allele frequencies of the g2157396G>A SNP locus on chromosome 19 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g2157396G>A SNP locus, the GG genotype frequency was the highest, being the dominant genotype, and the G allele frequency was 61.5%, showing the dominant allele. The χ2 goodness-of-fit test indicated that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.899, and the PIC was 0.361. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.
[0070] Table 1 Polymorphism of the g2157396G>A SNP locus on chromosome 19 of Tibetan sheep
[0071]
[0072] 5.3 Association analysis of different genotypes with antioxidant stress indices malondialdehyde (MDA), nitric oxide (NO), and total antioxidant capacity (T-AOC)
[0073] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the contents of antioxidant stress indices MDA, NO, and T-AOC. The results showed that the antioxidant stress index MDA of Tibetan sheep individuals with the GG genotype was significantly higher than that of GA and AA genotype individuals (p<0.05), and the antioxidant stress index MDA of Tibetan sheep individuals with the GA genotype was significantly higher than that of AA genotype individuals (p<0.05); the antioxidant stress index NO of Tibetan sheep individuals with the AA genotype was significantly higher than that of GG and GA genotype individuals (p<0.05), and there was no significant difference in the antioxidant stress index NO between Tibetan sheep individuals with the GG and GA genotypes (p>0.05); the antioxidant stress index T-AOC of Tibetan sheep individuals with the AA genotype was significantly higher than that of GG and GA genotype individuals (p<0.05), and the antioxidant stress index T-AOC of Tibetan sheep individuals with the GA genotype was significantly higher than that of GG genotype individuals (p<0.05). This indicated that the base at the g2157396G>A SNP locus on chromosome 19 of Tibetan sheep was significantly correlated with MDA, NO, and T-AOC of Tibetan sheep, and it was an SNP marker related to MDA, NO, and T-AOC of Tibetan sheep. The results are shown in Table 2.
[0074] Table 2 Correlation analysis between different genotypes and antioxidant stress indices MDA, NO, and T-AOC
[0075]
[0076]
[0077] Note: Different lowercase letters marked between data in the same row indicate significant differences (P < 0.05).
[0078] In summary, the SNP molecular marker described in the present invention is located at the 2,157,396th base on chromosome 19 of the international sheep reference genome Oar_v4.0 version; the mutation type is G / A, named g2157396G>A, and there are three genotypes. When the 2,157,396th base on chromosome 19 is G, the genotype is GG or GA; when the 2,157,396th base on chromosome 19 is A, the genotype is AA; through the correlation analysis of different genotypes with the antioxidant stress indexes MDA, NO, and T-AOC contents, it is found that the antioxidant stress index MDA of Tibetan sheep individuals with the GG genotype is significantly higher than that of GA and AA genotype individuals (p < 0.05), and the antioxidant stress index MDA of Tibetan sheep individuals with the GA genotype is significantly higher than that of AA genotype individuals (p < 0.05); the antioxidant stress index NO of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals (p < 0.05), and there is no significant difference in the antioxidant stress index NO between GG and GA genotype Tibetan sheep individuals (p > 0.05); the antioxidant stress index T-AOC of Tibetan sheep individuals with the AA genotype is significantly higher than that of GG and GA genotype individuals (p < 0.05), and the antioxidant stress index T-AOC of Tibetan sheep individuals with the GA genotype is significantly higher than that of GG genotype individuals (p < 0.05). By detecting the base at the 2,157,396th nucleotide site on chromosome 19 of Tibetan sheep, the contents of antioxidant stress indexes MDA, NO, and T-AOC of Tibetan sheep individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, provides a basis for screening Tibetan sheep with strong antioxidant stress ability, and provides a new direction for the assisted breeding of Tibetan sheep.
[0079] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SNP molecular markers in the preparation of a Tibetan sheep anti-oxidative stress trait auxiliary breeding detection reagent, characterized in that: The SNP molecular marker is shown in SEQ ID No. 1, and the base at the 229th base is mutated to G or A; the genotype of the Tibetan sheep with the mutated base G is GG or GA; the genotype of the Tibetan sheep with the mutated base A is AA; The anti-oxidative stress index MDA of the Tibetan sheep individuals with the GG genotype was significantly higher than that of the individuals with the GA and AA genotypes; The anti-oxidative stress index MDA of the Tibetan sheep individuals with the GA genotype was significantly higher than that of the individuals with the AA genotype; The anti-oxidative stress index NO of Tibetan sheep individuals with AA genotype was significantly higher than that of individuals with GG and GA genotypes; There was no significant difference in the antioxidant stress index NO between the Tibetan sheep individuals with the GG and GA genotypes; The anti-oxidative stress index T-AOC of Tibetan sheep individuals with the AA genotype was significantly higher than that of individuals with the GG and GA genotypes; The anti-oxidative stress index T-AOC of the Tibetan sheep individuals with the GA genotype is significantly higher than that of the individuals with the GG genotype.
2. The use according to claim 1, characterized in that: The reagent for detecting the SNP molecular marker is a primer pair, and the primer pair is shown in SEQ ID NO.2~3.
3. A method for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Tibetan sheep genomic DNA; (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pairs shown in SEQ ID NOs. 2-3 to obtain an amplified product; (3) performing genotyping analysis on the amplified product to obtain Tibetan sheep with different genotypes; and correlating the genotype of the Tibetan sheep with an anti-oxidative stress index; The primer pair is used to amplify a SNP molecular marker, and the SNP molecular marker is shown in SEQ ID No. 1, and the base at the 229th base thereof is mutated to G or A; the genotype of the Tibetan sheep with the mutated base G is GG or GA; the genotype of the Tibetan sheep with the mutated base A is AA; The anti-oxidative stress index MDA of the Tibetan sheep individuals with the GG genotype was significantly higher than that of the individuals with the GA and AA genotypes; The anti-oxidative stress index MDA of the Tibetan sheep individuals with the GA genotype was significantly higher than that of the individuals with the AA genotype; The anti-oxidative stress index NO of Tibetan sheep individuals with AA genotype was significantly higher than that of individuals with GG and GA genotypes; There was no significant difference in the antioxidant stress index NO between the Tibetan sheep individuals with the GG and GA genotypes; The anti-oxidative stress index T-AOC of Tibetan sheep individuals with the AA genotype was significantly higher than that of individuals with the GG and GA genotypes; The anti-oxidative stress index T-AOC of the Tibetan sheep individuals with the GA genotype is significantly higher than that of the individuals with the GG genotype.
4. The method according to claim 3, characterized in that: The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.
Citation Information
Patent Citations
Genetic marker relevant to high altitude hypoxia adaptability of Tibetan sheep and application of genetic marker
CN107988379A
Molecular marker for screening oxidative stress resistance of sheep and application of molecular marker
CN117051116A