A KASP marker tightly linked to the genetic locus of copper content in wheat grains and its application
By developing KASP markers closely linked to the genetic sites of wheat grain copper content, using KASP primer combination and fluorescence quantitative PCR technology, the problem of inefficient screening of grain copper content in wheat breeding was solved, and rapid screening and breeding efficiency were achieved.
Patent Information
- Application Number
- CN202411039366.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-31
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-07-31
AI Technical Summary
The prior art is difficult to effectively screen and improve the copper content in wheat grains, resulting in inefficiency and unstable quality during breeding.
A KASP marker closely linked to the genetic site of the copper content of wheat grains was developed, and the marker was used to quickly screen and distinguish wheat germplasms with high copper and low copper content by KASP primer combination and fluorescence quantitative PCR technology.
The rapid and accurate screening of the copper content of wheat grains has been achieved, which significantly improves breeding efficiency and can effectively improve the copper content of grains, thereby improving wheat quality and food security.
Smart Images

Figure CN118853936B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of wheat molecular genetic breeding, and particularly relates to a KASP marker closely linked to a genetic locus of wheat grain copper content and its application. Background Art
[0002] Wheat (Triticum aestivum L., 2n = 6x = 42., AABBDD) is one of the important food crops globally. Copper is an essential trace element for crop growth and development, which constitutes the components of life, participates in cell metabolism, regulates hormone signals and photosynthesis, etc., and affects the yield and quality of plants. However, more than about 30% of the cultivated land soil globally is copper-deficient, resulting in reduced grain yields and copper contents of crops such as wheat. The copper ingested by humans through diet mainly comes from cereal crops, and copper deficiency can cause various human diseases, such as anemia, decreased immunity, and poor bone development. Therefore, maintaining an appropriate grain copper content is of great significance for wheat quality and food security.
[0003] The copper content in wheat grains belongs to a complex quantitative trait. The investigation of this trait must be carried out after the wheat is mature and dried, and the measurement method is cumbersome, which is not conducive to the screening and elimination of a large number of plants in the wheat breeding process, greatly limiting the molecular breeding process of wheat trace element improvement. Although some genetic loci controlling the copper content in wheat grains have been reported currently, there is a lack of molecular markers available for breeding, and it is urgent to explore molecular markers closely linked to the copper content in wheat grains, so as to shorten the breeding time and improve the breeding efficiency.
[0004] Kompetitive Allele Specific PCR technology (KASP) has the advantages of low cost, high throughput, and strong operability. It is a high-throughput genotyping technology mainly based on SNPs developed in recent years and has been widely used in molecular marker-assisted selection of crops such as wheat. Therefore, developing a KASP molecular marker closely linked to the genetic locus of wheat grain copper content and using this marker to screen wheat lines with appropriate grain copper content is of great significance for the breeding improvement of wheat trace element accumulation. Summary of the Invention
[0005] The object of the present invention is to provide a KASP marker closely linked to a genetic locus of wheat grain copper content and its application to solve the problems existing in the above-mentioned prior art. This KASP marker is closely linked to the genetic locus of wheat grain copper content, and this marker can be used to quickly screen and distinguish wheat germplasms with high and low copper contents in grains, realizing molecular marker-assisted breeding.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a KASP marker closely linked to the genetic locus of copper content in wheat grains. The nucleotide sequence of the KASP marker is shown in SEQ ID NO.34; there is a SNP site at the 21st bp of the nucleotide sequence, which is a C / T mutation.
[0008] The present invention also provides a KASP primer combination for identifying the trait of copper content in wheat grains, including two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.13 and SEQ ID NO.14 respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.15.
[0009] The present invention also provides the application of the above KASP primer combination in the preparation of a product for identifying the trait of copper content in wheat grains.
[0010] Furthermore, the product is a kit.
[0011] The present invention also provides a product for identifying the trait of copper content in wheat grains, including the above KASP primer combination.
[0012] Furthermore, the product is a kit.
[0013] The present invention also provides the application of the above KASP marker, KASP primer combination or product in identifying the trait of copper content in wheat grains.
[0014] The present invention also provides a method for identifying the trait of copper content in wheat grains, including the following steps:
[0015] Extract the DNA of the wheat to be tested;
[0016] Using the DNA as a template, perform fluorescence quantitative PCR amplification with the above KASP primer combination to obtain the genotype of the wheat to be tested, and judge the trait of copper content in the wheat to be tested according to the genotype: the copper content in the grains of CC genotype wheat is higher than that of TT genotype wheat.
[0017] Furthermore, the reaction system for the fluorescence quantitative PCR amplification is: 1 μL of DNA template, 5 μL of HiGeno 2×probemix B, 1.4 μL of KASP primer combination and 2 2.6 μL of ddH
[0018] Furthermore, the reaction program for the fluorescence quantitative PCR amplification is: pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 20 s, annealing at 61 °C for 45 s, with a decrease of 0.6 °C for each cycle, for a total of 10 cycles; denaturation at 95 °C for 20 s, annealing at 55 °C for 45 s, for a total of 32 cycles, and extension at 25 °C for 1 min.
[0019] The present invention discloses the following technical effects:
[0020] In the present invention, a residual heterozygous line population was used as the research material. Thirty plants with high copper content and thirty plants with low copper content in the population were selected, and DNA bulks were constructed respectively for BSA-seq analysis. One hundred and three residual heterozygous line individuals were genotyped, and a genetic linkage map was constructed. The gene for grain copper content was preliminarily mapped between 49.00 - 145.97 Mb on chromosome 2B. Based on the SNPs obtained from BSA-seq, 11 pairs of KASP primers were designed for genotyping. Combining the grain copper content phenotypes of the residual heterozygous lines and their offspring populations, it was finally determined that the molecular marker KASP-52.32 (developed based on the C / T difference at the 52324075th base on chromosome 2B) was tightly linked to the genetic locus of wheat grain copper content; among them, the grain copper content of wheat with the CC genotype was extremely significantly higher than that of wheat with the TT genotype.
[0021] In the present invention, two natural populations were genotyped using the molecular marker KASP-52.32. Combining with the phenotypic identification of grain copper content, it was found that the average grain copper content of wheat varieties with the CC genotype was extremely significantly higher than that of wheat varieties with the TT genotype. This indicates that this marker can be used for rapid screening and discrimination of wheat germplasms with high and low grain copper contents, realizing molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0023] Figure 1 It is the preliminary mapping result diagram of the QTL interval for wheat grain copper content; among them, Figure A is the SNP enrichment diagram; Figure B is the G’ value analysis diagram;
[0024] Figure 2 It is the fine mapping diagram of the QTL QGr_Cu_Conc-2B for wheat grain copper content; among them, A and B are respectively the mapping results of the grain copper content of 2023_RHL and 2024_RHL on chromosome 2B;
[0025] Figure 3 It is the genotyping and grain copper content statistical result diagram of the molecular marker KASP-52.32 in 2024_RHL; among them, A - C are the genotyping results of the molecular marker KASP-52.32 in 2024_RHL; D is the difference diagram of the grain cadmium content of CC, CT, and TT type lines in 2024_RHL;
[0026] Figure 4 It is a diagram showing the differences in grain copper content among various types after genotyping of the molecular marker KASP-52.32 in the wheat natural population; among them, A shows the differences in grain copper content of the wheat natural population collected from Eurasia between 30° and 45° north latitude and planted in Wenjiang, Sichuan in 2018-2019, B shows the differences in grain copper content of the wheat natural population collected from Eurasia between 30° and 45° north latitude and planted in Chongzhou, Sichuan in 2018-2019, and C shows the differences in grain copper content of the wheat natural population collected from Sichuan and Henan regions of China and planted in Wenjiang, Sichuan in 2021-2022. Detailed implementation manners
[0027] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation manners of the present invention.
[0028] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0030] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are also obvious to those skilled in the art. The present invention specification and examples are only exemplary.
[0031] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, that is, they are intended to include but not limited to.
[0032] Example 1 Obtaining of the genetic locus of wheat grain copper content and its closely linked molecular marker KASP-52.32
[0033] (1) Construction of residual heterozygous lines
[0034] Using dwarf Polish wheat as the female parent and Jianyang Ailan wheat as the male parent, the hybrid F1 was obtained by hybridization. The individual plants of the F1 generation were self-crossed to obtain F2. One individual plant was randomly selected from F2 and crossed with Xikemai 11, and then crossed with Shumai 133. The individual plants of the F3 generation of the hybrid offspring were crossed with the individual plants of the F3 generation formed by crossing with K1041 and Chuanmai 64. Finally, continuous self-crossing was carried out to form the F5 generation, and a residual heterozygous single plant line containing 103 individual plants (abbreviated as 2023_RHL) was selected from the F5 generation as the mapping population. 2-3 individual plants were selected from the heterozygous individual plants of each line in the self-crossed offspring of 2023_RHL, with a total of 243 plants, to form the validation population (abbreviated as 2024_RHL).
[0035] (2) Determination of grain copper content in the residual heterozygous population
[0036] The plants of the residual heterozygous lines 2023_RHL and 2024_RHL were planted in the field. At the mature stage, the grains were harvested, blanched at 105 °C for 30 minutes and then dried to a constant weight at 80 °C. After weighing the dry weight, they were ground and sieved. 0.2 g of the sample was weighed, 5 mL of mixed acid (HClO 4 / HNO 3 = 1:4) was added and digested for 12 h, and heated and digested on an electric hot plate at 220 °C for 4 h until the solution was clear and transparent and less than 1 mL. After volume-fixing with 1% dilute nitric acid and filtering, the copper content was determined by inductively coupled plasma mass spectrometry (ICP-MS).
[0037] (3) BSA analysis
[0038] In the residual heterozygous line 2023_RHL, 30 plants with high and low grain copper content were selected respectively to construct DNA mixed pools for BSA-seq analysis. This analysis was completed by Chengdu Tiancheng Future Technology Co., Ltd. Combining the SNP variation density enrichment map and the G' value statistical algorithm, the grain copper content gene was initially mapped between 49.00 - 145.97 Mb on chromosome 2B( Figure 1 ).
[0039] 4. Fine mapping of QGr_Cu_Conc-2B and obtaining of the tightly linked marker KASP-52.32
[0040] According to the SNP information obtained by BSA-seq, 11 pairs of KASP primers (Table 1) were developed. The DNA of each plant in the residual heterozygous line was extracted by the CTAB method and used as a template, and the KASP marker PCR amplification was carried out using a fluorescence quantitative PCR instrument.
[0041] The reaction system for fluorescence quantitative PCR is as follows: 1 μL of DNA template, 5 μL of HiGeno 2×probe mix B (purchased from Beijing Jiacheng Biotechnology Co., Ltd.), 1.4 μL of specific primers (0.168 μM forward FAM primer mixture, 0.168 μM forward HEX primer mixture, and 0.42 μM universal reverse primer), and 2.6 μL of ddH 2 O₂. The reaction program for fluorescence quantitative PCR is: pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 20 s, annealing at 61 °C for 45 s, with a decrease of 0.6 °C for each cycle, for a total of 10 cycles; denaturation at 95 °C for 20 s, annealing at 55 °C for 45 s, for a total of 32 cycles, and extension at 25 °C for 1 min. The software Bio-Rad CFX Manager 3.1 was used for reading and analyzing fluorescence data.
[0042] Table 1 KASP primer sequences
[0043]
[0044]
[0045] JoinMap 4.0 was used for constructing the linkage map; combined with the phenotypic identification of grain copper content, IciMapping4.2 was used to calculate QTL. Combining the phenotypic identification of grain copper content, QGr_Cu_Conc-2B was mapped between KASP-52.32 and KASP-56.57, and the physical position of this interval is between 52.32-56.57 Mb on chromosome 2B ( Figure 2 ). According to the detection results of 11 pairs of KASP markers, KASP-52.32 is most closely linked to the genetic locus of grain copper content; according to the genotypes of the remaining heterozygous lines of the tightly linked marker KASP-52.32, most plants in 2024_RHL were divided into CC genotype (82 plants) and TT genotype (145 plants), and a small number of plants were divided into CT genotype (heterozygous, 16 plants). The average grain copper content of CC genotype plants was 5.42 mg / kg, which was 11.15% higher than that of TT genotype (4.88 mg / kg), and the difference was extremely significant; while the grain copper content of CT genotype plants had no significant difference from that of CC or TT genotype plants ( Figure 3 ). Therefore, KASP-52.32 is a molecular marker closely linked to wheat grain copper content.
[0046] The nucleotide sequence (SEQ ID NO.34) of the molecular marker KASP-52.32 is:
[0047] CAGTGCCATCATATATTGCCYAGTTGTTGACACTAGTCGTGGCAAATGGGCTAGCAGTATGAGCATGCCCATCTATTATCTGTGCCTGGTTGGAGTTCTCTCCATTAAAGATTCGGCGCA, where Y is C or T.
[0048] Application of Molecular Marker KASP-52.32 in Screening Wheat Materials with High and Low Copper Contents in Grains
[0049] Two natural populations were genotyped using the molecular marker KASP-52.32. Population 1 included 101 wheat germplasms collected from Eurasia between 30° and 45° north latitude (named NCW E30°N-45°N ), and Population 2 included 134 cultivar materials collected from wheat production areas in Sichuan and Henan, China (named NCW SH_China ). After planting the above materials in the field, the copper contents in the grains of the above wheat populations were determined according to the method in Example 1 (Tables 2 - 4), and fluorescence PCR detection and analysis were carried out using the primers of KASP-52.32. According to the detection results, the copper content in the grains of wheat with the CC genotype was significantly higher than that of the TT genotype ( Figure 4 ). The above results indicate that the SNP molecular marker KASP-52.32 can be used to quickly and accurately screen out the lines with higher and lower copper contents in grains, improving the breeding efficiency.
[0050] Table 2 Grain Copper Contents and Genotyping Results of Molecular Marker KASP-52.32 for the Wheat Natural Population Collected from Eurasia between 30° and 45° North Latitude Planted in Wenjiang, Sichuan in 2018 - 2019
[0051]
[0052]
[0053]
[0054] Table 3 Grain Copper Contents and Genotyping Results of Molecular Marker KASP-52.32 for the Wheat Natural Population Collected from Eurasia between 30° and 45° North Latitude Planted in Chongzhou, Sichuan in 2018 - 2019
[0055]
[0056]
[0057]
[0058] Table 4 Genotyping results of grain copper content and molecular marker KASP-52.32 for the natural wheat population collected from Sichuan and Henan regions of China and planted in Wenjiang, Sichuan in 2021-2022
[0059]
[0060]
[0061]
[0062]
[0063] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A KASP primer combination for identifying the copper content trait of wheat grains, characterized in that: It comprises two forward primers and a universal reverse primer; the nucleotide sequences of the two forward primers are shown as SEQ ID NO.13 and SEQ ID NO.14 respectively, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.
15.
2. Use of the KASP primer combination as claimed in claim 1 in preparing a product for identifying the copper content trait of wheat grains.
3. The use according to claim 2, characterized in that: The product is a test kit.
4. A product for identifying the copper content of wheat grains, characterized in that: Comprising the KASP primer combination according to claim 1.
5. The product according to claim 4, characterized in that The product is a test kit.
6. Use of the KASP primer combination according to claim 1 or the product according to claim 4 or 5 in identifying the copper content trait of wheat grains, characterized in that: The grain copper content trait of the wheat to be tested is determined according to the genotype: the grain copper content of CC genotype wheat is higher than that of TT genotype wheat.
7. A method for identifying the copper content of wheat grains, characterized in that: The following steps are involved: Extracting the DNA of the wheat to be tested; The DNA is used as a template and the KASP primer combination of claim 1 is used to perform fluorescent quantitative PCR amplification to obtain the genotype of the wheat to be tested, and the grain copper content trait of the wheat to be tested is determined according to the genotype: the grain copper content of CC genotype wheat is higher than that of TT genotype wheat.
8. The method according to claim 7, characterized in that The reaction system of the fluorescent quantitative PCR amplification is: 1 μL of DNA template, 5 μL of HiGeno 2×probe mix B, 1.4 μL of KASP primer combination and 2.6 μL of ddH2O.
9. The method according to claim 8, characterized in that The reaction procedure of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 20 s, annealing at 61°C for 45 s, decreasing 0.6°C in each cycle, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing at 55°C for 45 s, for a total of 32 cycles, and extension at 25°C for 1 min.
Citation Information
Patent Citations
CCX2-4B gene for controlling cadmium accumulation of wheat grains as well as molecular marker and application of CCX2-4B gene
CN116891860A
SNP molecular marker related to wheat grain protein content, KASP primer pair and application of SNP molecular marker and KASP primer pair
CN117887890A