Phosphoester backbone modified nucleotides and oligonucleotides

Abstract

The present disclosure provides a nucleotide and oligonucleotide modified with a phosphoester backbone, belonging to the technical field of small nucleic acid drug delivery. The present disclosure provides a double-stranded oligonucleotide and a conjugate thereof, wherein the double-stranded oligonucleotide contains at least one nucleotide modified with a phosphoester backbone, and the nucleotide modified with a phosphoester backbone has the effect of enhancing the activity of the double-stranded oligonucleotide and can improve the metabolic stability of the double-stranded oligonucleotide in vivo.

Description

Technical Field

[0001] The present disclosure relates to the technical field of small nucleic acid drug delivery, and in particular to a nucleotide and oligonucleotide modified with a phospholipid backbone. Background Art

[0002] Currently, one of the commonly used modifications to improve RNAi metabolic stability or long-term activity is phosphorothioate (PS) modification. However, oligonucleotides (including siRNA) that rely solely on phosphorothioate modification will still be degraded by endogenous nucleases, resulting in a rapid decrease in activity in vivo.

[0003] Therefore, new modifications are still needed in the field of RNAi therapy, such as forming a new phosphate backbone structure at the 5' or 3' end of oligonucleotides (including siRNA, miRNA and antisense oligonucleotides, etc.) to provide the oligonucleotides with more lasting activity or higher metabolic stability in vivo. Summary of the invention

[0004] The present disclosure provides a double-stranded oligonucleotide and a conjugate thereof, wherein the double-stranded oligonucleotide contains nucleotides modified with a phosphoester backbone, and the nucleotides modified with a phosphoester backbone can enhance the efficacy of the oligonucleotide, improve the activity and / or long-term effect, and improve the metabolic stability in vivo.

[0005] In a first aspect of the present disclosure, the present disclosure provides a double-stranded oligonucleotide, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand each independently have a length of 15-35 nucleotides, and each nucleotide in the double-stranded oligonucleotide is each independently selected from a modified nucleotide or an unmodified nucleotide.

[0006] Wherein, the double-stranded oligonucleotide contains at least one nucleotide modified with a phosphoester backbone, and the nucleotide modified with a phosphoester backbone has a structure represented by formula (IA), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0007]

[0008] wherein X is selected from methylene, O or S;

[0009] Z is selected from hydroxyl or thiol;

[0010] Base is selected from a nucleotide base or an analog thereof;

[0011] R1, R2, R3, and R4 are each independently selected from H, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, and at least one of R1 and R2 is selected from substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy;

[0012] R5 is selected from halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy;

[0013] R6 is selected from H, halogen, substituted or unsubstituted C1-C6 alkyl.

[0014] In some optional embodiments, one of R1, R2, R3, and R4 is selected from halogen, substituted or unsubstituted C1-C6 alkyl, and substituted or unsubstituted C1-C6 alkoxy.

[0015] In some optional embodiments, one of R1 and R2 is selected from halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy; and R1 and R2 are different.

[0016] In some optional embodiments, R1 is selected from halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, and R2, R3, and R4 are selected from H. Preferably, R1 is selected from halogen, C1-C3 alkyl.

[0017] In some optional embodiments, R1 is selected from F, methyl, ethyl, methoxy or ethoxy, and R2, R3, and R4 are selected from H.

[0018] In some optional embodiments, R1 is selected from methyl or ethyl, and R2, R3, and R4 are selected from H.

[0019] In some specific embodiments, R1 is selected from methyl, and R2, R3, and R4 are selected from H.

[0020] In some optional embodiments, the nucleotide modified with a phosphoester backbone has a structure represented by Formula (IIA), Formula (IIA-1) or Formula (IIA-2), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0021] , , .

[0022] In some specific embodiments, X is selected from O.

[0023] In some alternative embodiments, Base is selected from the nucleobases A, U, G, C, T.

[0024] In some alternative embodiments, R5 is selected from F, methyl, ethyl, methoxy or ethoxy.

[0025] In some alternative embodiments, R5 is selected from methoxy or ethoxy.

[0026] In some specific embodiments, R5 is selected from methoxy.

[0027] In some alternative embodiments, R6 is selected from H, F, methyl or ethyl.

[0028] In some specific embodiments, R6 is selected from H.

[0029] In a specific embodiment of the present disclosure, the nucleotide modified with a phosphoester backbone is selected from any of the following structures, or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0030] , , .

[0031] In some alternative embodiments, the antisense strand of the double-stranded oligonucleotide comprises at least one nucleotide modified with a phosphoester backbone.

[0032] In some alternative embodiments, one of the nucleotides modified with a phosphoester backbone is located at the 1st position from the 5' end or the 1st position from the 3' end of the antisense strand of the double-stranded oligonucleotide.

[0033] In some alternative embodiments, at least one of the nucleotides modified with a phosphoester backbone is each independently located at positions 2-8 starting from the 5' end or positions 1-6 starting from the 3' end of the antisense strand of the double-stranded oligonucleotide.

[0034] In some optional embodiments, at least one of the nucleotides modified with the phosphoester backbone is independently located at positions 1-6 from the 3' end, such as positions 1-5 from the 3' end, positions 1-4 from the 3' end, positions 1-3 from the 3' end, or positions 1-2 from the 3' end, etc.

[0035] In some specific embodiments, the antisense strand of the double-stranded oligonucleotide comprises two of the phosphoester backbone-modified nucleotides.

[0036] In some alternative embodiments, the two nucleotides modified with a phosphoester backbone are each independently located at positions 2-8 starting from the 5' end or positions 1-6 starting from the 3' end of the antisense strand of the double-stranded oligonucleotide.

[0037] In some optional embodiments, the two nucleotides modified with a phosphoester backbone are each independently located at positions 1-6 of the antisense strand of the double-stranded oligonucleotide starting from the 3' end, such as positions 1-5 starting from the 3' end, positions 1-4 starting from the 3' end, positions 1-3 starting from the 3' end, or positions 1-2 starting from the 3' end, etc.

[0038] In some specific embodiments, the two nucleotides modified with a phosphoester backbone are each independently located at the 1st and 2nd positions of the antisense strand of the double-stranded oligonucleotide starting from the 3′ end.

[0039] In some optional embodiments, the double-stranded oligonucleotide further comprises other modifications;

[0040] The other modifications include, but are not limited to: 2'-halogenated modified nucleotides, 2'-deoxy modified nucleotides, 2'-O-substituted or unsubstituted C1-C6 alkyl modified nucleotides, 2'-O-(CH2) n -OR modified nucleotides, 2'-amino modified nucleotides, abasic nucleotides or quasi-nucleotides.

[0041] The quasi-nucleotide is selected from one or more of peptide nucleic acid (PNA), morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid / glycerol nucleic acid (GNA), threose nucleic acid (TNA) or unlocked nucleic acid (UNA);

[0042] Wherein, n is selected from 1 or 2; R is selected from substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy; if R contains a substituent, the substituent is selected from halogen, C1-C6 alkoxy, hydroxyl or amino.

[0043] In some embodiments, the 2'-halogenated modified nucleotides are selected from 2'-fluoro-modified nucleotides;

[0044] In some specific embodiments, the 2'-O-substituted or unsubstituted C1-C6 alkyl modified nucleotides are selected from 2'-O-methyl modified nucleotides.

[0045] In some optional embodiments, the 2'-O-(CH2) n The -R modified nucleotide is selected from a 2'-O-methoxyethyl modified nucleotide, a 2'-O-ethoxymethyl modified nucleotide or a 2'-O-2,2,2-trifluoroethoxymethyl modified nucleotide.

[0046] In some specific embodiments, the 2'-O-(CH2) n The -R modified nucleotide is selected from 2'-O-methoxyethyl modified nucleotides.

[0047] In some embodiments, the other modification is selected from 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides or 2'-O-methoxyethyl modified nucleotides.

[0048] In some alternative embodiments, the sense strand or the antisense strand comprises a 3'-overhang of at least 1 nucleotide.

[0049] In some alternative embodiments, the antisense strand comprises a 3' overhang of at least 1 nucleotide.

[0050] In some embodiments, the antisense strand comprises a 3' overhang of 2 nucleotides.

[0051] In some alternative embodiments, the sense strand and / or the antisense strand independently comprises one or more phosphorothioate bonds.

[0052] In some embodiments, the sense strand comprises two consecutive phosphorothioate bonds between the terminal nucleotides starting at the 5' end.

[0053] In some embodiments, the antisense strand comprises two consecutive phosphorothioate bonds between the terminal nucleotides starting at the 3' end and starting at the 5' end, respectively.

[0054] In some specific embodiments, the sense strand has a length of 19 nucleotides and the antisense strand has a length of 21 nucleotides.

[0055] In some optional embodiments, in the direction from the 5' end to the 3' end, at least four nucleotides in positions 2, 6, 9-10, 14, and 16 of the nucleotide sequence of the antisense strand are selected from 2'-fluoro-modified nucleotides, at least one nucleotide in positions 16-21 is selected from the nucleotides modified with a phosphoester backbone, and the nucleotides at the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides;

[0056] And / or, in the direction from the 5' end to the 3' end, at least three nucleotides at positions 7-10 in the positive chain nucleotide sequence are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides.

[0057] In some optional embodiments, in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 9, 14, and 16 in the nucleotide sequence of the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, any two nucleotides at positions 16-21 are selected from the nucleotides modified with the phosphoester backbone, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0058] And / or, in the direction from the 5' end to the 3' end, at least three nucleotides at positions 7-10 in the positive chain nucleotide sequence are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides.

[0059] In some specific embodiments, in the direction from the 5' end to the 3' end, the nucleotides at positions 2, 6, 9, 14, and 16 in the nucleotide sequence of the antisense strand are selected from 2'-fluoro-modified nucleotides, the nucleotide at position 15 is selected from 2'-O-methoxyethyl-modified nucleotides, the nucleotides at positions 20-21 are selected from the nucleotides modified with the phosphoester backbone, and the nucleotides at the remaining positions are selected from 2'-O-methyl-modified nucleotides;

[0060] And / or, in the direction from the 5' end to the 3' end, the nucleotides at positions 7 to 10 in the positive strand nucleotide sequence are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides.

[0061] In some optional embodiments, in the direction from 5' end to 3' end, the nucleotide sequence of the antisense chain is selected from UmsAfsGmUmUmCfUmUmGfGmUmGmCmUfC(moe)UfUmGmGms(NM101)s(NM101); and the nucleotide sequence of the sense chain is selected from CmsCmsAmAmGmAmGfCfAfCfCmAmAmGmAmAmCmUmAm.

[0062] Among them, the structural formula of (NM101) is ; A represents adenine, U represents uracil, G represents guanine, and C represents cytosine; m represents that the adjacent nucleotide on its left is a 2'-O-methyl modified nucleotide; f represents that the adjacent nucleotide on its left is a 2'-fluoro modified nucleotide; (moe) represents that the adjacent nucleotide on its left is a 2'-O-methoxyethyl modified nucleotide; s represents that the two adjacent nucleotides on its left and right are connected by a phosphorothioate bond.

[0063] In some alternative embodiments, the antisense strand is substantially reverse complementary, essentially reverse complementary, or completely reverse complementary to a nucleotide sequence in the mRNA expressed by the target gene.

[0064] In some embodiments, the double-stranded oligonucleotide is selected from siRNA.

[0065] In a second aspect of the present disclosure, the present disclosure provides a conjugate, wherein the conjugate comprises the double-stranded oligonucleotide according to the first aspect of the present disclosure and one or more ligands capable of binding to a cell surface receptor.

[0066] In some embodiments, the cell is selected from a liver cell.

[0067] In some embodiments, the ligand is selected from asialoglycoprotein receptor ligands (ASGPR ligands).

[0068] In some embodiments, the asialoglycoprotein receptor ligand comprises galactose and / or its derivatives.

[0069] In some specific embodiments, the galactose derivative is selected from galactose derivatives having an affinity for asialoglycoprotein receptors equal to or greater than that of galactose, such as N-acetylgalactosamine (GalNAc).

[0070] In some specific embodiments, the galactose derivative is selected from N-acetylgalactosamine. Wherein, the structural formula of N-acetylgalactosamine is .

[0071] In some specific embodiments, the ligand is selected from the following structures, or stereoisomers thereof, or tautomers thereof, or pharmaceutically acceptable salts thereof:

[0072]

[0073] Wherein, Z' represents a hydroxyl group or a thiol group.

[0074] In some optional embodiments, the number of the ligands is selected from 1, 2, 3 or 4. The ligands are independently selected from the 3' end of the sense strand, the 5' end of the sense strand, the 3' end of the antisense strand or the 5' end of the antisense strand, and the conjugation sites of the ligands on the double-stranded oligonucleotide are different.

[0075] In some optional embodiments, the number of the ligands is selected from 1; wherein, one of the ligands can be conjugated to the 3' end of the sense strand, or one of the ligands can be conjugated to the 5' end of the sense strand, or one of the ligands can be conjugated to the 3' end of the antisense strand, or one of the ligands can be conjugated to the 5' end of the antisense strand.

[0076] In some embodiments, the number of the ligand is selected from one, and one of the ligands is conjugated to the 3' end of the sense strand of the double-stranded oligonucleotide.

[0077] In some specific embodiments, the conjugate structure is as follows:

[0078]

[0079] Wherein, Z' represents a hydroxyl group or a thiol group;

[0080] Nu represents the double-stranded oligonucleotide described in the first aspect of the present disclosure.

[0081] Further, the ligand is conjugated to the 3' end of the sense strand of the double-stranded oligonucleotide.

[0082] In some optional embodiments, the number of the ligands is selected from 2. Among them, the two ligands are conjugated to the 3' end of the sense strand and the 5' end of the sense strand, respectively; or the two ligands are conjugated to the 3' end of the sense strand and the 3' end of the antisense strand, respectively; or the two ligands are conjugated to the 3' end of the sense strand and the 5' end of the antisense strand, respectively; or the two ligands are conjugated to the 5' end of the sense strand and the 3' end of the antisense strand, respectively; or the two ligands are conjugated to the 5' end of the sense strand and the 5' end of the antisense strand, respectively. In some optional embodiments of the present disclosure, the number of the ligands is selected from 2, and the two ligands are conjugated to the 3' end of the sense strand and the 5' end of the sense strand, respectively.

[0083] In some optional embodiments, the number of the ligands is selected from 3. Among them, the three ligands are conjugated to the 3' end of the sense strand, the 5' end of the sense strand and the 3' end of the antisense strand respectively; or the three ligands are conjugated to the 3' end of the sense strand, the 5' end of the sense strand and the 5' end of the antisense strand respectively; or the three ligands are conjugated to the 3' end of the sense strand, the 3' end of the antisense strand and the 5' end of the antisense strand respectively; or the three ligands are conjugated to the 5' end of the sense strand, the 3' end of the antisense strand and the 5' end of the antisense strand respectively.

[0084] In some optional embodiments, the number of the ligands is selected from 4. The four ligands are conjugated to the 3' end of the sense strand, the 5' end of the sense strand, the 3' end of the antisense strand, and the 5' end of the antisense strand, respectively.

[0085] In a specific embodiment of the present disclosure, in the direction from 5' end to 3' end, the antisense strand of the conjugate is selected from UmsAfsGmUmUmCfUmUmGfGmUmGmCmUfC(moe)UfUmGmGms(NM101)s(NM101); and the sense strand of the conjugate is selected from CmsCmsAmAmGmAmGfCfAfCfCmAmAmGmAmAmCmUmAm_L96.

[0086] Wherein, "_L96" indicates that the L96 vector is conjugated to the 3' end of the sense strand as shown above via a phosphodiester bond.

[0087] In a third aspect of the present disclosure, the present disclosure provides a use of any of the following items in the preparation of a medicament for treating and / or preventing a disease or condition associated with an dysregulated mRNA level of target gene expression:

[0088] (I) the double-stranded oligonucleotide described in the first aspect of the present disclosure; and / or

[0089] (II) The conjugate described in the second aspect of the present disclosure.

[0090] In a fourth aspect of the present disclosure, the present disclosure provides a pharmaceutical composition, comprising any of the following items and a pharmaceutically acceptable excipient or adjuvant:

[0091] (I) the double-stranded oligonucleotide described in the first aspect of the present disclosure; and / or

[0092] (II) The conjugate described in the second aspect of the present disclosure.

[0093] In a fifth aspect of the present disclosure, the present disclosure provides a method for regulating mRNA dysregulation of target gene expression in a cell, the method comprising contacting any of the following items with the cell:

[0094] (I) the double-stranded oligonucleotide described in the first aspect of the present disclosure; and / or

[0095] (II), the conjugate according to the second aspect of the present disclosure; and / or

[0096] (III) The pharmaceutical composition according to the fourth aspect of the present disclosure.

[0097] In a sixth aspect of the present disclosure, the present disclosure provides a modified nucleoside monomer, wherein the modified nucleoside monomer has a structure represented by formula (IB), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0098]

[0099] Wherein, X, Base, R1, R2, R3, R4, R5, and R6 are as defined in the first aspect of the present disclosure; wherein, if Base contains an amino group, the amino group is protected by an amino protecting group.

[0100] In some optional embodiments, the modified nucleoside monomer has a structure represented by formula (IIB), formula (IIB-1) or formula (IIB-2), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0101] , , .

[0102] R7 is selected from H or a hydroxyl protecting group;

[0103] In some alternative embodiments, the hydroxy protecting group is selected from trityl, 4-methoxytrityl, 4,4'-dimethoxytrityl or 4,4',4''-trimethoxytrityl.

[0104] In some specific embodiments, the hydroxy protecting group is selected from 4,4'-dimethoxytrityl.

[0105] In some specific embodiments, R7 is selected from H or 4,4'-dimethoxytrityl.

[0106] In some specific embodiments, R7 is selected from 4,4'-dimethoxytrityl.

[0107] R8 is selected from H or ; where each R 8a Independently selected from or C containing a cyano substituent 1-6 alkoxy, and at least one R 8a Selected from ; Each R 8a ' is independently selected from optionally substituted C 1-6 alkyl.

[0108] In some embodiments, each R 8a Independently selected from or , and at least one R 8a Selected from .

[0109] In some alternative embodiments, Selected from or .

[0110] In some specific embodiments, Selected from .

[0111] In some optional embodiments, R8 is selected from H or .

[0112] In some specific embodiments, R8 is selected from .

[0113] In a specific embodiment of the present disclosure, the modified nucleoside monomer is selected from any of the following structures, or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof:

[0114] , , .

[0115] The present disclosure provides a double-stranded oligonucleotide containing a nucleotide modified with a phosphoester backbone. Experiments have shown that the nucleotide modified with a phosphoester backbone has the effect of enhancing the activity of the double-stranded oligonucleotide and can improve the metabolic stability of the double-stranded oligonucleotide in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0116] Figure 1 Relative expression levels of target genes of interest in mice after administration of siRNA conjugates. DETAILED DESCRIPTION

[0117] The present disclosure discloses a double-stranded oligonucleotide containing nucleotides modified with a phospholipid backbone and a conjugate thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all deemed to be included in the present disclosure. The methods and applications of the present disclosure have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present disclosure to implement and apply the disclosed technology.

[0118] Explanation of terms

[0119] In the present disclosure, the terms “comprise” or “include” are open expressions, that is, including the contents specified in the present disclosure but not excluding other contents.

[0120] In this disclosure, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance can but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0121] In the present disclosure, the term "small interfering RNA (siRNA)" is a double-stranded RNA of 17 to 25 nucleotides in length, comprising a sense strand and an antisense strand. siRNA mediates targeted cleavage of RNA transcripts in the RISC pathway by forming a silencing complex (RISC). Specifically, siRNA guides the specific degradation of mRNA sequences through the known RNA interference (RNAi) process, inhibiting the translation of mRNA into amino acids and proteins.

[0122] In the present disclosure, the term "antisense strand (or guide strand)" includes a region that is substantially complementary to a target sequence, such as the mRNA of AGT. "Sense strand (or follower strand)" refers to an iRNA strand that contains a region that is substantially complementary to the antisense strand. The term "substantially complementary" refers to complete complementarity or at least partial complementarity, for example, the antisense strand is completely complementary to the target sequence or at least partially complementary. In the case of partial complementarity, mismatches can exist in the interior or terminal regions of the molecule, wherein the most tolerated mismatches exist in the terminal regions, for example, within 5, 4, 3 or 2 nucleotides of the 5' end and / or 3' end of the iRNA.

[0123] It should be noted that "at least part of the antisense strand is substantially complementary to the mRNA" means that the antisense strand has a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest. Alternatively, if a polynucleotide is substantially non-interruptedly complementary to a portion of the mRNA encoding the target gene, the antisense strand is complementary to at least a portion of the mRNA of the target gene.

[0124] In the present disclosure, the term "target sequence" refers to a continuous portion of a nucleotide sequence of an mRNA molecule formed during transcription encoding a target gene, including mRNA that is an RNA processing product of a primary transcription product.

[0125] In the present disclosure, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure.

[0126] In the present disclosure, the term "substantially complementary" means that the sense strand and the antisense strand have no more than 3 nucleotides, no more than 2 nucleotides, or no more than 1 nucleotide mismatch in the duplex region, for example, 3 nucleotides, 2 nucleotides, 1 nucleotide, or 0 nucleotides, while retaining the ability to hybridize under relevant conditions. In addition, when two oligonucleotides are designed to form one or more single-stranded overhangs when hybridized, such overhangs should not be regarded as mismatches in terms of determining complementarity. In the present disclosure, when the above hybridization ability requirements are met, the "complementary" sequence may also include or be completely formed from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in the present disclosure, unless otherwise specified, "mismatch" means that in the siRNA duplex molecule, the bases at corresponding positions are not paired in a complementary form.

[0127] In the present disclosure, the term "complementary sequence having complementarity" refers to a mismatch between the antisense strand of a double-stranded oligonucleotide and the complementary sequence of AGT mRNA of no more than 3 nucleotides, no more than 2 nucleotides, or no more than 1 nucleotide, for example, a mismatch of 3 nucleotides, 2 nucleotides, 1 nucleotide, or 0 nucleotides.

[0128] In the present disclosure, the term "nucleotide difference" and the term "nucleotide base difference" and the term "nucleotide sequence difference" can be used interchangeably. It means that the base type of the nucleotide at the same or corresponding position has changed compared to the original nucleotide sequence. For example, when one nucleotide base in the original nucleotide sequence is A, when the nucleotide base at the same or corresponding position is changed to U, C, G or dT, dC, dG, etc., it is considered that there is a difference in the nucleotide sequence at this position. It should be noted here that when the nucleotide at the same or corresponding position differs only in the presence or absence of modification or the type of modification compared to the original nucleotide sequence, it is not considered that there is a difference in the nucleotide sequence at this position. .

[0129] In the present disclosure, the term "overhang" refers to at least one unpaired nucleotide protruding from the double-stranded oligonucleotide double helix structure, and is also a nucleotide sequence in the siRNA structure other than the double-stranded region. For example: when the 3' end of one strand in the sense strand and / or the antisense strand exceeds the 5' end of the other strand, or when the 5' end of one strand in the sense strand and / or the antisense strand exceeds the 3' end of the other strand, there is a nucleotide overhang. The overhang may contain at least one nucleotide, at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more nucleotides. The nucleotide overhang may contain or be composed of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang may be located in the sense strand, the antisense strand, or any combination thereof. In addition, the nucleotides of the overhang may appear at the 5' end, the 3' end, or both ends of the antisense or sense strand.

[0130] In the present disclosure, the term "subject" refers to any animal that is examined, studied or treated, and it is not intended that the present disclosure be limited to any particular type of subject. In some embodiments of the present disclosure, humans are preferred subjects, while in other embodiments, non-human animals are preferred subjects, including but not limited to mice, monkeys, ferrets, cattle, sheep, goats, pigs, chickens, turkeys, dogs, cats, horses, and reptiles.

[0131] In the present disclosure, "conjugation" refers to the connection between two or more chemical moieties by covalent bonding; "conjugate" refers to a compound formed by covalent bonding between chemical moieties; "conjugated molecule" is understood to be a specific compound that can be conjugated to an oligonucleotide through a reaction to ultimately form the oligonucleotide conjugate of the present disclosure.

[0132] In the present disclosure, "pharmaceutical composition" may refer to a composition used for the treatment of a disease, and may also be used for in vitro culture experiments of cells. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dosage form, and may be prepared by any of the methods well known in the pharmaceutical field. All methods include the step of combining the active ingredient with an excipient that constitutes one or more accessory ingredients. Typically, the composition is prepared by uniformly and fully combining the active siRNA with a liquid excipient, a finely divided solid excipient, or both.

[0133] In the present disclosure, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammals treated therewith. Preferably, the "pharmaceutically acceptable" described in the present disclosure refers to those approved by federal regulatory agencies or national governments or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeias for use in animals, especially humans.

[0134] In the present disclosure, the term "pharmaceutically acceptable excipients or adjuvants" may include any solvents, solid excipients, diluents or other liquid excipients, etc., suitable for a specific target dosage form. Except for any conventional excipients that are incompatible with the siRNA of the present disclosure, such as any adverse biological effects produced or interactions with any other components of the pharmaceutically acceptable composition in a harmful manner, their use is also within the scope of the present disclosure.

[0135] In the present disclosure, the term "treatment" refers to the use of drugs to obtain the desired pharmacological and / or physiological effects. The effect can be preventive in terms of completely or partially preventing a disease or its symptoms, and / or can be therapeutic in terms of partially or completely curing a disease and / or adverse effects caused by the disease. "Treatment" as used herein covers diseases in mammals, especially humans, including: (a) preventing the occurrence of diseases or conditions in individuals who are susceptible to the disease but have not yet been diagnosed with the disease; (b) inhibiting the disease, such as blocking the development of the disease; or (c) alleviating the disease, such as alleviating symptoms associated with the disease. "Treatment" as used herein covers any medication that administers a drug or siRNA to an individual to treat, cure, alleviate, improve, reduce or inhibit the individual's disease, including but not limited to administering a drug containing the siRNA or siRNA conjugate described herein to an individual in need.

[0136] In addition to any conventional excipients, to the extent that they are incompatible with the siRNA of the present disclosure, such as producing any adverse biological effects or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is also contemplated by the present disclosure.

[0137] In order to make the purpose, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below in conjunction with examples.

[0138] Unless otherwise specified, the reagents, consumables and instruments used in the present disclosure are all from commercially available products. Among them, the main reagents and consumables and their sources are shown in Table 1, and the main instruments and their sources are shown in Table 2.

[0139] Table 1 Main reagents and consumables

[0140]

[0141] Table 2 Main instruments and equipment

[0142]

[0143] The present disclosure is further described below in conjunction with embodiments:

[0144] Preparation of compounds

[0145] Preparation Example 1: Preparation of Compound 5

[0146] In this preparation example, the synthetic route of compound 5 is as follows:

[0147]

[0148] (1-1) Synthesis of Compound 2

[0149] Compound 1 (25 g, 1.0 eq, 2'-methoxyuridine, CAS No. 2140-76-3) was dissolved in 250 mL of pyridine, and 4,4'-dimethoxytrityl chloride (37 g, 1.3 eq, DMTrCl) was added under ice bath, and reacted at room temperature for 3 hours, and quenched by adding 150 mL of methanol. After the reaction, the reaction solution was concentrated under reduced pressure, extracted with ethyl acetate 3 times, dried and concentrated to obtain a crude yellow oil compound 2 (47 g), which was directly used for the next step without purification. MS ESI (m / z) = 561[M + H] + .

[0150] (1-2) Synthesis of Compound 3

[0151] Compound 2 (47 g, 1 eq) was dissolved in 200 mL of dichloromethane solution. Imidazole (11.5 g, 2 eq) and tert-butyldimethylsilyl chloride (19 g, 1.2 eq, CAS No. 18162-48-6) were added and stirred at room temperature overnight. After the reaction was completed, the reaction solution was concentrated under reduced pressure, extracted with ethyl acetate three times, dried and concentrated to obtain a crude yellow solid compound 3 (60 g). Compound 3 was directly used for the next step without purification. MS ESI (m / z) = 675 [M + H] + .

[0152] (1-3) Synthesis of Compound 4

[0153] Compound 3 (25 g, 1.0 eq) was dissolved in a mixed solution of dichloromethane (70 ml) and methanol (30 ml), p-toluenesulfonic acid (14 g, 2 eq, CAS No. 104-15-4) was added, and stirred at room temperature for 3 hours. After the reaction was completed, the reaction solution was extracted 3 times with ethyl acetate and saturated sodium bicarbonate aqueous solution, backwashed 3 times with saturated sodium chloride aqueous solution, dried and concentrated, and purified by normal phase (eluent: petroleum ether PE / ethyl acetate EA = 1 / 1, volume ratio v / v) to obtain compound 4 (20 g) as an off-white solid. MSESI (m / z) = 373[M + H] + .

[0154] (1-4) Synthesis of Compound 5

[0155] Compound 4 (20 g, 1.0 eq) and 2-iodobenzoic acid (9.4 g, 2.5 eq, abbreviated as IBX, CAS No. 61717-82-6) were dissolved in 150 ml of acetonitrile and reacted at 85°C for 3 hours. After the reaction was completed, the reaction system was cooled to room temperature, the reaction solution was filtered and rinsed with ethyl acetate 3 times, and the filtrate was dried and concentrated to obtain a crude compound 5 (20 g) as a pink-yellow solid. Compound 5 was directly used in the subsequent reaction without purification. MS ESI (m / z) = 371 [M + H] + .

[0156] Preparation Example 2: Synthesis of Compound NM100

[0157] In this preparation example, the synthesis route of compound NM100 is as follows:

[0158]

[0159] (2-1) Synthesis of compound NM100-1

[0160] Dissolve triphenylmethylphosphonium bromide (15g, 2.5eq, CAS No. 1779-49-3) in tetrahydrofuran (50ml, referred to as THF), add potassium tert-butoxide (4.8g, 2.5eq, CAS No. 865-47-4) under ice bath, stir at 0°C for 30 minutes, then add a tetrahydrofuran solution of compound 5 (7.2g, 1.0eq), and react at room temperature overnight. After the reaction, the reaction solution was extracted with saturated ammonium chloride and ethyl acetate three times, concentrated under reduced pressure, dried and filtered, and purified by normal phase (eluent: PE / EA=2 / 1, v / v) to obtain compound NM100-1 as a white solid (3.2g, yield 44.7%). MS ESI (m / z) = 369 [M + H] + .

[0161] (2-2) Synthesis of compound NM100-2

[0162] Compound NM100-1 (3.2 g, 1.0 eq) was dissolved in 50 ml THF, and 9-boranobicyclo[3.3.1]nonane (100 ml, 6 eq, 9-BBN, CAS No. 280-64-8) was slowly added under ice bath, and stirred at room temperature for 6 hours. Methanol (30 ml) and water (50 ml) were added in sequence at low temperature and stirred for 10 minutes, and sodium perborate tetrahydrate (6.9 g, 5 eq) was added, and the reaction was allowed to proceed overnight at room temperature. After the reaction was completed, the reaction solution was extracted 3 times with saturated ammonium chloride and ethyl acetate, dried and filtered, and concentrated under reduced pressure to obtain crude compound NM100-2 (7 g) as a white solid. MS ESI (m / z) = 387 [M + H]+ .

[0163] (2-3) Synthesis of compound NM100-3

[0164] Compound NM100-2 (7 g, 1.0 eq) was dissolved in 45 ml of pyridine, DMTrCl (3.2 g, 1.3 eq) was added under ice bath, reacted at room temperature for 3 hours, and quenched by adding 15 mL of methanol. After the reaction, the reaction solution was concentrated under reduced pressure and purified by normal phase (eluent: PE / EA=1 / 1, v / v) to obtain compound NM100-3 (370 mg) as a yellow solid. MS ESI (m / z) =689 [M + H] + .

[0165] (2-4) Synthesis of Compound NM100-4

[0166] Compound NM100-3 (730 mg, 1.0 eq) was dissolved in 15 ml THF, and tetrabutylammonium fluoride (1.25 ml, 1.2 eq, TBAF, CAS No. 429-41-4) was added and reacted at room temperature for 1 hour. After the reaction, the reaction solution was directly subjected to reverse phase purification to obtain compound NM100-4 (400 mg, yield 65.5%) as a white solid. MS ESI (m / z) = 575 [M + H] + .

[0167] (2-5) Synthesis of compound NM100

[0168] Compound NM100-4 (400 mg, 1.0 eq) was dissolved in 20 ml of dichloromethane (DCM), and 4,5-dicyanoimidazole (64 mg, 0.8 eq, DCI, CAS No. 1122-28-7) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (247 mg, 1.2 eq, CAS No. 102691-36-1) were added, and the mixture was reacted at room temperature for 3 hours. After the reaction, the reaction solution was directly subjected to reverse phase purification to obtain compound NM100 (480 mg, yield 74.6%) as a white solid. MS ESI (m / z)=775 [M + H] + .

[0169] 1H NMR (400 MHz, DMSO-d6) δ 11.45 – 11.40 (s, 1H), 7.43 – 7.23 (m,10H), 6.92 – 6.83 (m, 4H), 5.85 – 5.78 (dd, J = 6.9, 5.2 Hz, 1H), 5.62 – 5.54(dd, J = 8.1, 3.7 Hz, 1H), 4.53 – 4.46 (ddd, J = 10.4, 4.9, 2.6 Hz, 1H), 4.14– 4.00 (ddd, J = 19.5, 7.0, 4.9 Hz, 1H), 3.91 – 3.78 (m, 2H), 3.76 – 3.71 (t,J = 1.8 Hz, 6H), 3.71 – 3.57 (m, 1H), 3.40 – 3.32 (d, J = 7.5 Hz, 4H), 3.13 –2.86 (m, 2H), 2.84 – 2.76 (dt, J = 12.0, 5.9 Hz, 2H), 2.12 – 2.07 (s, 1H),1.31 – 1.14 (ddd, J = 8.1, 6.4, 2.7 Hz, 12H).

[0170] Preparation Example 3: Synthesis of Compound NM101

[0171] In this preparation example, the synthesis route of compound NM101 is as follows:

[0172]

[0173] (3-1) Synthesis of compound NM101-1

[0174] Compound 5 (20 g, 1 eq) was dissolved in 200 ml THF, 3 M methylmagnesium bromide THF solution (50 ml) was added at -20 °C, nitrogen was replaced 3 times, the reaction system was stirred at -20 °C in a nitrogen atmosphere for 1 hour, and 20 ml of saturated ammonium chloride aqueous solution was added to quench. After the reaction, the reaction solution was extracted 3 times with ethyl acetate, the organic phase was separated, dried and concentrated, and normal phase purification (eluent: PE / EA=1 / 1, v / v) was performed to obtain compound NM101-1 (7 g, yield 33.6%) as a white solid. MS ESI (m / z) =409 [M + Na] + .

[0175] (3-2) Synthesis of compound NM101-2

[0176] Compound NM101-1 (7 g, 1.0 eq) and 2-iodobenzoic acid (13.3 g, 2.5 eq, referred to as IBX, CAS No. 61717-82-6) were dissolved in 70 ml of acetonitrile and reacted at 85 °C for 3 hours. After the reaction was completed, the reaction system was cooled to room temperature, the reaction solution was filtered and rinsed with ethyl acetate 3 times, and the filtrate was dried and concentrated to obtain a crude compound NM101-2 (20 g) as a pink-yellow solid. MS ESI (m / z) = 385 [M + H] + .

[0177] (3-3) Synthesis of Compound NM101-3

[0178] Dissolve triphenylmethylphosphonium bromide (15g, 2.5eq) in 50ml THF, add potassium tert-butoxide (4.8g, 2.5eq) under ice bath, stir at 0°C for 30 minutes, then add compound NM101-2 (7.2g, 1.0eq) in THF solution, and react at room temperature overnight. After the reaction is completed, the reaction solution is extracted with saturated ammonium chloride aqueous solution and ethyl acetate three times, concentrated under reduced pressure, dried and filtered, and purified by normal phase (eluent: PE / EA=2 / 1, v / v) to obtain compound NM101-3 (3.2g, yield 44.7%) as a white solid. MS ESI (m / z) = 383 [M + H] + .

[0179] (3-4) Synthesis of Compound NM101-4

[0180] Compound NM101-3 (3.2 g, 1.0 eq) was dissolved in 50 ml THF, 9-BBN (100 ml, 6 eq) was slowly added under ice bath, stirred at room temperature for 6 hours, methanol (30 ml) was added in turn at low temperature, water (50 ml) was added and stirred for 10 minutes, sodium perborate tetrahydrate (6.9 g, 5 eq) was added, and the reaction was allowed to proceed overnight at room temperature. After the reaction was completed, the reaction solution was extracted 3 times with saturated aqueous ammonium chloride solution and ethyl acetate, dried and filtered, and concentrated under reduced pressure to obtain crude compound NM101-4 (7 g) as a white solid. MSESI (m / z) = 401 [M + H] + .

[0181] (3-5) Synthesis of Compound NM101-5

[0182] Compound NM101-4 (7 g, 1.0 eq) was dissolved in 45 ml of pyridine, DMTrCl (3.2 g, 1.3 eq) was added under ice bath, reacted at room temperature for 3 hours, and quenched by adding 15 mL of methanol. After the reaction, the reaction solution was concentrated under reduced pressure and purified by normal phase (eluent: PE / EA=1 / 1, v / v) to obtain compound NM101-5 (370 mg) as a yellow solid. MS ESI (m / z) =703 [M + H] + .

[0183] (3-6) Synthesis of Compound NM101-6

[0184] Compound NM101-5 (730 mg, 1.0 eq) was dissolved in 15 ml THF, and TBAF (1.25 ml, 1.2 eq) was added and reacted at room temperature for 1 hour. After the reaction, the reaction solution was directly subjected to reverse phase purification to obtain compound NM101-6 (400 mg, yield 65.5%) as a white solid. MS ESI (m / z) = 589 [M + H] + .

[0185] (3-7) Synthesis of Compound NM101

[0186] Compound NM101-6 (400 mg, 1.0 eq) was dissolved in 20 ml DCM, and DCI (64 mg, 0.8 eq) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (247 mg, 1.2 eq) were added and reacted at room temperature for 3 hours. After the reaction, the reaction solution was directly subjected to reverse phase purification to obtain compound NM101 (400 mg, yield 74.6%) as a white solid. MS ESI (m / z) = 789 [M + H] + .

[0187] 1H NMR (400 MHz, DMSO-d6) δ 11.45 – 11.40 (s, 1H), 7.43 – 7.23 (m,10H), 6.92 – 6.83 (m, 4H), 5.85 – 5.78 (dd, J = 6.9, 5.2 Hz, 1H), 5.62 – 5.54(dd, J = 8.1, 3.7 Hz, 1H), 4.53 – 4.46 (ddd, J = 10.4, 4.9, 2.6 Hz, 1H), 4.14– 4.00 (ddd, J = 19.5, 7.0, 4.9 Hz, 1H), 3.91 – 3.78 (m, 2H), 3.76 – 3.71 (t,J = 1.8 Hz, 6H), 3.71 – 3.57 (m, 1H), 3.40 – 3.32 (d, J = 7.5 Hz, 4H), 3.13 –2.86 (m, 2H), 2.84 – 2.76 (dt, J = 12.0, 5.9 Hz, 2H), 2.12 – 2.07 (s, 1H), 1.31 – 1.14 (ddd, J = 8.1, 6.4, 2.7 Hz, 12H), 1.08 – 1.00 (dd, J = 13.4, 6.7Hz, 3H).

[0188] Preparation Example 4: Preparation of siRNA conjugates

[0189] Among them, compound L96-PS was purchased from Ailiying Pharmaceutical Group (Tianjin) Co., Ltd., with a loading of 120±12µmol / g (detection method: UV / HPLC). The structural formula of compound L96-PS is as follows:

[0190]

[0191] Among them, PS represents polystyrene resin solid phase carrier.

[0192] (4-1) Synthesis of the positive chain (SS)

[0193] By using the phosphoramidite nucleic acid solid phase synthesis method, compound L96-PS is used to start the cycle, and nucleoside monomers are connected one by one in the 3'-5' direction according to the nucleotide sequence. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. The synthesis conditions are given as follows:

[0194] The nucleoside monomer was prepared into an acetonitrile solution with a concentration of 0.1 M.

[0195] The conditions of the deprotection reaction in each step are the same. The conditions of the deprotection reaction are: temperature of 25°C, reaction time of 70 seconds, deprotection reagent of dichloroacetic acid in dichloromethane solution (3 volume %), and the molar ratio of dichloroacetic acid to 4,4'-dimethoxytrityl protecting group on the solid phase carrier is 5:1.

[0196] The conditions of each coupling reaction are the same. The coupling reaction conditions are as follows: temperature is 25°C, the molar ratio of the nucleic acid sequence connected to the solid phase support to the nucleoside monomer is 1:10, the molar ratio of the nucleic acid sequence connected to the solid phase support to the coupling reagent is 1:65, the reaction time is 600 seconds, the coupling reagent is an acetonitrile solution of 5-ethylthio-1H-tetrazole with a concentration of 0.5M, and the thiolation reagent is an acetonitrile / pyridine mixed solution of hydrogenated xanthanol with a concentration of 0.2mol / L (the volume ratio of acetonitrile and pyridine is 1:1).

[0197] The conditions of each capping reaction are the same. The conditions of the capping reaction are: temperature is 25°C; reaction time is 2 minutes; the capping reagent solution is a mixed solution of Cap1 and Cap2 with a molar ratio of 1:1, Cap1 is a pyridine / acetonitrile mixed solution of N-methylimidazole with a concentration of 20 volume%, the volume ratio of pyridine to acetonitrile is 3:5, Cap2 is an acetonitrile solution of acetic anhydride with a volume ratio of 20 volume%; the molar ratio of N-methylimidazole in Cap1 capping reagent, acetic anhydride in Cap2 capping reagent to the nucleic acid sequence connected to the solid phase carrier is 1:1:1.

[0198] The conditions for each step of the oxidation reaction are the same. The conditions for the oxidation reaction are: temperature 25°C; reaction time 3 seconds; oxidation reagent concentration is 0.05M iodine water, and the molar ratio of iodine to the nucleic acid sequence connected to the solid phase carrier in the coupling reaction is 30:1; the oxidation reaction is carried out in a water / pyridine mixed solvent (the volume ratio of water to pyridine is 1:9). The conditions for the sulfidation reaction are: temperature 25°C; reaction time 360 ​​seconds; thiolation reagent concentration is 0.2M hydrogenated xanthin pyridine solution, and the molar ratio of thiolation reagent to the nucleic acid sequence connected to the solid phase carrier in the coupling reaction is 4:1; the sulfidation reaction is carried out in a water / pyridine mixed solvent (the volume ratio of water to pyridine is 1:9).

[0199] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the positive chain, wherein:

[0200] The cleavage and deprotection conditions are as follows: the synthesized nucleotide sequence connected to the solid phase carrier is added to 25% by mass ammonia water, the amount of ammonia water is 0.5 ml / μmol, the reaction is carried out at 55°C for 16 hours, the solvent is removed, and the product is concentrated to dryness in vacuo. After the ammonia water treatment, the product is dissolved with 0.4 ml / μmol N-methylpyrrolidone relative to the amount of single-stranded nucleic acid, and then 0.3 ml / μmol triethylamine and 0.6 ml / μmol triethylamine trihydrofluoride are added to remove the 2'-O-TBDMS protection on the ribose.

[0201] Purification and desalting conditions: The nucleic acid was purified by gradient elution of NaCl using a preparative ion chromatography purification column (Source 15Q). Specifically, eluent 1 was 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (the volume ratio of water to acetonitrile was 9:1); eluent 2 was 1.5 M sodium chloride, 20 mM sodium phosphate (pH = 8.1), and the solvent was a water / acetonitrile mixed solution (the volume ratio of water to acetonitrile was 9:1); the elution gradient was eluent 1: eluent 2 = (100:0)-(50:50). The product eluates were collected and combined, and desalted using a reverse chromatographic purification column. The desalting conditions included desalting using a dextran gel column, the filler was dextran gel G25, and eluted with deionized water.

[0202] Detection: Use ion exchange chromatography (IEX-HPLC) for purity detection; use liquid chromatography-mass spectrometry (LC-MS) for molecular weight detection, and compare the measured value of the molecular weight with the theoretical value. If the measured value is consistent with the theoretical value, it indicates that the obtained compound is conjugated to the 3' end of the siRNA sense chain.

[0203] (4-2) Synthesis of antisense strand (AS)

[0204] The antisense chain was synthesized using a universal solid phase carrier. The deprotection, coupling, capping, oxidation or sulfurization reaction conditions, cleavage and deprotection conditions, purification and desalting conditions in the solid phase synthesis method of the antisense chain are the same as those in step (4-1) for synthesizing the sense chain.

[0205] Detection: Use ion exchange chromatography (IEX-HPLC) for purity detection; use liquid chromatography-mass spectrometry (LC-MS) for molecular weight detection, and compare the measured value of the molecular weight with the theoretical value. If the measured value is consistent with the theoretical value, it indicates that the siRNA antisense chain is obtained.

[0206] (4-3) Synthesis of siRNA conjugates

[0207] The sense chain synthesized in step (4-1) and the antisense chain synthesized in step (4-2) are mixed in an equimolar ratio, dissolved in water for injection and heated to 95° C., slowly cooled to room temperature and kept at room temperature for 10 minutes, so that the sense chain and the antisense chain form a double-stranded structure through hydrogen bonds, thereby obtaining a siRNA conjugate having a sense chain and an antisense chain as shown in Table 3.

[0208] The structural formula of the siRNA conjugate is as follows:

[0209]

[0210] in, Represents siRNA. L96 is conjugated to the 3' end of the sense strand of siRNA via a phosphodiester bond.

[0211] The siRNA conjugates described in Table 3 are obtained by modifying the double-stranded oligonucleotides as described below:

[0212] Sense strand (5'-3'): CCAAGAGCACCAAGAACUA (SEQ ID NO.1)

[0213] Antisense strand (5'-3'): UAGUUCUUGGUGCUCUUGGUU (SEQ ID NO. 2)

[0214] When generating RNA sequences, the sequence table generation software requires that U be represented by T. Therefore, the siRNA sequences disclosed in the present disclosure cannot be correctly represented in the sequence table. All sequences are subject to those described in the specification.

[0215] Table 3 siRNA conjugate sequence information

[0216]

[0217] Exemplarily explained, "_L96" indicates that the L96 vector is conjugated to the 3' end of the sense strand as shown in RZ597114 via a phosphodiester bond.

[0218] Unless otherwise specified, the base composition and modification meanings described in each embodiment of the present disclosure are as follows: capital letters A, U, G, C, and T represent the base composition of the nucleotide, respectively; lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a 2'-O-methyl modified (also known as: 2'-methoxy modified) nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a 2'-fluoro modified nucleotide; lowercase letter d represents that the nucleotide adjacent to the left of the letter d is a 2'-deoxy modified ribonucleic acid (also known as: deoxyribonucleic acid); (moe) represents that the nucleotide adjacent to the left of the combination mark (moe) is a 2'-O-methoxyethyl modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by a phosphorothioate bond.

[0219] (NM100) represents a nucleotide, and its structural formula is: ; It is obtained by the synthesis of siRNA conjugates with the participation of nucleoside monomer NM100.

[0220] (NM101) represents a nucleotide, and its structural formula is: ; It is obtained by the synthesis of siRNA conjugates with the participation of nucleoside monomer NM101.

[0221] The structural formula of the 2'-methoxy modified nucleotide is .

[0222] The structural formula of the 2'-fluorine-modified nucleotide is .

[0223] Among them, Z represents a hydroxyl group or a thiol group; Base represents the base of a nucleotide, such as A, U, G, C, and T.

[0224] Table 4 Molecular weight information of siRNA conjugates

[0225]

[0226] Biological detection experiments

[0227] Unless otherwise specified, the siRNA sequences used in the present disclosure were commissioned to Suzhou Beixin Biotechnology Co., Ltd. for synthesis; the PCR primers were commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis; and the experimental animals C57BL / 6J mice were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd.

[0228] Method for evaluating the inhibitory activity of siRNA conjugates on target genes in mice

[0229] 6-8 week old C57BL / 6J mice were randomly divided into groups according to body weight (all female). The drug dose of mice in each group was calculated according to body weight, and a single dose was given by subcutaneous injection in the abdomen. Each siRNA conjugate was prepared into a solution of corresponding concentration (calculated as siRNA) with PBS solution for administration, and the administration volume was 5 ml (calculated as siRNA) / kg (calculated as mouse). The PBS control group was given 5 ml / kg (calculated as mouse) of PBS solution (without drug conjugate). The day of administration was recorded as day 0 (recorded as D0), and 5 mice were killed in each group at the preset time after administration. The killed mice were grossly dissected and the liver tissue of each killed mouse was collected, and the liver tissue was cut into approximately 2 mm 3 Small pieces were stored with RNA Later.

[0230] Liver tissue samples at different time points in different experimental groups were obtained from the above RNA later, and the liver tissue samples were disrupted in a Tissuelyser II fully automatic tissue homogenizer for 60 seconds. Total RNA was then extracted using a fully automatic nucleic acid extractor (purchased from Zhejiang Hanwei Technology Co., Ltd.) and a nucleic acid extraction kit (purchased from Zhejiang Hanwei Technology Co., Ltd.) according to the standard operating procedures for total RNA extraction.

[0231] mRNA expression level detection:

[0232] Take the above 1μg total RNA, use the reverse transcription kit (Promega, Reverse Transcription System, A3500) and select Oligo (dT)15 reverse transcription primer, configure 20μL reverse transcription system according to the method described in the reverse transcription kit manual and complete the reverse transcription reaction. After the reaction is completed, add 80μL RNase-Free water to the reverse transcription system to obtain a cDNA solution. Then use the real-time fluorescence quantitative PCR kit (ABI, SYBR™ Select MasterMix, Catalog number: 4472908) to detect the expression level of the target gene mRNA in liver tissue. In this real-time fluorescence quantitative PCR method, primers for the target gene and primers for the internal reference gene are used to detect the target gene and the internal reference gene respectively. According to the method described in the manual of the real-time fluorescence quantitative PCR kit, 20μL Real-time PCR reaction system was configured for each PCR detection well. Each reaction system contained 5μL cDNA solution obtained from the above reverse transcription reaction, 10μL SYBR™ Select Master Mix, 0.5μL 10μM upstream primer, 0.5μL 10μM downstream primer, and 4μL RNase-FreeH2O. The configured reaction system was placed on a real-time fluorescence quantitative PCR instrument (ABI, StepOnePlus™), and the real-time PCR amplification was performed using a three-step method. The amplification program was 95℃ pre-denaturation for 10min, then 95℃ denaturation for 30s, 60℃ annealing for 30s, and 72℃ extension for 30s. The denaturation, annealing, and extension process were repeated for 40 cycles. In this real-time fluorescence quantitative PCR method, the ΔΔCt method was used to perform relative quantitative calculations on the expression level and inhibition rate of the target gene mRNA in each test group. The calculation method is as follows:

[0233] ΔCt(test group) = Ct(test group target gene) – Ct(test group reference gene)

[0234] ΔCt(control group) = Ct(control group target gene) – Ct(control group internal reference gene)

[0235] ΔΔCt(test group) = ΔCt(test group) – ΔCt(control group average)

[0236] ΔΔCt(control group) = ΔCt(control group) – ΔCt(control group average)

[0237] Among them, ΔCt (control group average) is the arithmetic mean of the ΔCt (control group) of 5 mice sacrificed at the same time point in the control group. Therefore, each sample in the test group and the control group corresponds to a ΔΔCt value.

[0238] Relative expression level of target gene mRNA in the test group = 2 -ΔΔCt( Test group) × 100%

[0239] The target gene mRNA expression level of the test group was normalized based on the control group, and the target gene mRNA expression level of the control group was defined as 100%.

[0240] The target gene mRNA expression inhibition rate (%) of the test group = 1 – the relative expression level of the target gene mRNA in the test group

[0241] Unless otherwise stated, the in vivo activity experimental data were expressed as X±STDEV, and the experimental data were plotted and analyzed using GraphPadprism 8.0 software.

[0242] Example 1 Evaluation of the inhibitory activity of siRNA conjugates on the target gene Angiopoietin-like 3 (ANGPTL3) in mice

[0243] In this example, a method for evaluating the target gene inhibitory activity in vivo in mice was used to evaluate the inhibitory activity of the ANGPTL3 target siRNA, comprising a conjugate RZ597151 containing NM101 groups at positions 20 and 21 of the antisense strand, a control conjugate RZ597150 containing NM100 groups at positions 20 and 21, and a conjugate RZ597114 containing no alternative groups, on the target gene ANGPTL3 in vivo in mice.

[0244] 6-8 week old C57BL / 6j mice were randomly divided into 4 groups according to body weight, with 15 mice in each group. The above siRNA conjugates were administered subcutaneously in the abdomen. The dose of each mouse in the PBS control group was 5 mL / kg, and the dose of each mouse in the siRNA conjugate experimental group was 3 mg / kg (in terms of siRNA) with a volume of 5 mL / kg. The day of administration was recorded as day 0 (D0). Five mice in each group were killed on the 7th day (D7), the 28th day (D28), and the 56th day (D56) after administration. The animals were grossly dissected, and the liver tissues were collected and cut into several 2 mm 3 The small pieces were stored in RNA later. RNA extraction and Real-time PCR detection were performed as described above, and gene expression differences were calculated by the ΔΔCt method.

[0245] Table 5 Primer sequence list

[0246]

[0247] The results are shown in the following table:

[0248] Table 6 Inhibitory activity of target genes in mice after administration of the siRNA conjugates described in this example

[0249]

[0250] The results of Example 1 show that compared with the control conjugate RZ597114 whose antisense strand does not contain any alternative groups, the conjugate RZ597150 containing the NM100 group and the conjugate RZ597151 containing the NM101 group have higher inhibitory activity at D7, D28 and D56, and at D56, the conjugate RZ597151 containing the NM101 group has higher inhibitory activity than the conjugate RZ597150 containing the NM100 group. ( Figure 1 , Table 6)

[0251] The above specific implementations are only illustrative of the content of the present invention and do not represent limitations of the content of the present invention. For those skilled in the art, various modifications and improvements can be made without departing from the spirit and essence of the present disclosure, and these modifications and improvements are also considered to be within the scope of protection of the present disclosure.

Claims

1. A double-stranded oligonucleotide, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand each independently have a length of 15-35 nucleotides, and each nucleotide in the double-stranded oligonucleotide is each independently selected from a modified nucleotide or an unmodified nucleotide; in, The double-stranded oligonucleotide contains at least one nucleotide modified with a phosphoester backbone, and the nucleotide modified with a phosphoester backbone has a structure represented by formula (IA), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof: wherein X is selected from O; Z is selected from hydroxyl or thiol; Base is selected from a nucleotide base; R1 is selected from unsubstituted C1-C6 alkyl, R2, R3, R4 are selected from H; R5 is selected from halogen, unsubstituted C1-C6 alkyl, unsubstituted C1-C6 alkoxy; R6 is selected from H, halogen, and unsubstituted C1-C6 alkyl.

2. The double-stranded oligonucleotide according to claim 1, characterized in that R1 is selected from methyl, R2, R3, R4 are selected from H; Furthermore, the nucleotide modified with a phosphoester backbone has a structure represented by formula (IIA), formula (IIA-1) or formula (IIA-2), or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof: 、 、 ； wherein X is selected from O; Base is selected from the group consisting of nucleobases A, U, G, C, and T; R5 is selected from F, methyl, ethyl, methoxy or ethoxy; R6 is selected from H, F, methyl or ethyl.

3. The double-stranded oligonucleotide according to claim 2, characterized in that The nucleotide modified with a phosphoester backbone is selected from any of the following structures, or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof: 、 、 ； Z is selected from hydroxyl or mercapto.

4. The double-stranded oligonucleotide according to claim 3, characterized in that The antisense strand of the double-stranded oligonucleotide comprises two nucleotides modified with a phosphoester backbone, and the two nucleotides modified with a phosphoester backbone are independently located at the first and second positions of the antisense strand of the double-stranded oligonucleotide starting from the 3' end.

5. The double-stranded oligonucleotide according to claim 3, characterized in that The double-stranded oligonucleotide further comprises other modifications selected from 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides or 2'-O-methoxyethyl modified nucleotides.

6. The double-stranded oligonucleotide according to claim 3, characterized in that The antisense strand of the double-stranded oligonucleotide comprises a 3' overhang with 2 nucleotides; the sense strand comprises two consecutive phosphorothioate bonds between the terminal nucleotides starting from the 5' end; and the antisense strand comprises two consecutive phosphorothioate bonds between the terminal nucleotides starting from the 3' end and the 5' end, respectively.

7. The double-stranded oligonucleotide according to any one of claims 1 to 6, characterized in that The sense strand has a length of 19 nucleotides, the antisense strand has a length of 21 nucleotides, and in the direction from the 5' end to the 3' end, at least four nucleotides in the 2nd, 6th, 9-10th, 14th, and 16th positions of the nucleotide sequence of the antisense strand are selected from 2'-fluoro-modified nucleotides, at least one nucleotide in the 16th to 21st positions is selected from the nucleotides modified with the phosphoester backbone, and the nucleotides in the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides; And / or, in the direction from the 5' end to the 3' end, at least three nucleotides at positions 7-10 in the positive chain nucleotide sequence are selected from 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are each independently selected from 2'-O-methyl-modified nucleotides or 2'-O-methoxyethyl-modified nucleotides.

8. A conjugate comprising the double-stranded oligonucleotide according to any one of claims 1 to 7 and one or more ligands capable of binding to cell surface receptors, wherein the ligands are selected from asialoglycoprotein receptor ligands.

9. Use of any of the following in the preparation of a medicament for treating and / or preventing a disease or condition associated with an imbalance in the level of mRNA expressed by a target gene: (I) a double-stranded oligonucleotide according to any one of claims 1 to 7; and / or (II) The conjugate according to claim 8.

10. A pharmaceutical composition comprising any of the following and a pharmaceutically acceptable excipient or adjuvant: (I) a double-stranded oligonucleotide according to any one of claims 1 to 7; and / or (II) The conjugate according to claim 8.

11. A modified nucleoside monomer, wherein the modified nucleoside monomer is selected from any of the following structures, or a stereoisomer thereof, or a tautomer thereof, or a pharmaceutically acceptable salt thereof: 、 、 。

Images