Rice EPSPS enzyme mutant, expression cassette, recombinant bacteria or application thereof

Abstract

The invention discloses a rice EPSPS enzyme mutant, an expression cassette, a recombinant bacterium or an application thereof, and relates to the technical field of plant genetic engineering. The invention can obtain a glyphosate-resistant rice EPSPS enzyme by mutating a wild-type rice EPSPS enzyme at a specific position, and after transforming the wild-type rice EPSPS enzyme into a plant, the rice EPSPS enzyme mutant can be expressed and has glyphosate resistance. The rice EPSPS enzyme mutant provided by the invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new approach for cultivating glyphosate-resistant crop varieties. At the same time, the rice EPSPS enzyme mutant, nucleic acid molecule, expression cassette or vector or recombinant bacterium or recombinant cell provided by the invention has broad application prospects in cultivating glyphosate-resistant rice.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a rice EPSPS enzyme mutant, an expression cassette, a recombinant bacterium or an application thereof. Background Art

[0002] Farmland weeds are one of the important factors affecting crop yields, and manual weeding consumes a lot of human resources and costs, and is not convenient for intensive agricultural production, which seriously restricts the development of crop planting towards high yield, high quality and low cost. Therefore, herbicides came into being, and the use of herbicides has played a great role in solving farmland weed damage, promoting the innovation of cultivation methods and increasing production.

[0003] At present, there are many types of herbicides, especially selective herbicides, which only act on a specific group of weeds without affecting crops, but different selective herbicides are often used in combination to effectively control weeds. The other type is non-selective herbicides, among which glyphosate has quickly occupied the dominant position of the world's herbicides due to its broad spectrum, low toxicity, safety, and no soil residue. Glyphosate is a herbicide that targets 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) in plant chloroplasts.

[0004] EPSPS is an enzyme involved in the biosynthesis pathway of shikimic acid and is involved in the synthesis of aromatic amino acids. Glyphosate achieves its weed control goal mainly by interfering with the shikimic acid synthesis pathway of plants. Its mechanism of action is mainly to competitively inhibit the activity of EPSPS in the shikimic acid pathway, so that the affected plants cannot continuously synthesize essential amino acids, thereby affecting the normal growth of the plants and even death. However, as a non-selective herbicide, glyphosate also indiscriminately harms crops while efficiently removing weeds. Therefore, cultivating and planting glyphosate-resistant crop varieties can not only reduce the burden of manual weeding, but also increase crop yields, which is conducive to mechanized crop production.

[0005] The most commonly used glyphosate-resistant CP4 gene on the market is a gene that is highly resistant to glyphosate isolated by Monsanto from Agrobacterium. At present, crops that have obtained glyphosate-resistant traits by introducing the CP4 gene through transgenic technology have been widely used, and corn and soybean varieties containing the CP4 gene have been widely promoted in the past 20 years. These transgenic crops can grow normally in the presence of glyphosate, thereby reducing dependence on glyphosate, reducing the cost and labor consumption of manual weeding. However, new glyphosate-resistant genes and glyphosate-resistant crop varieties based on them are still constantly needed in production applications. In addition, due to the anti-GMO wave, the acceptance of genetically modified crops in the world is still low. Even in the Americas, where the largest area of ​​genetically modified crops is planted, genetic modification is mainly limited to a few crops such as corn, soybeans, and cotton. Therefore, it is particularly important to create a plant EPSPS gene that is resistant to glyphosate.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The object of the present invention is to provide a rice EPSPS enzyme mutant, an expression cassette, a recombinant bacterium or an application thereof to solve the above technical problems.

[0008] The present invention is achieved in that:

[0009] In a first aspect, the present invention provides a rice EPSPS enzyme mutant having glyphosate resistance,

[0010] It is as follows (i) or (ii):

[0011] (i): The rice EPSPS enzyme mutant has the following mutations compared to the wild-type rice EPSPS enzyme: (1) at least one of the amino acid mutations A131G, A216T, K274R, L275P, K311Q, K313E, S328G and V403A;

[0012] and (2) G172A and / or P177S;

[0013] (ii): It has at least 70% identity with the EPSPS enzyme mutant shown in (i), and is identical to the EPSPS enzyme mutant shown in (i) at least one amino acid at position 131, 216, 274, 275, 311, 313, 328 and 403, or is identical to the EPSPS enzyme mutant shown in (i) at least one amino acid at position 172 and 177, and has glyphosate resistance;

[0014] Compared with the wild-type rice EPSPS enzyme, the rice EPSPS enzyme mutant does not have the following mutations at the same time: A131G, G172A, P177S, K274R, K313E and V403A amino acid mutations.

[0015] The inventors found that by mutating the wild-type rice EPSPS enzyme at the above position, a rice EPSPS enzyme resistant to glyphosate can be obtained, and after transforming it into a plant, a rice EPSPS enzyme mutant can be expressed and has glyphosate resistance. The rice EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new way to cultivate glyphosate-resistant crop varieties. At the same time, the rice EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve the weeding effect in agricultural production, reduce the weeding cost, and promote the increase of crop yield.

[0016] The expression of the rice EPSPS enzyme mutant in rice can confer tolerance to herbicides that inhibit EPSPS enzymes, especially herbicides of the phosphonomethylglycine family, including but not limited to glyphosate.

[0017] As defined herein, "glyphosate" includes any herbicidally effective form of N-phosphonomethylglycine (including any salts thereof), other forms that result in production of the glyphosate anion in plants, and any other herbicides in the phosphonomethylglycine family.

[0018] The EPSPS enzyme in the present invention refers to 5-enolpyruvylshikimate-3-phosphate synthase.

[0019] The number of amino acid mutations in the above mutation (1) is 1, 2, 3, 4, 5, 6, 7 or 8. When the number is 1, it may be any one of A131G, A216T, K274R, L275P, K311Q, K313E, S328G and V403A amino acid mutations;

[0020] When there are two types, they can be A131G and A216T, A131G and K274R, A131G and L275P, A131G and K311Q, A131G and K313E, A131G and S328G, A131G and V403A, A216T and K274R, A216T and L275P, A216T and K311Q, A216T and K313E, A216T and S328G, A216T and V403A, K274R and L27 Any of 5P, K274R and K311Q, K274R and K313E, K274R and S328G, K274R and V403A, L275P and K311Q, L275P and K313E, L275P and S328G, L275P and V403A, K311Q and K313E, K311Q and S328G, K311Q and V403A, K313E and S328G, K313E and V403A, S328G and V403A;

[0021] When there are three types, it can be any one of A131G, A216T and K274R; L275P, K311Q and K313E; A131G, S328G and V403A; A216T, K274R and L275P; K311Q, K313E and S328G.

[0022] When there are 4 types, it can be any one of A131G, A216T, K274R and L275P; K311Q, K313E, S328G and V403A; A216T, K274R, L275P and K311Q; A131G, A216T, S328G and V403A.

[0023] When there are 5 types, it can be any one of A131G, A216T, K274R, L275P and K311Q; A131G, A216T, K313E, S328G and V403A; L275P, K311Q, K313E, S328G and V403A.

[0024] When there are 6 types, it can be any one of A131G, A216T, K274R, L275P, K311Q and K313E; A131G, A216T, K274R, L275P, S328G and V403A; A216T, K274R, L275P, K311Q, K313E and S328G.

[0025] When there are 7 types, it can be any one of A131G, A216T, K274R, L275P, K311Q, K313E and S328G; A131G, A216T, K274R, L275P, K311Q, K313E and V403A; any one of A131G, K274R, L275P, K311Q, K313E, S328G and V403A.

[0026] In addition, those skilled in the art can adjust the combination of mutations according to the number of mutation types or resistance requirements, and are not limited to the combinations listed above.

[0027] and the EPSPS enzyme mutant shown in (i) having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

[0028] In a preferred embodiment of the present invention, the amino acid sequence of the wild-type rice EPSPS enzyme is shown in SEQ ID NO: 6, and the sequence contains a signal peptide.

[0029] In a preferred embodiment of the present invention, the rice EPSPS enzyme mutant has the following mutations compared to the wild-type rice EPSPS enzyme:

[0030] (1) at least one of the amino acid mutations A216T and K274R;

[0031] and (2) G172A and / or P177S.

[0032] Rice EPSPS enzymes are mutated at the above mutation sites to obtain rice with glyphosate resistance. In particular, rice EPSPS enzyme mutants with K274R mutations have at least 10 times resistance to glyphosate (41% glyphosate isopropylammonium salt solution) after transformation into rice.

[0033] In a preferred embodiment of the present invention, the rice EPSPS enzyme mutant has the following mutations compared to the wild-type rice EPSPS enzyme:

[0034] (1) at least one of the amino acid mutations A131G, K274R, L275P, K311Q, K313E, S328G, and V403A;

[0035] and (2) G172A and / or P177S.

[0036] In a preferred embodiment of the present invention, the rice EPSPS enzyme mutant has any of the following mutations compared to the wild-type rice EPSPS enzyme:

[0037] (1) A131G, G172A, P177S, K274R, K311Q, and V403A;

[0038] (2) G172A, P177S, and A216T;

[0039] (3) G172A and K274R;

[0040] (4) P177S, L275P and S328G.

[0041] In particular, after transformation with the EPSPS mutations shown in (3) and (4), rice has a high resistance to glyphosate.

[0042] In a second aspect, the present invention also provides a nucleic acid molecule encoding the above-mentioned rice EPSPS enzyme mutant with glyphosate resistance.

[0043] The term "nucleic acid molecule encoding a rice EPSPS enzyme mutant with glyphosate resistance" may include a polynucleotide encoding a mutant protein of the present invention, or may include additional coding and / or non-coding sequences.

[0044] In the case where the present invention provides the above-mentioned amino acid sequence, those skilled in the art can easily obtain the nucleic acid sequence encoding the above-mentioned EPSPS enzyme mutant according to the degeneracy of the codon. For example, the nucleic acid sequence encoding the above-mentioned EPSPS enzyme mutant can be obtained by making corresponding nucleotide mutations on the nucleic acid sequence encoding the wild-type EPSPS enzyme. This is easy to achieve for those skilled in the art.

[0045] The mutant proteins and polynucleotides of the present invention are preferably provided in an isolated form, and more preferably, purified to homogeneity.

[0046] The full-length sequence of the polynucleotide of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art are used as templates to amplify and obtain the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in each time together in the correct order.

[0047] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0048] In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is shorter. Usually, a long fragment of sequence can be obtained by synthesizing multiple small fragments first and then connecting them.

[0049] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0050] The method of amplifying DNA / RNA using PCR technology is preferably used to obtain the polynucleotides of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.

[0051] In an alternative embodiment, the nucleic acid molecule is selected from DNA, RNA, or a combination thereof.

[0052] In a third aspect, the present invention further provides an expression cassette or vector, which comprises the above-mentioned nucleic acid molecule.

[0053] Vectors include but are not limited to expression vectors, shuttle vectors, and integration vectors.

[0054] Expression vector

[0055] The present invention also relates to a vector comprising the nucleic acid molecule of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the mutant protein coding sequence of the present invention, and a method for producing the rice EPSPS enzyme mutant of the present invention by recombinant technology.

[0056] In the present invention, the polynucleotide sequence encoding the mutant protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0057] Preferably, the expression cassette further comprises a promoter and a terminator.

[0058] The promoter is the promoter of the rice EPSPS gene, and its sequence is shown in SEQ ID NO: 11; the terminator is the terminator of the rice EPSPS gene, and its sequence is shown in SEQ ID NO: 12; all promoters and terminators in the expression cassette can be set to be derived from rice.

[0059] Preferably, the nucleotide sequence of the expression cassette is selected from any one of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. SEQ ID NO: 2 corresponds to an expression cassette expressing A131G, G172A, P177S, K274R, K311Q and V403A mutations.

[0060] SEQ ID NO:3 corresponds to the expression cassette expressing the G172A, P177S and A216T mutations;

[0061] SEQ ID NO:4 corresponds to the expression cassette expressing the G172A and K274R mutations;

[0062] SEQ ID NO:5 corresponds to the expression cassette for expressing the P177S, L275P and S328G mutations.

[0063] In a fourth aspect, the present invention further provides a recombinant bacterium or a recombinant cell, wherein the recombinant bacterium or the recombinant cell contains a gene encoding the above-mentioned rice EPSPS enzyme mutant with glyphosate resistance, and the recombinant cell is a non-plant cell.

[0064] The recombinant bacteria may be selected from Agrobacterium; the recombinant cells may be competent cells.

[0065] The recombinant cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher non-plant eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast.

[0066] In a fifth aspect, the present invention also provides a rice EPSPS enzyme mutant, nucleic acid molecule, expression cassette or vector having glyphosate resistance or the use of the above-mentioned recombinant bacteria or recombinant cells in cultivating glyphosate-resistant plants.

[0067] The plant is selected from rice, tobacco, soybean, corn, cotton, sorghum, wheat or rapeseed.

[0068] In an optional embodiment, it includes at least one of the following application methods:

[0069] (1) delivering nucleic acid molecules into target plant cells;

[0070] (2) transforming the target plant with an expression cassette or vector by gene gun or Agrobacterium infection, wherein the expression cassette or vector contains a gene encoding a rice EPSPS enzyme mutant encoding glyphosate resistance;

[0071] (3) introducing a recombinant bacterium or a recombinant cell into a target plant, wherein the recombinant bacterium or the recombinant cell contains a gene encoding a rice EPSPS enzyme mutant that is resistant to glyphosate.

[0072] In an optional embodiment, the method of introduction is selected from a genetic transformation method, a genome editing method or a gene mutation method.

[0073] The above genetic transformation methods include but are not limited to: producing individuals with glyphosate resistance by selfing or crossing parent plants with genes of glyphosate-resistant EPSPS enzyme mutants with other plant individuals.

[0074] In other embodiments, the above transformation methods include but are not limited to Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel method.

[0075] In a sixth aspect, the present invention also provides a method for detecting EPSPS mutant rice with glyphosate resistance, which comprises: determining whether the rice to be tested contains the above-mentioned nucleic acid molecule; or determining whether the rice to be tested contains the above-mentioned rice EPSPS enzyme mutant with glyphosate resistance.

[0076] Determine whether the rice to be tested contains the above-mentioned nucleic acid molecules: including but not limited to detection by detecting primers, probes, nucleic acid aptamers, etc. Detection of nucleic acid molecules is achieved by amplification, hybridization, etc.

[0077] The method for determining whether the rice to be tested contains the above-mentioned rice EPSPS enzyme mutant with glyphosate resistance includes but is not limited to: modifying a marker that can detect the EPSPS enzyme mutant on a solid phase carrier to achieve qualitative or quantitative determination of the rice EPSPS enzyme mutant. The solid phase carrier includes but is not limited to: magnetic beads, test strips, microplates, membranes, micron-sized particles, nanoparticles, etc.

[0078] The present invention has the following beneficial effects:

[0079] The present invention can obtain a glyphosate-resistant rice EPSPS enzyme by mutating the wild-type rice EPSPS enzyme at the above position, and after transforming the wild-type rice EPSPS enzyme into a plant, the rice EPSPS enzyme mutant can be expressed and has glyphosate resistance. The rice EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new way to cultivate glyphosate-resistant crop varieties. At the same time, the rice EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve the weeding effect in agricultural production, reduce the weeding cost, and promote the increase of crop yield.

[0080] The present invention provides a method for expressing a rice EPSPS enzyme mutant in rice, which can confer tolerance to herbicides that inhibit EPSPS enzymes, particularly herbicides of the phosphonomethylglycine family, including but not limited to glyphosate.

[0081] In addition, the present invention also provides an expression cassette for expressing a rice EPSPS enzyme mutant, which confers a rice glyphosate-resistant EPSPS mutant gene. The expression cassette is derived from the rice variety itself rather than a microorganism, and can be suitable for transforming various plant varieties such as rice, tobacco, soybean, corn, cotton, sorghum, wheat and the like, and has a wider range of applications.

[0082] The rice EPSPS enzyme mutant, nucleic acid molecule, expression box or vector or recombinant bacteria or recombinant cell with glyphosate resistance provided by the present invention has broad application prospects in cultivating glyphosate-resistant rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0084] Figure 1 The expression cassette map for the herbicide resistance gene 4KO44;

[0085] Figure 2 The expression cassette map for the herbicide resistance gene 4KO74;

[0086] Figure 3 The expression cassette map for the herbicide resistance gene 4KO107;

[0087] Figure 4 The expression cassette map for the herbicide resistance gene 4KO125;

[0088] Figure 5A schematic diagram of the structure of the pADV5 vector provided by the present invention;

[0089] Figure 6 The invention provides the growth results of Escherichia coli containing rice EPSPS mutants on culture media containing glyphosate at different concentrations. DETAILED DESCRIPTION

[0090] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used for the practice or testing of the preparations or unit doses herein, some methods and materials are now described. Unless otherwise stated, the techniques adopted or considered herein are standard methods. Materials, methods and examples are illustrative and non-restrictive only.

[0092] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Plant Physiology (Cang Jing et al., 2017); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); Plant Molecular Genetics (Monica A. Hughes et al.); PCR: The Polymerase Chain Reaction (Mullis et al., 1994), each of which is expressly incorporated herein by reference.

[0093] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0094] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0095] According to the data of the International Gene Database (GenBank) and the inventor's sequencing of cultivated varieties, it was found that the rice EPSPS (OsEPSPS) gene structure is relatively conservative in rice varieties, and the gene structure is basically the same between various varieties, including indica and japonica subspecies, and all contain 8 exons. The bases and encoded amino acids in the coding region are more conservative. Using the method in the patent CN105969782B previously applied by the applicant, the rice EPSPS gene was randomly mutated by PCR and site-directed mutagenesis, and then transferred to the mutant strain unique to the patent for glyphosate resistance screening, and a rice EPSPS mutant with glyphosate resistance was obtained. Based on the information of these mutants, primers were designed to synthesize the required mutant bases in the forward and reverse PCR primers. The rice genomic DNA was used as a template to amplify the gene fragments with the mutant bases by PCR, and then overlapping PCR was used to splice the fragments into the entire OsEPSPS coding gene fragment, that is, the expression cassette composed of the OsEPSPS promoter, the glyphosate-resistant OsEPSPS coding region and the OsEPSPS terminator.

[0096] Example 1

[0097] This example provides an expression cassette (named 4KO44) capable of expressing an EPSPS enzyme comprising A131G, G172A, P177S, K274R, K311Q and V403A mutation sites.

[0098] It is difficult to determine the boundary between the OsEPSPS gene promoter and terminator from existing literature and multiple database data. In the present embodiment, the 1000 bases after the termination codon (TGA) are taken as the terminator. The promoter tried 2000 and 4000 bases at the front end of the start codon (ATG), and found that the difference was not great. The following is an example of a 2000 base promoter.

[0099] (1) Using the KOD system and Huaidao 5 rice genomic DNA as a template, PCR amplification of the PYN fragment (partial exon and intron fragments without the mutated OsEPSPS) was performed;

[0100] (2) KOD PCR: In a 20 μl reaction system, the PYN amplified in the previous step was used as a DNA template and PCR amplified using forward and reverse primers containing the mutation to obtain different DNA fragments containing the mutant base. These fragments were then spliced ​​together using overlapping PCR to form PY fragments (exon and intron fragments containing the mutation);

[0101] (3) Using the genomic DNA of Huaidao 5 rice as a template, the PCR fragment PZ (terminator fragment) was amplified using the KOD system;

[0102] (4) Using PY+PZ as template, overlapping PCR was performed using the KOD system to obtain the PYZ fragment (containing the mutated exon and intron fragments + terminator fragment);

[0103] (5) Using the genomic DNA of Huaidao 5 rice as a template, the PCR fragment PX (promoter fragment) was amplified using the KOD system;

[0104] (6) Using PX+PYZ as template, the 4KO44 fragment (the entire OsEPSPS gene fragment) was obtained by overlapping PCR amplification.

[0105] The 4KO44 fragment is the 4KO44 expression cassette, the nucleotide sequence of which is shown in SEQ ID NO: 2, the amino acid sequence of the EPSPS enzyme mutant is shown in SEQ ID NO: 7, and the structure is shown in Figure 1 As shown, the expression cassette consists of the OsEPSPS gene promoter, the 4KO44 coding gene and the OsEPSPS terminator.

[0106] Compared with the nucleotide sequence (SEQ ID NO.1) of the wild-type rice EPSPS encoding gene fragment (4KOWT), the mutant 4KO44 has multiple base mutations in its exons, that is, the base at position 3096 from the 5' end to the 3' end of the nucleic acid sequence of the mutant 4KO44 is mutated from C to G, the two consecutive bases at positions 3219 and 3220 are mutated from GA to CG, the base at position 3233 is mutated from C to T, the base at position 3235 is mutated from A to C, the base at position 3886 is mutated from A to G, the base at position 3996 is mutated from A to C, and the base at position 4582 is mutated from T to C. Compared with the amino acid sequence (SEQ ID NO:6) of the wild-type rice EPSPS, the mutant 4KO44 has multiple amino acid residue site mutations. They are: the 131st amino acid residue from N-terminus to C-terminus mutated from A to G (A131G); the 172nd amino acid residue mutated from G to A (G172A); the 177th amino acid residue mutated from P to S; the 274th amino acid residue mutated from K to R; the 311th amino acid residue mutated from K to Q; and the 403rd amino acid residue mutated from V to A.

[0107] The multiple site mutations render the expression cassette 4KO44 resistant to glyphosate.

[0108] Example 2

[0109] This example provides an expression cassette (named 4KO74) capable of expressing an EPSPS enzyme containing G172A, P177S and A216T mutation sites.

[0110] According to the experimental method described in Example 1, the 4KO74 expression cassette was constructed in this example. The nucleotide sequence is shown in SEQ ID NO:3, the amino acid sequence of the EPSPS enzyme mutant is shown in SEQ ID NO:8, and the structure of the expression cassette is shown in Figure 2 As shown, the expression cassette consists of the OsEPSPS gene promoter, the 4KO74 coding gene and the OsEPSPS terminator.

[0111] Compared with the nucleotide sequence (SEQ ID NO.1) of the coding gene of wild-type rice EPSPS (4KOWT), the mutant 4KO74 has multiple base mutations in its exons, that is, two consecutive bases at positions 3219 and 3220 from the 5' end to the 3' end of the nucleic acid sequence of the mutant 4KO74 are mutated from GA to CG, the 3233rd position is mutated from C to T, the 3235th position is mutated from A to C, and the 3434th position is mutated from G to A. Compared with the amino acid sequence (SEQ ID NO:6) of wild-type rice EPSPS, the amino acid sequence has multiple amino acid residue site mutations, namely: the 172nd amino acid residue from the N-terminus to the C-terminus is mutated from G to A; the 177th amino acid residue is mutated from P to S; and the 216th amino acid residue is mutated from A to T.

[0112] The multiple site mutations make the rice EPSPS full-length gene mutant 4KO74 resistant to glyphosate.

[0113] Example 3

[0114] This example provides an expression cassette (named 4KO107) capable of expressing an EPSPS enzyme containing G172A and K274R mutation sites.

[0115] According to the experimental method of Example 1 above, the 4KO107 expression cassette was constructed in this example. The nucleotide sequence is shown in SEQ ID NO:4, the amino acid sequence of the EPSPS enzyme mutant is shown in SEQ ID NO:9, and the structure is shown in Figure 3 As shown, the expression cassette consists of the OsEPSPS gene promoter, the 4KO107 coding gene and the OsEPSPS terminator.

[0116] Compared with the nucleotide sequence (SEQ ID NO.1) of the coding gene of wild-type rice EPSPS (4KOWT), the mutant 4KO107 has multiple base mutations in its exons, that is, two consecutive bases at positions 3219 and 3220 from the 5' end to the 3' end of the nucleic acid sequence of the mutant 4KO107 are mutated from GA to CG, and the 3886th position is mutated from A to G. Compared with the amino acid sequence (SEQ ID NO:6) of wild-type rice EPSPS, the amino acid sequence has multiple amino acid residue site mutations, namely: the 172nd amino acid residue from the N-terminus to the C-terminus is mutated from G to A; the 274th amino acid residue is mutated from K to R.

[0117] The multiple site mutations make the rice EPSPS full-length gene mutant 4KO107 resistant to glyphosate.

[0118] Example 4

[0119] This example provides an expression cassette (named 4KO125) capable of expressing an EPSPS enzyme containing P177S, L275P and S328G mutation sites.

[0120] According to the experimental method provided in Example 1 above, the 4KO125 expression cassette was constructed in this example. The nucleotide sequence is shown in SEQ ID NO:5, the encoded amino acid sequence is shown in SEQ ID NO:10, and the structure is shown in Figure 4 As shown, the expression cassette consists of the OsEPSPS gene promoter, the 4KO125 coding gene and the OsEPSPS terminator.

[0121] Compared with the nucleotide sequence (SEQ ID NO.1) of the coding gene of wild-type rice EPSPS (4KOWT), the mutant 4KO125 has multiple base mutations in its exons, that is, the 3233rd position from the 5' end to the 3' end of the nucleic acid sequence of the mutant 4KO125 is mutated from C to T, the 3235th position is mutated from A to C, the 3889th and 3890th two consecutive bases are mutated from CA to CG, and the 4140th position is mutated from A to G. Compared with the amino acid sequence (SEQ ID NO:6) of the wild-type rice EPSPS, the amino acid sequence has multiple amino acid residue site mutations, namely: the 177th amino acid residue from the N-terminus to the C-terminus is mutated from P to S; the 275th amino acid residue is mutated from L to P, and the 328th amino acid residue is mutated from S to G.

[0122] The multiple site mutations make the rice EPSPS full-length gene mutant 4KO125 resistant to glyphosate.

[0123] Example 5

[0124] This example uses the gene gun method to transform rice, which specifically includes the following steps:

[0125] 1. Callus Induction

[0126] 1.1 Seed disinfection

[0127] Take the dried mature seeds, shell them manually, and then add 60-80% alcohol to disinfect for 20-60 seconds. Pour off the alcohol and wash once with sterile water; add 2-3% sodium hypochlorite solution and soak for 15-20 minutes. Pour off the sodium hypochlorite solution and soak and wash 6-7 times with sterile water, 3 minutes each time.

[0128] 1.2 Induction and subculture

[0129] The seeds were placed on sterile filter paper to blot dry, and placed in induction medium, 10-15 seeds per dish, and cultured in the dark at 30°C for 28-35 days. The callus tissue was transferred to fresh medium and cultured for another 7-14 days.

[0130] 1.3 Hypertonic treatment

[0131] Take the ball-shaped callus of appropriate size and transfer it to the hypertonic medium for 4-8 hours;

[0132] 2. DNA fragment packaging

[0133] 2.1 DNA fragment preparation

[0134] The concentration of the OsEPSPS gene fragment solution provided in Experimental Example 1-4 was adjusted to 50-1000 ng / μL for later use.

[0135] 2.2 Preparation of gold powder mother liquor (prepared on the spot)

[0136] Weigh 30 mg of microparticles into a 1.5 ml microcentrifuge tube. Add 1 ml of 70% ethanol (v / v). Vortex vigorously to mix for 3-5 minutes. Allow the particles to soak in 70% ethanol for 15 minutes. Pellet the microparticles by spinning in a microcentrifuge for 5 seconds. Discard the supernatant.

[0137] Repeat the following washing steps three times: add 1 ml sterile water; vortex vigorously for 1 minute; let the particles settle for 1 minute. Pellet the particles by briefly spinning in a microcentrifuge, aspirate the liquid and discard. After the third wash, add 500ul sterile 50% glycerol to a particle concentration of 60mg / ml. Weigh 60mg (diameter 0.8-1.5μm) gold powder into a 1.5ml Eppendorf tube; add 0.5ml 100% ethanol, vortex thoroughly for 3-5min, let stand for 5min, centrifuge at 5000rpm for 30s; repeat 2-3 times; add 0.5mL 75% ethanol, vortex thoroughly, let stand for 1min, centrifuge at 5000rpm for 30s; discard the supernatant, add 1.2ml sterile 50% glycerol, vortex thoroughly, aliquot 50μL / 1.5ml Eppendorf tube, and store at 4℃.

[0138] 2.3 DNA packaging

[0139] Take 50 μl of gold powder suspension and sonicate it with an ultrasonic disruptor for 1-2 minutes, then vortex thoroughly; then add 5 μl of DNA (50-1000 ng / μl), 50 μl of 2.5 M CaCl 2 and 20μl 0.1M spermidine, vortex and add; vortex thoroughly, let stand on ice for 3-10min, centrifuge at 3000-10000rpm for 10-30s, and remove the supernatant; add 140μl 70% ethanol, vortex to mix, let stand for 1-2min, centrifuge at 3000-10000rpm for 10-30s, and remove the supernatant; repeat this step once; add 140μl 100% ethanol, vortex to mix, let stand for 1-2min, centrifuge at 3000-10000rpm for 10-30s, and remove the supernatant; repeat this step once. Finally, vortex with 30-100μl anhydrous ethanol and place on ice until use. Evenly apply the prepared gold powder + OsEPSPS gene suspension on the flight membrane, wait for it to dry naturally, and then bombard the rice callus tissue.

[0140] 3. Microparticle bombardment

[0141] 3.1 Preparations before bombardment

[0142] Before using the flight membrane, flight membrane fixing groove, split membrane, stainless steel mesh, split membrane cover, particle launch device, etc., soak them in 75% alcohol for 15 minutes, then dry them for later use.

[0143] 3.2 Gene gun bombardment transformation

[0144] Rice callus that had been treated on hypertonic medium for 4-8 h was bombarded using a gene gun.

[0145] After bombardment, callus tissue was cultured on hypertonic medium for 12-24 h.

[0146] 4. Cultivation and rooting

[0147] 4.1 The callus was transferred to the screening medium S1g400 and cultured in the dark at 30°C for 14 days;

[0148] 4.2 The callus was transferred to the screening medium S2g400 and cultured in the dark at 30°C for 14 days;

[0149] 4.3 The callus tissue was transferred to differentiation medium Fg5, 30℃, 18 hours of light, and cultured for about 21 days before changing to new differentiation medium and continuing to culture for about 21 days;

[0150] 4.4 Select green spots and young shoots and place them on new differentiation medium Fg5, and continue to culture at 30℃ for about 21 days;

[0151] 4.5 When the new seedlings grow to about 2 cm, transfer them to the rooting medium and culture them at 30℃ for 18 hours for 2 to 4 weeks;

[0152] 4.6 When roots are induced and the seedlings grow to 7-10 cm, transplant them into the soil. These seedlings are the C0 generation.

[0153] Example 6

[0154] This example is about obtaining and identifying positive plants.

[0155] One week after transplanting the C0 seedlings provided in Example 5, 10x the field dosage of glyphosate was sprayed. In this experiment, Roundup herbicide (41% glyphosate isopropyl ammonium salt solution) was used for spraying. After one week of spraying, the surviving rice seedlings were selected, sampled, and DNA was extracted by alkali boiling method. The designed specific primers were used for EPSPS copy number detection. The primer sequences are as follows:

[0156] R96A5:CAAGCAGTGCTTTCTCCCAAAATTATG;

[0157] R96A3:AATGCTAATTCAAAAGAAGACATCAAGACC.

[0158] PCR used KOD enzyme from Toyobo Co., Ltd., and the PCR reaction system (20ul) was as follows:

[0159]

[0160] The PCR reaction conditions were:

[0161]

[0162] Take 3ul of PCR product and run 1% agarose gel electrophoresis. The target band size is 1063bp. Send the PCR product to Shanghai Bioengineering Co., Ltd. for sequencing. According to the sequencing results, the copy number of C0 seedlings is evaluated, and the low copy number C0 seedlings are retained.

[0163] Example 7

[0164] This embodiment provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE44, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 20.

[0165] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide shown in SEQ ID NO: 13, the rice EPSPS mutant OE44 has A70(131)G, G111(172)A, P116(177)S, K213(274)R, K250(311)Q and V342(403)A mutations.

[0166] That is, relative to the wild-type rice EPSPS without a signal peptide, the 70th amino acid residue of the rice EPSPS mutant OE44 mutated from A to G, the 111th amino acid residue mutated from G to A, the 116th amino acid residue mutated from P to S, the 213th amino acid residue mutated from K to R, the 250th amino acid residue mutated from K to Q, and the 342nd amino acid residue mutated from V to A, and these sites correspond to the 131st, 172nd, 177th, 274th, 311th and 403rd positions of the wild-type rice EPSPS (SEQ ID NO: 6) containing a signal peptide, respectively.

[0167] This example also provides a rice EPSPS mutant OE44 encoding gene encoding the above rice EPSPS mutant OE44, and its nucleotide sequence is shown in SEQ ID NO:21.

[0168] The rice EPSPS mutant OE44 encoding gene and the rice EPSPS mutant OE44 provided in the embodiment of the present invention can both be obtained by chemical synthesis.

[0169] Example 8

[0170] This embodiment provides a plant EPSPS mutant, which is derived from rice, namely, rice EPSPS mutant OE74, which is obtained by mutating wild-type rice EPSPS (amino acid sequence as shown in SEQ ID NO: 13) without a signal peptide, and its amino acid sequence is shown in SEQ ID NO: 22.

[0171] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide as shown in SEQ ID NO: 13, the rice EPSPS mutant OE74 has G111(172)A, P116(177)S and A155(216)T mutations.

[0172] That is, relative to the wild-type rice EPSPS without a signal peptide, the 111th amino acid residue of the rice EPSPS mutant OE74 mutated from G to A, the 116th amino acid residue mutated from P to S, and the 155th amino acid residue mutated from K to T, which sites correspond to the 172nd, 177th, and 216th sites of the wild-type rice EPSPS containing a signal peptide (SEQ ID NO: 6), respectively.

[0173] This example also provides a rice EPSPS mutant OE74 encoding gene encoding the rice EPSPS mutant OE74, and its nucleotide sequence is shown in SEQ ID NO:23.

[0174] The rice EPSPS mutant OE74 encoding gene and the rice EPSPS mutant OE74 provided in the embodiments of the present invention can both be obtained by chemical synthesis.

[0175] Example 9

[0176] This embodiment provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE107, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 24.

[0177] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide as shown in SEQ ID NO: 13, the rice EPSPS mutant OE107 has two mutations, G111(172)A and K213(274)R.

[0178] That is, relative to the wild-type rice EPSPS without a signal peptide, the 111th amino acid residue of the rice EPSPS mutant OE107 mutated from G to A, and the 213th amino acid residue mutated from K to R, and these two sites correspond to the 172nd and 274th positions of the wild-type rice EPSPS containing a signal peptide (SEQ ID NO: 6), respectively.

[0179] This example also provides a rice EPSPS mutant OE107 encoding gene encoding the rice EPSPS mutant OE107, the nucleotide sequence of which is shown in SEQ ID NO:25.

[0180] The rice EPSPS mutant OE107 encoding gene and the rice EPSPS mutant OE107 provided in the embodiments of the present invention can both be obtained by chemical synthesis.

[0181] Example 10

[0182] This embodiment provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE125, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 26.

[0183] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide as shown in SEQ ID NO: 13, the rice EPSPS mutant OE125 has P116(177)S, L214(275)P, and S267(328)G mutations.

[0184] That is, relative to the wild-type rice EPSPS without a signal peptide, the 116th amino acid residue of the rice EPSPS mutant OE125 mutated from P to S, the 214th amino acid residue mutated from L to P, and the 267th amino acid residue mutated from S to G, which sites correspond to the 177th, 275th and 328th sites of the wild-type rice EPSPS (SEQ ID NO: 6) containing a signal peptide, respectively.

[0185] This example also provides a rice EPSPS mutant OE125 encoding gene encoding the rice EPSPS mutant OE125, the nucleotide sequence of which is shown in SEQ ID NO:27.

[0186] The rice EPSPS mutant OE125 encoding gene and the rice EPSPS mutant OE125 provided in the embodiments of the present invention can both be obtained by chemical synthesis.

[0187] Comparative Example 1

[0188] This comparative example provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE99, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 14.

[0189] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide shown in SEQ ID NO: 13, the rice EPSPS mutant OE99 has a mutation of G111(172)A.

[0190] That is, relative to the wild-type rice EPSPS without a signal peptide, the 111th amino acid residue of the rice EPSPS mutant OE99 mutated from G to A, which corresponds to the 172nd position of the wild-type rice EPSPS with a signal peptide (SEQ ID NO: 6).

[0191] This example also provides a rice EPSPS mutant OE99 encoding gene encoding the above rice EPSPS mutant OE99, and its nucleotide sequence is shown in SEQ ID NO:15.

[0192] The rice EPSPS mutant OE99 encoding gene and the rice EPSPS mutant OE99 provided in the embodiment of the present invention can be obtained by chemical synthesis.

[0193] Comparative Example 2

[0194] This comparative example provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE101, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 16.

[0195] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide shown in SEQ ID NO: 13, the rice EPSPS mutant OE101 has a mutation of P116(177)S.

[0196] That is, relative to the wild-type rice EPSPS without a signal peptide, the 116th amino acid residue of the rice EPSPS mutant OE101 mutated from P to S, which corresponds to the 177th position of the wild-type rice EPSPS with a signal peptide (SEQ ID NO: 6).

[0197] This example also provides a rice EPSPS mutant OE101 encoding gene encoding the above rice EPSPS mutant OE101, and its nucleotide sequence is shown in SEQ ID NO:17.

[0198] The rice EPSPS mutant OE101 encoding gene and the rice EPSPS mutant OE101 provided in the embodiments of the present invention can both be obtained by chemical synthesis.

[0199] Comparative Example 3

[0200] This comparative example provides a plant EPSPS mutant derived from rice, which is a rice EPSPS mutant OE69, which is obtained by mutating a wild-type rice EPSPS without a signal peptide (amino acid sequence as shown in SEQ ID NO: 13), and its amino acid sequence is shown in SEQ ID NO: 18.

[0201] Compared with the amino acid sequence of the wild-type rice EPSPS without a signal peptide as shown in SEQ ID NO: 13, the rice EPSPS mutant OE69 has two mutations, G111(172)A and P116(177)S.

[0202] That is, relative to the wild-type rice EPSPS without a signal peptide, the 111th amino acid residue of the rice EPSPS mutant OE69 mutated from G to A, which corresponds to the 172nd position of the wild-type rice EPSPS containing a signal peptide (SEQ ID NO: 6); the 116th amino acid residue mutated from P to S, which corresponds to the 177th position of the wild-type rice EPSPS containing a signal peptide (SEQ ID NO: 6).

[0203] This example also provides a rice EPSPS mutant OE69 encoding gene encoding the above rice EPSPS mutant OE69, and its nucleotide sequence is shown in SEQ ID NO:19.

[0204] The rice EPSPS mutant OE69 encoding gene and the rice EPSPS mutant OE69 provided in the embodiment of the present invention can both be obtained by chemical synthesis.

[0205] Comparative Experiment Example 1

[0206] The glyphosate resistance of the rice EPSPS mutants OE99, OE101, OE69, OE44, OE74, OE107 and OE125 provided in Comparative Examples 1-3 and Examples 7-10 was detected respectively, and the method was as follows:

[0207] According to the sequences of nucleic acid molecules provided in Comparative Examples 1-3 and Examples 7-10, genes encoding rice EPSPS mutants OE99, OE101, OE69, OE44, OE74, OE107, OE125 and wild-type rice EPSPS (OE) were synthesized by chemical synthesis, restriction sites (Pac1 and Sbf1) were introduced at both ends, and after restriction digestion, they were ligated to an expression vector (e.g., pADV5 vector, whose structure is as shown in the figure) treated with the same restriction enzymes under the action of a ligase. Figure 5As shown), EPSPS-deficient E. coli were transformed respectively. This defective E. coli was obtained by Tianyu Xinghe Biotechnology Co., Ltd. by knocking out EPSPS on the basis of E. coli DH5α. After verification, positive clones were picked and inoculated into M9 medium containing different concentrations of glyphosate to observe the growth of defective E. coli. Wild-type rice EPSPS mutants were used as negative controls to detect glyphosate resistance of EPSPS mutants OE99, OE101, OE69, OE44, OE74, OE107, and OE125. The results are shown in Figure 6 shown.

[0208] On a medium containing 0 mM glyphosate (AG0), the transformed defective strains encoding the genes encoding wild-type rice EPSPS (OE) and rice EPSPS mutants OE99, OE101, OE69, OE44, OE74, OE107, and OE125 all grew normally, indicating that the EPSPS encoded by OE99, OE101, OE69, OE44, OE74, OE107, and OE125 all had normal EPSPS enzyme activity;

[0209] On the culture medium containing 10 mM glyphosate (AG10), Escherichia coli transformed with wild-type rice EPSPS (OE) could not grow, but Escherichia coli transformed with rice mutants OE99, OE101, OE69, OE44, OE74, OE107, and OE125 grew positively, indicating that the glyphosate resistance of OE99, OE101, OE69, OE44, OE74, OE107, and OE125 mutants was significantly better than that of the wild type.

[0210] On a culture medium containing 20 mM glyphosate (AG20), Escherichia coli transformed with the rice mutant OE101 (Comparative Example 2) could hardly grow, indicating that the resistance of the mutant OE101 containing only the P116(177)S mutation was significantly inferior to that of the mutant OE125 containing the P116(177)S, L214(275)P, and S267(328)G mutations, indicating that the simultaneous presence of the P116(177)S, L214(275)P, and S267(328)G mutations can improve the ability to resist glyphosate.

[0211] On a culture medium containing 50 mM glyphosate (AG50), Escherichia coli transformed with the rice mutant OE99 (Comparative Example 1) could hardly grow, indicating that the resistance of the mutant OE99 containing only the G111(172)A mutation was significantly inferior to that of the mutant OE107 containing the P116(177)S and K213(274)R mutations, indicating that having both the G111(172)A and K213(274)R mutations can improve the ability to resist glyphosate.

[0212] On the medium containing 50 mM glyphosate (AG50), although the E. coli transformed with the rice mutant OE69 (Comparative Example 3) continued to grow, its growth was significantly inhibited compared with that of the E. coli transformed with the mutants OE44 and OE74, respectively. This indicates that the resistance of the mutant OE69 containing both G111(172)A and P116(177)S is not as good as that containing both A70(131)G, G111(172)A, P116( 177)S, K213(274)R, K250(311)Q, V342(403)A; or mutants OE44 and OE74 containing G111(172)A, P116(177)S, A155(216)T mutations at the same time, indicating that the presence of A70(131)G, A155(216)T, K213(274)R, K250(311)Q and V342(403)A has the ability to improve glyphosate resistance.

[0213] Experimental Example 1

[0214] Herbicide tolerance test of positive plants.

[0215] One week after the C0 seedlings of Example 5 were sprayed with 10 times the field dosage of glyphosate (the normal field dosage of glyphosate (1 times) is 1060 grams of active ingredient per hectare, and 10 times is 10,600 grams of active ingredient per hectare), the number of surviving plants and the number of dead plants were counted, and the statistical data are shown in Table 1.

[0216] Table 1 Number of C0 generation plants resistant to at least 10 times glyphosate

[0217] DNA Number of plants wild type 0 Example 1 20 Example 2 24 Example 3 232 Example 4 111

[0218] Table 1 shows that the rice plants transformed with the four expression cassettes can grow normally, indicating that the biological enzyme activities of the rice EPSPS mutants in the four expression cassettes are normal.

[0219] In summary, compared with the wild-type rice EPSPS (SEQ ID NO: 6) and its encoding gene (SEQ ID NO: 1), the rice EPSPS expression cassettes (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5) and rice EPSPS enzyme mutants (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10) provided by the present invention have higher glyphosate resistance and complete biological enzyme activity; in addition, these expression cassettes (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5) are derived from the rice variety itself rather than microorganisms, and can be suitable for transforming various plant varieties such as rice, tobacco, soybean, corn, cotton, sorghum, wheat and the like, and have a wider range of applications.

[0220] At the same time, the sequence of the rice EPSPS mutant gene provided by the present invention can be used to cultivate new glyphosate-resistant rice varieties (non-transgenic method), obtain glyphosate-resistant non-transgenic conventional varieties, and improve the public acceptance of new varieties.

[0221] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rice EPSPS enzyme mutant with glyphosate resistance, characterized in that: Compared with the wild-type rice EPSPS enzyme, the rice EPSPS enzyme mutant contains only any one of the following mutations: (1) A131G, G172A, P177S, K274R, K311Q and V403A; (2) G172A and K274R; the amino acid sequence of the wild-type rice EPSPS enzyme is shown in SEQ ID NO:

6.

2. A nucleic acid molecule, characterized in that The gene encodes the rice EPSPS enzyme mutant with glyphosate resistance as claimed in claim 1.

3. An expression cassette or vector, characterized in that: It comprises the nucleic acid molecule according to claim 2.

4. The expression cassette or vector according to claim 3, characterized in that The expression cassette also includes a promoter and a terminator.

5. The expression cassette or vector according to claim 4, characterized in that The promoter is the promoter of the rice EPSPS gene, and its sequence is shown in SEQ ID NO:11; the terminator is the terminator of the rice EPSPS gene, and its sequence is shown in SEQ ID NO:

12.

6. The expression cassette or vector according to claim 4, characterized in that The nucleotide sequence of the expression cassette is selected from any one of SEQ ID NO: 2 and SEQ ID NO:

4.

7. A recombinant bacterium or a recombinant cell, characterized in that: The recombinant bacteria or recombinant cells contain a gene encoding the rice EPSPS enzyme mutant with glyphosate resistance according to claim 1, and the recombinant cells are non-plant cells.

8. Use of the rice EPSPS enzyme mutant with glyphosate resistance according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette or vector according to any one of claims 3 to 6, or the recombinant bacteria or recombinant cells according to claim 7 in cultivating glyphosate-resistant plants.

9. The use according to claim 8, characterized in that: The plant is selected from rice, tobacco, soybean, corn, cotton, sorghum, wheat or rapeseed.

10. The use according to claim 8, characterized in that: The application method includes at least one of the following: (1) delivering the nucleic acid molecule into target plant cells; (2) transforming the target plant with the expression cassette or vector by gene gun or Agrobacterium infection, wherein the expression cassette or vector contains a gene encoding the rice EPSPS enzyme mutant resistant to glyphosate; (3) Introducing a recombinant bacterium or a recombinant cell into a target plant, wherein the recombinant bacterium or the recombinant cell contains a gene encoding the rice EPSPS enzyme mutant confers resistance to glyphosate.

Images