Mutant sequence of rice osabcb7 gene and method and application thereof in regulating cadmium accumulation in rice
By editing the rice OsABCB7 gene, inserting or replacing nucleotides, and using CRISPR/Cas9 technology to introduce a functional defect mutant into rice plants, the problem of excessive cadmium content in rice was solved, the cadmium absorption content was reduced, and food security and health were ensured.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-02
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies have resulted in excessive cadmium content in rice, posing a threat to food security and human health. Furthermore, current genetic modification methods may hinder rice growth and reduce yield.
By editing the coding region of the rice OsABCB7 gene, inserting or replacing nucleotides to cause loss of protein function, a functional defect mutant was introduced into rice plants using CRISPR/Cas9 technology to reduce cadmium accumulation.
Significantly reduce the cadmium content in rice, cultivate rice varieties with reduced cadmium absorption, ensure food security and human health, and avoid negative impacts on rice growth.
Smart Images
Figure CN118879725B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to a mutant sequence of the rice OsABCB7 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its application. Background Technology
[0002] Cadmium (Cd) is a highly toxic heavy metal. Early industrial and agricultural development neglected environmental issues, leading to a gradual expansion of soil and water pollution by heavy metals such as Cd. Furthermore, Cd accumulates in the human body through the soil-crops-human pathway, causing serious consequences such as kidney damage, bone diseases, and cancer. Rice is one of the main sources of Cd intake for humans.
[0003] Although cadmium is not an essential nutrient for plants, its physical and chemical properties are similar to those of essential plant elements such as zinc (Zn) and iron (Fe). Therefore, it often competes with Zn and Fe for ion channels and carrier proteins, thus being transported into the plant. In recent years, researchers have located and cloned some key genes affecting cadmium accumulation in rice, such as... OsHMA3 , OsNRAMP1 However, most transport proteins are only facultative Cd transporters, and modifying these genes usually disrupts the homeostasis of essential mineral ions in rice, leading to inhibited plant growth and reduced yield. Therefore, further in-depth research is needed on the molecular mechanisms of cadmium absorption, transport, and accumulation in rice, and to explore more genes related to cadmium accumulation.
[0004] In recent years, research has revealed that the ABC (ATP-binding cassette) transporter family in plants plays a crucial role in the transport of substances between cells and the environment. This transporter family exhibits diversity and complexity in plants, including different subfamilies such as ABCA, ABCB, ABCC, and ABCG. Driven by ATP hydrolysis energy, they facilitate the transmembrane transport of organic matter and ions, playing a vital role in processes such as nutrient absorption and toxin removal. In Arabidopsis thaliana, several ABCB transporter genes have been identified as involved in Cd absorption and transport, such as AtABCC1, AtABCC2, AtABCB25, and AtABCG36. Researchers have also found that OsABCG36 in rice can act as an efflux transporter, regulating the efflux of Cd or Cd conjugates from root cells, thereby enhancing the plant's tolerance to Cd. However, currently, there are relatively few ABC transporter family genes related to Cd transport in rice. Therefore, identifying target genes that can reduce cadmium content in rice can provide genetic resources for low-cadmium rice breeding and has significant agricultural application value. Summary of the Invention
[0005] In order to address the problem of excessive cadmium in rice in existing technologies, the purpose of this disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption.
[0006] To achieve the above objectives, the first aspect of this disclosure is a mutant sequence of the rice OsABCB7 gene, which is obtained by mutating the nucleotide sequence of the coding region of the rice OsABCB7 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the coding region of the rice OsABCB7 gene.
[0007] The coding region of the rice OsABCB7 gene has the nucleotide sequence described in (I) or (II):
[0008] (I) The nucleotide sequence shown in SEQ ID NO: 1;
[0009] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.
[0010] Optionally, the mutant sequence is selected from at least one of the following sequences:
[0011] (1) The nucleotide sequence shown in SEQ ID NO:5 was obtained by inserting base A between the 3rd and 4th bases of the target site I of the rice OsABCB7 gene;
[0012] (2) The nucleotide sequence shown in SEQ ID NO: 6 was obtained by inserting a base T between the 3rd and 4th bases of the target site I of the rice OsABCB7 gene.
[0013] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0014] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 7 and / or SEQ ID NO: 8.
[0015] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;
[0016] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0017] The fourth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;
[0018] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0019] The fifth aspect of this disclosure is a method for reducing the cadmium content in rice, the method comprising: gene editing of the rice OsABCB7 gene to mutate the nucleotide sequence of the rice OsABCB7 gene and to change the protein encoded by the OsABCB7 gene.
[0020] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCB7 gene.
[0021] Optionally, the gene editing method includes:
[0022] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCB7 gene;
[0023] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium. Mutations were randomly performed at the target site I in the rice plants. Then, the designed primers were used for detection to screen and obtain T0 generation positive plants with functional defect mutations.
[0024] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0025] The nucleotide sequence of target site I is shown in SEQ ID NO: 9;
[0026] The sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0027] Optionally, in step S1, the mutation includes one of the following:
[0028] (a) Insert a base A between the 3rd and 4th bases of the target site I sequence of the rice OsABCB7 gene;
[0029] (b) Insert a T base between the 3rd and 4th bases of the target site I sequence of the rice OsABCB7 gene.
[0030] The sixth aspect of this disclosure provides the application of the rice OsABCB7 gene and / or the protein encoded by the rice OsABCB7 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0031] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCB7 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0032] Through the aforementioned technical solution, this disclosure achieves the loss of function of the OsABCB7 gene by mutating its coding region nucleotide sequence, thereby reducing cadmium accumulation in rice. This provides genetic resources and technical support for cultivating rice varieties with reduced cadmium absorption, and offers new methods and ideas for breeding low-cadmium varieties and producing safe food. This disclosure can effectively address the problem of excessive cadmium content in rice, which is of great significance for solving food security issues. It also provides technical support for further in-depth research on the molecular mechanisms of cadmium absorption, translocation, and accumulation in rice.
[0033] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description
[0034] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:
[0035] Figure 1 The OsABCB7 gene structure and mutant type are shown in the examples.
[0036] Figure 2 Gene-edited rice osabcb7-1 and osabcb7-2 Cadmium content test results for mutants and wild-type (WT) cadmium. Detailed Implementation
[0037] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.
[0038] The first aspect of this disclosure is a mutant sequence of the rice OsABCB7 gene, which is obtained by mutation of the nucleotide sequence of the coding region of the rice OsABCB7 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the coding region of the rice OsABCB7 gene.
[0039] The coding region of the rice OsABCB7 gene has the nucleotide sequence described in (I) or (II):
[0040] (I) The nucleotide sequence shown in SEQ ID NO: 1;
[0041] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.
[0042] According to this disclosure, the amino acid sequence of the protein encoded by the rice OsABCB7 gene is shown in SEQ ID NO: 2.
[0043] In this disclosure, the inventors have made a surprising discovery that the OsABCB7 gene (accession number: LOC_Os01g52550) can regulate the accumulation of cadmium in rice. This disclosure discloses that by mutating the nucleotide sequence of the rice OsABCB7 gene to cause the gene to lose its function, the accumulation of cadmium in rice can be effectively reduced, and rice varieties with reduced cadmium content can be cultivated.
[0044] According to this disclosure, sequences having more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site include sequences having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site, wherein the aforementioned homologous sequences can encode proteins with the same function as the nucleotide sequence shown in SEQ ID NO: 1.
[0045] In one specific embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:
[0046] (1) The nucleotide sequence shown in SEQ ID NO:5 was obtained by inserting base A between the 3rd and 4th bases of the target site I of the rice OsABCB7 gene;
[0047] (2) The nucleotide sequence shown in SEQ ID NO: 6 was obtained by inserting a base T between the 3rd and 4th bases of the target site I of the rice OsABCB7 gene.
[0048] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0049] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, mutation sequence detection was performed using designed primers, and mutant lines with A and T base insertions were selected. The insertion of base A or T into the nucleotide sequence of the rice OsABCB7 gene caused corresponding changes in the codon sequence and composition after the insertion site, resulting in the premature appearance of the stop codon and premature termination of the encoded protein. The structure and function of the protein encoded by the mutant sequence were altered. Furthermore, the inventors of this disclosure also discovered that homozygous mutant plants with OsABCB7 gene function defect mutations obtained through transgenics, and rice grains from mutant plants with A or T base insertions in the OsABCB7 gene nucleotide sequence, had significantly lower cadmium content than wild-type rice. This can be used to analyze the biological function of the OsABCB7 gene in rice and has potential application value in agricultural development.
[0050] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 7 and / or SEQ ID NO: 8.
[0051] According to this disclosure, the nucleotide sequence shown in SEQ ID NO: 5 encodes the protein shown in SEQ ID NO: 7; the nucleotide sequence shown in SEQ ID NO: 6 encodes the protein shown in SEQ ID NO: 8.
[0052] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;
[0053] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0054] The fourth aspect of this disclosure is a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant is introduced with the mutant sequence of the target site I described in the first aspect, or the transformant is introduced with the vector described in the third aspect;
[0055] The nucleotide sequence of target site I is shown in SEQ ID NO: 9.
[0056] In this disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.
[0057] The fifth aspect of this disclosure is a method for reducing the cadmium content in rice, the method comprising: gene editing of the rice OsABCB7 gene to mutate the nucleotide sequence of the rice OsABCB7 gene and to change the protein encoded by the OsABCB7 gene.
[0058] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCB7 gene.
[0059] In this disclosure, gene editing of the rice OsABCB7 gene alters the protein encoded by the OsABCB7 gene, thereby reducing or eliminating the expression level of the OsABCB7 gene and decreasing the activity of the protein encoded by the rice OsABCB7 gene. This is beneficial for cultivating rice varieties with reduced cadmium absorption and effectively solves the problem of excessive cadmium content in rice.
[0060] In one specific embodiment of this disclosure, the gene editing method includes:
[0061] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCB7 gene;
[0062] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium. Mutations were randomly performed at the target site I in the rice plants. Then, the designed primers were used for detection to screen and obtain T0 generation positive plants with functional defect mutations.
[0063] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0064] The nucleotide sequence of target site I is shown in SEQ ID NO: 9;
[0065] The sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:4.
[0066] In the above embodiments, CRISPR-Cas9 technology was used to construct mutant plants, and two different types of mutant plants were screened for subsequent experiments. After planting the mutant plants in soil contaminated with the heavy metal cadmium, the Cd content of individual plant grains was measured. The results showed that the cadmium content in the mutant plant grains was significantly lower than that of the wild type. This indicates that OsABCB7 participates in regulating the absorption and translocation of Cd in rice. The mutant strain disclosed in this paper can significantly reduce the heavy metal cadmium content in rice grains, contributing to food security and human health.
[0067] In a preferred embodiment of this disclosure, in step S1, the mutation includes one of the following:
[0068] (a) Insert a base A between the 3rd and 4th bases of the target site I sequence of the rice OsABCB7 gene;
[0069] (b) Insert a T base between the 3rd and 4th bases of the target site I sequence of the rice OsABCB7 gene.
[0070] The sixth aspect of this disclosure provides the application of the rice OsABCB7 gene and / or the protein encoded by the rice OsABCB7 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0071] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCB7 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0072] In this disclosure, OsABCB7 is involved in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCB7 can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice grains. Breeding rice varieties with reduced cadmium absorption using mutants of the rice OsABCB7 gene has potential application value in agriculture.
[0073] The present disclosure is further described in detail below through examples.
[0074] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.
[0075] Example 1
[0076] 1. Construction of OsABCB7 mutant plants.
[0077] The coding region of the OsABCB7 gene has a nucleotide sequence of 3705 bp. Mutant plants of the OsABCB7 gene were created using the CRISPR-Cas9 genome knockout system: First, a CRISPR target site I (sequence as SEQ ID NO: 9) was designed based on the coding region sequence, and the pCRISPR-OsABCB7 plasmid with an OsABCB7-specific target was constructed. Then, mutant plants were constructed by infecting wild-type Nipponbare rice callus with Agrobacterium strains. Finally, homozygous mutant plants were screened using PCR, and specific primers were designed.
[0078] Forward primer F: CATGCGTGTGTGTTCTGTGC (SEQ ID NO: 3); Reverse primer R: AACCCCTAGCATAGAGTGCC (SEQ ID NO: 4).
[0079] After PCR amplification and sequencing of the designed target site, two independent homozygous mutant plants were selected. osabcb7-1 SEQ ID NO: 5 and osabcb7-2 (SEQ ID NO: 6) The following experiments were performed, and the target sites and mutation types of wild-type and mutants are as follows: Figure 1 As shown.
[0080] 2. Analysis of Cd content in OsABCB7 mutant plants.
[0081] Wild-type WT and osabcb7-1 and osabcb7-2 The mutants were transplanted to an experimental field in Beishan Town, Changsha County, Hunan Province. The soil there was slightly acidic (pH 5.4-6.2) with a Cd content of 1.8 mg / kg. Field planting was conducted using a randomized block design with 3-5 replicates. Except for intermittent irrigation, all other field management practices were standard. Rice grains were harvested from individual plants, and the Cd content was determined by ICP-MS after treatment. Results are as follows... Figure 2 As shown, "*" indicates a comparison with the wild type. p <0.05. osabcb7-1 and osabcb7-2 The Cd content in the seeds of the mutant plants was significantly lower than that of the wild type, indicating that... osabcb7-1 and osabcb7- 2 The mutation reduced the accumulation of Cd in rice grains.
[0082] The above examples demonstrate that OsABCB7 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium; OsABCB7 Improvements can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice.
[0083] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.
[0084] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.
[0085] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.
Claims
1. A method of reducing cadmium content in rice grain, characterized by, The method comprises: causing a mutation in a nucleotide sequence of a rice OsABCB7 gene and changing a protein encoded by the OsABCB7 gene by performing gene editing on the rice OsABCB7 gene; The mutation comprises substitution, deletion and / or addition of one or more nucleotides on the rice OsABCB7 gene; The method for gene editing comprises: S1, designing a CRISPR / Cas9 editing vector according to a target site I of a rice OsABCB7 gene; S2, infecting the CRISPR / Cas9 editing vector into a rice plant through agrobacterium, randomly mutating at the target site I in the rice plant, and then detecting and screening a T0 generation positive plant with a functional defect type mutation according to a designed primer; S3, selfing the T0 generation positive plant, screening a T1 generation homozygous mutant plant, and obtaining a rice plant with reduced cadmium content; The nucleotide sequence of the target site I is shown as SEQ ID NO: 9; The sequence of the primer is shown as SEQ ID NO: 3 and SEQ ID NO: 4; The nucleotide sequence of the rice OsABCB7 gene is shown as SEQ ID NO:
1.
2. The method of claim 1, wherein, The mutation is one of the following: (a) inserting a base A between the 3rd and 4th bases of the sequence of the target site I of the rice OsABCB7 gene; (b) inserting a base T between the 3rd and 4th bases of the sequence of the target site I of the rice OsABCB7 gene.
3. Use of a knockout of an OsABCB7 gene or a protein encoded thereby in breeding a rice variety with reduced cadmium content in the rice grain, wherein, The nucleotide sequence of the rice OsABCB7 gene is shown as SEQ ID NO: 1.