Mutant sequence of rice osabcg47 gene and method and application thereof in regulating cadmium accumulation in rice
By editing the OsABCG47 gene in rice and mutating its nucleotide sequence to change protein function, the problem of excessive cadmium accumulation in rice was solved, the cadmium content in rice was reduced, and food security was improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
- Filing Date
- 2024-08-02
- Publication Date
- 2026-04-14
AI Technical Summary
The problem of excessive cadmium accumulation in rice reduces the safety of rice and affects human health.
By editing the rice OsABCG47 gene, a CRISPR/Cas9 editing vector was designed to mutate the nucleotide sequence of the rice OsABCG47 gene, resulting in loss or alteration of protein function and reducing cadmium accumulation.
Significantly reduce the cadmium content in rice, cultivate rice varieties with reduced cadmium absorption, and safeguard food security and human health.
Smart Images

Figure CN118956893B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to a mutant sequence of the rice OsABCG47 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its application. Background Technology
[0002] Cadmium is a non-essential element that is harmful to organisms. With the rapid development of industrialization, the area of soil cadmium pollution has been increasing year by year. Low concentrations of cadmium stress will reduce plant resistance, while high concentrations of cadmium stress will inhibit plant growth and development.
[0003] Rice is one of the world's major food crops. Due to its strong ability to absorb cadmium, it stores cadmium in its grains through its root absorption-transport system. This cadmium then transfers to the human body through the food chain, posing a health hazard. Excessive cadmium accumulation in the human body can lead to kidney dysfunction, osteoporosis, cancer, and cardiovascular disease.
[0004] Cadmium enters plants via essential element transporters. Studies have shown that multiple family proteins are involved in cadmium absorption, transport, distribution, and storage. For example, OsNramp1 and OsNramp5 are the main cadmium transporters in rice, while OsZIP5 and OsZIP9 absorb zinc along with cadmium. OsHMA3 can isolate absorbed cadmium in root vacuoles, preventing its transport to the aboveground parts and mitigating the toxicity of cadmium accumulation in rice. Since cadmium enters rice plants via this "hitchhiking" mechanism, exploring more genetic resources related to cadmium absorption, transport, distribution, and storage is an effective way to reduce cadmium accumulation in rice grains and improve food security. Summary of the Invention
[0005] In order to address the problem of excessive cadmium in rice in existing technologies, the purpose of this disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption.
[0006] To achieve the above objectives, the first aspect of this disclosure provides a mutant sequence of the rice OsABCG47 gene, said mutant sequence being obtained by mutation of the nucleotide sequence of the rice OsABCG47 gene; said mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCG47 gene.
[0007] The nucleotide sequence of the rice OsABCG47 gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the rice OsABCG47 gene is shown in SEQ ID NO: 2.
[0008] Optionally, the mutant sequence is selected from at least one of the following sequences:
[0009] (1) The nucleotide sequence shown in SEQ ID NO: 6 obtained by deleting the CA fragment from position 17 to position 18 of the target site I sequence of the rice OsABCG47 gene.
[0010] (2) The nucleotide sequence shown in SEQ ID NO: 7 was obtained by inserting a base C between the 16th and 17th bases of the target site I of the rice OsABCG47 gene.
[0011] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0012] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 8 and / or SEQ ID NO: 9.
[0013] A third aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with a target site I and produces a mutant sequence as described in the first aspect;
[0014] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0015] The fourth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;
[0016] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0017] The fifth aspect of this disclosure provides a method for reducing cadmium content in rice, the method comprising: gene editing of the rice OsABCG47 gene to mutate the nucleotide sequence of the rice OsABCG47 gene and alter the protein encoded by the OsABCG47 gene.
[0018] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCG47 gene.
[0019] Optionally, the gene editing method includes:
[0020] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG47 gene;
[0021] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.
[0022] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0023] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;
[0024] The sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0025] Optionally, in step S2, the mutation includes one of the following:
[0026] (a) Deletion of the CA segment from position 17 to position 18 of the target site I of the rice OsABCG47 gene;
[0027] (b) Insert a base C between the 16th and 17th bases of the target site I sequence of the rice OsABCG47 gene.
[0028] The sixth aspect of this disclosure provides the application of the rice OsABCG47 gene and / or the protein encoded by the rice OsABCG47 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0029] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCG47 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0030] Through the aforementioned technical solution, this disclosure achieves the loss of function of the OsABCG47 gene by mutating its nucleotide sequence, thereby reducing cadmium accumulation in rice. This provides genetic resources and technical support for cultivating rice varieties with reduced cadmium absorption, and offers new methods and ideas for breeding low-cadmium varieties and producing safe food. This disclosure can effectively address the problem of excessive cadmium content in rice, which is of great significance for solving food security issues. It also provides technical support for further in-depth research into the molecular mechanisms of cadmium absorption, translocation, and accumulation in rice.
[0031] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description
[0032] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:
[0033] Figure 1 This refers to the OsABCG47 gene structure and mutant type in the examples.
[0034] Figure 2 Gene-edited rice osabcg47-1 and osabcg47-2 Cadmium content test results for mutants and wild-type (WT) cadmium. Detailed Implementation
[0035] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.
[0036] The first aspect of this disclosure is a mutant sequence of the rice OsABCG47 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCG47 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCG47 gene.
[0037] The nucleotide sequence of the rice OsABCG47 gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the rice OsABCG47 gene is shown in SEQ ID NO: 2.
[0038] In this disclosure, the inventors have made a surprising discovery that the OsABCG47 gene (accession number: LOC_Os09g16380) can regulate the accumulation of cadmium in rice. This disclosure discloses that by mutating the nucleotide sequence of the rice OsABCG47 gene to cause the gene to lose its function, the accumulation of cadmium in rice can be effectively reduced, and rice varieties with reduced cadmium content can be cultivated.
[0039] In one specific embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:
[0040] (1) The nucleotide sequence shown in SEQ ID NO: 6 obtained by deleting the CA fragment from position 17 to position 18 of the target site I sequence of the rice OsABCG47 gene.
[0041] (2) The nucleotide sequence shown in SEQ ID NO: 7 was obtained by inserting a base C between the 16th and 17th bases of the target site I of the rice OsABCG47 gene.
[0042] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0043] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, mutation sequence detection was performed using designed primers, and mutant lines with CA deletion and C base insertion were selected. The deletion of CA or insertion of C in the rice OsABCG47 gene leads to corresponding changes in codon sequence and composition, premature appearance of the stop codon, and premature termination of the encoded protein. The structure and function of the protein encoded by the mutant sequence are altered. Furthermore, the inventors of this disclosure also discovered that homozygous mutant plants with functional defective mutations in the OsABCG47 gene obtained through transgenics showed significantly lower cadmium content in rice grains compared to the wild type. This can be used to study the biological function of the OsABCG47 gene in regulating cadmium accumulation in rice, and has potential application value in low-cadmium breeding development.
[0044] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 8 and / or SEQ ID NO: 9.
[0045] According to this disclosure, the nucleotide sequence shown in SEQ ID NO: 6 encodes the protein shown in SEQ ID NO: 8; the nucleotide sequence shown in SEQ ID NO: 7 encodes the protein shown in SEQ ID NO: 9.
[0046] A third aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with a target site I and produces a mutant sequence as described in the first aspect;
[0047] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0048] The fourth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;
[0049] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0050] In this disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.
[0051] The fifth aspect of this disclosure provides a method for reducing cadmium content in rice, the method comprising: gene editing of the rice OsABCG47 gene to mutate the nucleotide sequence of the rice OsABCG47 gene and alter the protein encoded by the OsABCG47 gene.
[0052] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCG47 gene.
[0053] In this disclosure, gene editing of the rice OsABCG47 gene alters the protein encoded by the OsABCG47 gene, thereby reducing or eliminating the expression level of the OsABCG47 gene and decreasing the activity of the protein encoded by the rice OsABCG47 gene. This is beneficial for cultivating rice varieties with reduced cadmium absorption and effectively solves the problem of excessive cadmium content in rice.
[0054] In one specific embodiment of this disclosure, the gene editing method includes:
[0055] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG47 gene;
[0056] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.
[0057] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0058] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;
[0059] The sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0060] In the above embodiments, CRISPR-Cas9 technology was used to construct mutant plants, and two different types of mutant plants were screened for subsequent experiments. After planting the mutant plants in soil contaminated with the heavy metal cadmium, the Cd content of individual plant grains was measured. The results showed that the cadmium content in the mutant plant grains was significantly lower than that in the wild type. This indicates that OsABCG47 participates in regulating the absorption and translocation of Cd in rice. The mutant strain disclosed in this paper can significantly reduce the heavy metal cadmium content in rice grains, contributing to food security and human health.
[0061] In a preferred embodiment of this disclosure, in step S2, the mutation includes one of the following:
[0062] (a) Deletion of the CA segment from position 17 to position 18 of the target site I of the rice OsABCG47 gene;
[0063] (b) Insert a base C between the 16th and 17th bases of the target site I sequence of the rice OsABCG47 gene.
[0064] The sixth aspect of this disclosure provides the application of the rice OsABCG47 gene and / or the protein encoded by the rice OsABCG47 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0065] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCG47 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0066] In this disclosure, OsABCG47 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCG47 can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice grains. Breeding rice varieties with reduced cadmium absorption using mutants of the rice OsABCG47 gene has potential application value in agriculture.
[0067] The present disclosure is further described in detail below through examples.
[0068] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.
[0069] Example 1
[0070] This embodiment illustrates the preparation of the OsABCG47 knockout mutant of the rice ABC transporter protein encoding gene. The specific implementation process is as follows:
[0071] Using CRISPR-Cas9 gene editing technology, the nucleotide sequence of target site I was selected as shown in SEQ ID NO: 3, and the gene encoding the ABC transporter OsABCG47 was knocked out.
[0072] Using wild-type Nipponbare seeds as material, transgenic T0 generation plants were obtained by Agrobacterium infection transformation.
[0073] Transplant T0 generation plants in the field and use identification primers:
[0074] mG47F: TTCATATGTCTCGGGCGCAG (SEQ ID NO: 4); mG47R: CCGAGGTGGTCACAAATCAC (SEQ ID NO: 5). T0 generation DNA was amplified, and sequencing was used to identify the mutation type in the OsABCG47 coding region. Homozygous mutants were selected for harvesting T1 generation seeds.
[0075] In this embodiment, two OsABCG47 knockout mutants of the rice ABC transporter gene were obtained. osabcg47-1 and osabcg47-2 .like Figure 1 As shown, the black solid line indicates the target sequence, and the red solid line PAM indicates the adjacent motif of the candidate recognition site; osabcg47-1 It is the deletion of the segment "CA" from the 8th exon (i.e., bases 959-960 in the coding region, or positions 17 to 18 in the sequence of target site I). osabcg46-2 The "C" base is inserted at the 8th exon (i.e., after the 958th base in the coding region, or between the 16th and 17th positions of the sequence at target site I). osabcg47-1 and osabcg47-2 All mutations were frameshift mutations, which caused the protein encoded by OsABCG4 to terminate prematurely, resulting in a nonfunctional protein.
[0076] Example 2
[0077] OsABCG47 knockout mutant prepared in Example 1 osabcg47-1 and osabcg47-2 The specific implementation process of the planting experiment on cadmium-contaminated soil is as follows:
[0078] Seeds of wild-type Nipponbare and mutants osabcg47-1 and osabcg47-2 After germinating homozygous T1 generation seeds in the dark at 37°C for 3 days, seeds with uniform germination were sown in non-cadmium-contaminated paddy fields and covered with mud to promote seed germination.
[0079] Fourteen days later, the wild-type Nipponbare and the mutant will grow uniformly. osabcg47-1 and osabcg47-2 The seedlings were transplanted into paddy fields containing 1.8 ppm cadmium and pH 5.4. Eight seedlings were transplanted from each line, with a spacing of 15 cm between each seedling and a row spacing of 15 cm. The water and fertilizer management and pest and disease control throughout the rice growth period were the same as in ordinary paddy fields.
[0080] At maturity, individual plants are harvested as wild-type Nipponbare and mutants. osabcg47-1 and osabcg47-2The main ear of grains was dried in an oven at 65℃, the husks were removed and the grains were weighed. The grains were then digested with nitric acid and the cadmium content was determined by ICP-OES.
[0081] The results are as follows Figure 2 As shown, "*" indicates a comparison with the wild type. p <0.05; "**" indicates compared to the wild type, p <0.01. The results of this example show that after mutation of the OsABCG47 gene encoding the ABC transporter, the cadmium content of mature rice grains was significantly reduced by about 50% under cadmium-contaminated field conditions.
[0082] The above examples show that OsABCG47 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCG47 can optimize the cadmium accumulation characteristics of rice and reduce the amount of heavy metal cadmium accumulated in rice.
[0083] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.
[0084] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.
[0085] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.
Claims
1. A method for reducing the cadmium content in rice grains, characterized in that, The method includes: modifying the nucleotide sequence of the rice OsABCG47 gene by gene editing, thereby altering the protein encoded by the OsABCG47 gene. The mutations include the substitution, deletion and / or addition of one or more nucleotides in the rice OsABCG47 gene; The gene editing method includes: S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG47 gene; S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers. S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content. The nucleotide sequence of target site I is shown in SEQ ID NO: 3; The sequences of the primers are shown in SEQ ID NO: 4 and SEQ ID NO: 5; The nucleotide sequence of the rice OsABCG47 gene is shown in SEQ ID NO:
1.
2. The method according to claim 1, wherein, In step S2, the mutation includes one of the following: (a) Deletion of the CA segment from position 17 to position 18 of the target site I of the rice OsABCG47 gene; (b) Insert a base C between the 16th and 17th bases of the target site I sequence of the rice OsABCG47 gene.