Mutant sequence of rice osabcf1 gene and method and application thereof in regulating cadmium accumulation in rice
By mutating and editing the OsABCF1 gene in rice, the problem of excessive cadmium content in rice was solved, and rice varieties with reduced cadmium absorption were cultivated, resulting in a significant reduction in cadmium content in rice and ensuring food security and human health.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
- Filing Date
- 2024-08-02
- Publication Date
- 2026-04-28
AI Technical Summary
Excessive cadmium content in rice poses a threat to food security and human health, and current technologies lack effective genetic breeding methods to reduce cadmium accumulation.
By mutating the rice OsABCF1 gene, especially by inserting or deleting nucleotides, and designing CRISPR/Cas9 editing vectors, the expression of the OsABCF1 gene can be suppressed or its encoded protein function can be altered, thereby reducing cadmium absorption and accumulation.
Significantly reduce the cadmium content in rice, cultivate rice varieties with reduced cadmium absorption, and safeguard food security and human health.
Smart Images
Figure CN118879729B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to a mutant sequence of the rice OsABCF1 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its application. Background Technology
[0002] Cadmium (Cd) is a highly toxic heavy metal that poses a serious threat to the global soil environment. In cadmium-contaminated soil, plant growth is significantly inhibited, often manifesting as stunted growth, chlorosis of leaves, and browning of root tips. Because cadmium is easily absorbed by plants and accumulates in edible parts, it can easily enter the human body through the food chain, causing serious damage to organs such as the kidneys and bones. To prevent further contamination of the food chain by cadmium, we must adopt effective countermeasures. One feasible strategy is to actively seek and cultivate new crop varieties with low cadmium accumulation using genetic breeding technology. Simultaneously, we can also consider using certain plants with high accumulation capacity for bioremediation to reduce cadmium levels in the soil. However, to achieve these goals, we must first gain a deeper understanding of the mechanisms by which plants absorb, translocate, and accumulate cadmium.
[0003] Cadmium is not an essential element for plant growth, therefore plants have not evolved a dedicated cadmium transport system. Cadmium absorption and transport primarily rely on other transport proteins and ion channels. Among these, ABC transporters are a class of widely distributed and functionally diverse proteins found in various organelles such as the plasma membrane, vacuolar membrane, and chloroplasts. They can transport a variety of substrates, including hormones, metal ions, and metabolites. By regulating the transport and balance of these substrates, ABC transporters have a profound impact on physiological processes such as hormone transport, toxin isolation, and secondary metabolite secretion in plants. Therefore, studying the functions of ABC proteins related to cadmium transport is crucial for improving crops to reduce cadmium accumulation. For example, in Arabidopsis thaliana, transporters such as AtABCC1, AtABCC2, and AtABCC3 can isolate the PC-Cd complex into vacuoles, thereby reducing cadmium concentration in root cells and decreasing cadmium transport to plant branches. Furthermore, under cadmium stress, the expression level of AtABCC6 is significantly upregulated, which may be a natural response of plants to cadmium stress. Meanwhile, overexpression of AtPDR8 and AtATM3 was also shown to reduce cadmium accumulation in plants and enhance their resistance to cadmium. These findings clearly demonstrate that ABC transporters play a crucial role in Arabidopsis thaliana's response to cadmium stress.
[0004] Rice is one of the main sources of cadmium ingestion for humans, and the problem of excessive cadmium levels in rice has attracted widespread attention. Although the rice genome contains as many as 128 ABC transporters, research on their specific functions is still relatively limited. Therefore, we need to further explore these molecular mechanisms and strive to discover the rice ABC transporter family genes associated with cadmium transport. This will help us to more comprehensively understand the plant response mechanisms to cadmium and provide important scientific evidence for developing low-cadmium rice varieties and formulating phytoremediation strategies for cadmium-contaminated soils. Summary of the Invention
[0005] In order to address the problem of excessive cadmium in rice in existing technologies, the purpose of this disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption.
[0006] To achieve the above objectives, the first aspect of this disclosure is a mutant sequence of the rice OsABCF1 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCF1 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCF1 gene.
[0007] The rice OsABCF1 gene has the nucleotide sequence described in (I) or (II):
[0008] (I) The nucleotide sequence shown in SEQ ID NO: 1;
[0009] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.
[0010] Optionally, the mutant sequence is selected from at least one of the following sequences:
[0011] (1) The nucleotide sequence shown in SEQ ID NO: 8 was obtained by inserting base A between the 14th and 15th bases of the target site I of the rice OsABCF1 gene.
[0012] (2) The nucleotide sequence shown in SEQ ID NO: 9 obtained by deleting the CAAAGATGCTATCAG fragment from position 1 to position 15 of the target site I of the rice OsABCF1 gene;
[0013] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0014] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.
[0015] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;
[0016] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0017] The fourth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;
[0018] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0019] The fifth aspect of this disclosure is a method for reducing cadmium content in rice, the method comprising: downregulating the expression level of the rice OsABCF1 gene or inactivating the OsABCF1 gene by mutating or inhibiting the OsABCF1 gene, and / or altering the protein encoded by the OsABCF1 gene.
[0020] Among them, the methods of mutating or inhibiting the rice OsABCF1 gene include gene editing, EMS mutagenesis, radiation mutagenesis, or space-borne methods.
[0021] Optionally, the gene editing includes:
[0022] The OsABCF1 gene can be knocked out using CRISPR / Cas9 or TALEN, or the promoter that initiates OsABCF1 gene expression can be edited using CRISPR / Cas9 or TALEN to suppress its expression.
[0023] Preferably, the gene editing method includes the following steps:
[0024] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCF1 gene;
[0025] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on the target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.
[0026] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0027] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;
[0028] The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCF1 gene;
[0029] The sequences of the primers are shown in SEQ ID NO: 6 and SEQ ID NO: 7.
[0030] Optionally, in step S1, the mutation includes one of the following:
[0031] (a) Insert base A between the 14th and 15th bases of the target site I sequence of the rice OsABCF1 gene;
[0032] (b) Deletion of the CAAAGATGCTATCAG fragment from position 1 to position 15 of the target site I of the rice OsABCF1 gene.
[0033] The sixth aspect of this disclosure provides the application of the rice OsABCF1 gene and / or the protein encoded by the rice OsABCF1 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0034] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCF1 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0035] Through the above-described technical solution, this disclosure achieves the loss of function of the OsABCF1 gene by mutating its nucleotide sequence, thereby reducing cadmium accumulation in rice. This provides genetic resources and technical support for cultivating rice varieties with reduced cadmium absorption, and offers new methods and ideas for breeding low-cadmium varieties and producing safe food. This disclosure can effectively address the problem of excessive cadmium content in rice, which is of great significance for solving food security issues. It also provides technical support for further in-depth research into the molecular mechanisms of cadmium absorption, translocation, and accumulation in rice.
[0036] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description
[0037] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:
[0038] Figure 1 This is the OsABCF1 gene structure and mutant type in the example.
[0039] Figure 2 Gene-edited rice OsABCF1-1 and OsABCF1-2 Cadmium content test results for mutants and wild-type (WT) cadmium. Detailed Implementation
[0040] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.
[0041] The first aspect of this disclosure is a mutant sequence of the rice OsABCF1 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCF1 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCF1 gene.
[0042] The rice OsABCF1 gene has the nucleotide sequence described in (I) or (II):
[0043] (I) The nucleotide sequence shown in SEQ ID NO: 1;
[0044] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.
[0045] In this disclosure, the inventors have surprisingly discovered that the OsABCF1 gene (accession number: LOC_Os02g58020) can regulate cadmium accumulation in rice. This disclosure describes a method to reduce cadmium accumulation in rice by mutating the nucleotide sequence of the rice OsABCF1 gene to eliminate its function, thereby cultivating rice varieties with reduced cadmium content. The amino acid sequence of the protein encoded by the nucleotide sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2.
[0046] According to this disclosure, sequences having more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site include sequences having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site, wherein the aforementioned homologous sequences can encode proteins with the same function as the nucleotide sequence shown in SEQ ID NO: 1.
[0047] In one specific embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:
[0048] (1) The nucleotide sequence shown in SEQ ID NO: 8 was obtained by inserting base A between the 14th and 15th bases of the target site I of the rice OsABCF1 gene.
[0049] (2) The nucleotide sequence shown in SEQ ID NO: 9 obtained by deleting the CAAAGATGCTATCAG fragment from position 1 to position 15 of the target site I of the rice OsABCF1 gene;
[0050] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0051] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, the mutant sequences were detected using designed primers, and mutant lines with A base insertion and CAAAGATGCTATCAG deletion were selected. The OsABCF1 gene was modified by inserting base A or deleting the CAAAGATGCTATCAG fragment, resulting in corresponding changes in the codon sequence and composition. The stop codon appeared prematurely, causing the encoded protein to terminate prematurely. The structure and function of the protein encoded by the mutant sequence were altered.
[0052] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 10 and / or SEQ ID NO: 11.
[0053] According to this disclosure, the nucleotide sequence shown in SEQ ID NO: 8 encodes the protein shown in SEQ ID NO: 10; the nucleotide sequence shown in SEQ ID NO: 9 encodes the protein shown in SEQ ID NO: 11.
[0054] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;
[0055] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0056] The fourth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;
[0057] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.
[0058] In this disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.
[0059] The fifth aspect of this disclosure is a method for reducing cadmium content in rice, the method comprising: downregulating the expression level of the rice OsABCF1 gene or inactivating the OsABCF1 gene by mutating or inhibiting the OsABCF1 gene, and / or altering the protein encoded by the OsABCF1 gene.
[0060] Among them, the methods of mutating or inhibiting the rice OsABCF1 gene include gene editing, EMS mutagenesis, radiation mutagenesis, or space-borne methods.
[0061] In this disclosure, by mutating the OsABCF1 gene to downregulate or inactivate the protein it encodes, or by inhibiting the expression of the OsABCF1 gene to downregulate the abundance of the protein it encodes, the activity of the protein encoded by the rice OsABCF1 gene is reduced, thereby improving the cadmium accumulation characteristics of rice or cultivating low-cadmium-accumulating rice varieties with reduced cadmium content, effectively solving the problem of excessive cadmium content in rice.
[0062] In one embodiment of this disclosure, the gene editing includes:
[0063] The OsABCF1 gene can be knocked out using CRISPR / Cas9 or TALEN, or the promoter that initiates OsABCF1 gene expression can be edited using CRISPR / Cas9 or TALEN to suppress its expression.
[0064] In one specific embodiment of this disclosure, the gene editing method includes:
[0065] S1 designed a CRISPR / Cas9 editing vector based on target site I of the rice OsABCF1 gene;
[0066] S2. The CRISP and R / Cas9 editing vectors were infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on the target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.
[0067] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.
[0068] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;
[0069] The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCF1 gene;
[0070] The sequences of the primers are shown in SEQ ID NO: 6 and SEQ ID NO: 7.
[0071] In the above embodiments, CRISPR-Cas9 technology was used to construct mutant plants, and two different types of mutant plants were screened for subsequent experiments. After planting the mutant plants in soil contaminated with the heavy metal cadmium, the Cd content of individual plant grains was measured. The results showed that the cadmium content in the grains of the mutant plants was significantly lower than that of the wild type. This indicates that OsABCF1 participates in regulating the absorption and translocation of Cd in rice. The mutant strain disclosed in this paper can significantly reduce the cadmium content in rice grains, contributing to food security and human health. It also provides genetic resources and technical support for breeding low-cadmium-accumulation rice.
[0072] In a preferred embodiment of this disclosure, in step S1, the mutation includes one of the following:
[0073] (a) Insert base A between the 14th and 15th bases of the target site I sequence of the rice OsABCF1 gene;
[0074] (b) Deletion of the CAAAGATGCTATCAG fragment from position 1 to position 15 of the target site I of the rice OsABCF1 gene.
[0075] The sixth aspect of this disclosure provides the application of the rice OsABCF1 gene and / or the protein encoded by the rice OsABCF1 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.
[0076] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCF1 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.
[0077] In this disclosure, OsABCF1 is involved in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCF1 can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice grains. Breeding rice varieties with reduced cadmium absorption using mutants of the rice OsABCF1 gene has potential application value in agriculture.
[0078] The present disclosure is further described in detail below through examples.
[0079] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.
[0080] Example 1
[0081] This example illustrates the acquisition and molecular identification of OsABCF1 gene knockout lines.
[0082] Editing the coding region (CDS) of the OsABCF1 gene using CRISPR / Cas9 to induce nonsense mutations and suppress OsABCF1 gene expression is described in the following steps:
[0083] S1. Based on the target site selection principle of the CRISPR / Cas9 vector system, a 20bp sequence was selected from the sixth exon of the OsABCF1 gene as the target sequence for generating sgRNA.
[0084] The target sequence is located on the sense strand of the OsABCF1 gene coding region, 903-922 bp downstream of the start codon ATG, and the sequence is CAAAGATGCTATCAGCAAGA (as shown in SEQ ID NO: 3).
[0085] Based on the target sequences above, the adapter primers were designed as follows:
[0086] F1P1U3-F: GGCATCTTGCTGATAGCATCTTTG (as shown in SEQ ID NO: 4);
[0087] F1P1U3-R: AAACCAAAGATGCTATCAGCAAGA (as shown in SEQ ID NO: 5).
[0088] The above adapter primers were synthesized and dissolved into 100 μmol / L stock solutions. 1 μL of each was taken. F1P1U3-F and F1P1U3-R were mixed to obtain F1P1U3 mixture. The F1P1U3 mixture was diluted to 1 μmol / L, placed on a PCR machine at 98℃ for 30 seconds, and then cooled to room temperature to complete the annealing and form adapters at the target sites.
[0089] References Ma XL ,Zhang QY ,Zhu QL ,Liu W ,Chen Y ,Qiu R ,Wang B ,YangZF ,Li HY ,Lin YR ,Xie YY ,Shen RX ,Chen SF ,Wang Z ,Chen YL ,Guo JX ,Chen LT ,Zhao XC ,Dong ZC ,Liu YG .A robust CRISPR / Cas9 system for convenient,high-efficiency multiplex genome editing in monocot and dicot plants .Mol Plant ,2015 ,8(8):1274–1284. Constructing the CRISPR / Cas9 recombinant vector pCRISPR / Cas9-OsABCF1 for the OsABCF1 gene.
[0090] S2. The pCRISPR / Cas9-OsABCF1 recombinant vector was introduced into competent Agrobacterium species EHA105, and the genetic transformation of rice was carried out by Baige Biotechnology Co., Ltd.
[0091] The procedure is briefly described as follows: Mature and plump seeds of the Japonica rice variety Nipponbare were selected, dehulled, sterilized with sodium hypochlorite, filtered dry, and inoculated onto an induction medium to induce callus formation. Nipponbare callus was infected with Agrobacterium EHA105 containing the pCRISPR / Cas9-OsABCF1 recombinant vector, then transferred to a co-culture medium and cultured in the dark at 24°C for 3 days. The callus was washed and transferred to a selection medium containing hygromycin for screening and culture for 30 days. The selected resistant callus was transferred to a pre-differentiation medium for 7-10 days, then to a differentiation medium under light. When the seedlings reached 2-4 cm in height, they were transferred to a rooting medium and grown for about 3 weeks, resulting in 15 T0 generation seedlings. After 3 days of hardening, the seedlings were transplanted into the soil. Seeds were collected and used to propagate the next generation, yielding T1 generation plants.
[0092] S3. Target site genotyping was performed on T1 generation plants to identify mutant plants, as briefly described below:
[0093] DNA was extracted from T1 generation plants using SDS-PAGE. Primers were designed to amplify DNA fragments containing the target sequence of OsABCF1. The amplification primers are as follows:
[0094] OsABCF1-CAS9-F:GCAACCAATGTAACTGCAACGA(as shown in SEQ ID NO:6)
[0095] OsABCF1-CAS9-R: CAAGAGGTTGTGGGCGATGA (as shown in SEQ ID NO: 7);
[0096] Using the extracted DNA as a template, and OsABCF1-CAS9-F and OsABCF1-CAS9-R as primers, PCR amplification was performed using high-fidelity LA Tap polymerase (TaKaRa). The following reaction system was established in a sterile PCR tube: 25 μL GCX Buffer solution, 8 μL dNTP Mixture, 0.5 μL LA Tap polymerase, 2 μL OsABCF1-F (10 nmol), 2 μL OsABCF1-R (10 nmol), 3.5 μL DNA, 9 μL ddH2O, for a total reaction volume of 50 μL. The reaction program was: 95℃ denaturation for 6 min; PCR amplification: 94℃ denaturation for 40 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 33 cycles, with a final extension at 72℃ for 5 min. After the reaction, the sample was sent to Qingke Sequencing Company for sequencing. The sequencing primer was OsABCF1-CAS9-F. Individual plants with a single peak at the target site in their sequencing results were screened and directly compared with wild-type sequences to analyze the target site genotype. Homozygous knockout lines with mutations at the target site leading to nonsense mutations were screened in T1 generation plants, and Hpt, Cas9, and other transgenic elements were detected using PCR. Further screening for knockout lines without transgenic elements was conducted. osabcf1-1 and osabcf1-2 Mutated sequences such as Figure 1 As shown.
[0097] Example 2
[0098] This example illustrates the elemental content of the OsABCF1 gene knockout strain.
[0099] (1) Planting of mutant materials:
[0100] Functional deficiency osabcf1-1 and osabcf1-2 The T1 generation of the mutant, along with the control Zhonghua 11, was planted in a cadmium-contaminated paddy field in Beishan, Changsha, for a field experiment. Simultaneously, the transgenic plants underwent another sequencing identification. The planting density in the field was 16.5 × 26 cm, and field management followed the routine field production management practices.
[0101] (2) Determination of cadmium content in rice:
[0102] After being harvested from the field and naturally dried, the rice was threshed, milled, and dried to constant weight in an oven at a temperature not lower than 80℃. 0.3000g of each sample was added to a sample tube, with two blanks and one standard rice sample added as controls for each batch. A mixed acid solution of 9mL nitric acid (re-distilled and purified): hydrogen peroxide (v / v 8:1) was added, and the mixture was placed in a microwave digester for digestion. The digestion reaction program was: room temperature to 190℃ for 15 min, 190℃ for 35 min, and 190℃ to room temperature for 15 min. After digestion, the sample tubes were placed in a constant-temperature acid removal apparatus for acid removal, with the reaction program being: 140℃ for 110 min. After acid removal, the sample tubes were rinsed repeatedly with small amounts of 1% nitric acid and transferred to 10mL volumetric tubes. The volume was then adjusted to 10mL, and the solution was filtered through a funnel made of folded quantitative filter paper into a 10mL test tube. The elements in the samples were determined by coupled plasma atomic emission spectrometry (Agilent ICP-OES 700), with each sample measured three times and the average value calculated.
[0103] The results are as follows Figure 2 As shown, "**" indicates the difference compared to the wild type. p <0.01; "*" indicates compared to the wild type, p <0.05. Two homozygous mutants with different mutation types. osabcf1-1 and osabcf1-2 The cadmium content of brown rice was significantly lower than that of wild-type rice, indicating that knocking out the OsABCF1 gene can reduce the cadmium content of rice.
[0104] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.
[0105] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.
[0106] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.
Claims
1. A method of reducing cadmium content in rice, characterized by, The method comprises: down-regulating expression of or inactivating an OsABCF1 gene of rice by mutation or inhibition; The gene editing comprises: The gene editing comprises:
2. The method of claim 1, wherein, The gene editing comprises: The gene editing comprises:
3. The method of claim 2, wherein, The method of gene editing comprises the following steps: S1, designing a CRISPR / Cas9 editing vector according to a target site I of the OsABCF1 gene of rice; S2, infecting the CRISPR / Cas9 editing vector into a rice plant through agrobacterium, mutating at the target site I in the rice plant body at random, and then detecting and screening a T0 generation positive plant with a functional defect type mutation according to a designed primer; S3, self-crossing the T0 generation positive plant, screening a T1 generation homozygous mutant plant, and obtaining a rice plant with reduced cadmium content; The nucleotide sequence of the target site I is shown as SEQ ID NO:
3. The mutation comprises substitution, deletion and / or addition of one or more nucleotides on the OsABCF1 gene of rice. The sequences of the primers are shown as SEQ ID NO: 6 and SEQ ID NO:
7.
4. The method of claim 3, wherein, In step S2, the mutation comprises one of the following: (a) inserting a base A between the 14th and 15th bases of the sequence of the target site I of the OsABCF1 gene of rice; (b) deleting a fragment CAAAGATGCTATCAG from the 1st to 15th of the sequence of the target site I of the OsABCF1 gene of rice.
5. The use of knock-out of OsABCF1 gene or its encoded protein in breeding rice varieties with reduced cadmium content in rice grains, wherein, The nucleotide sequence of the OsABCF1 gene is shown as SEQ ID NO: 1.