Mutated sequence of rice osabcg27 gene and method and application thereof in regulating cadmium accumulation in rice

By editing the rice OsABCG27 gene and inserting specific bases to alter protein function, the problem of excessive cadmium in rice was solved, resulting in the cultivation of rice varieties with reduced cadmium content and improved agricultural applications.

CN118879723BActive Publication Date: 2026-04-28INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
Filing Date
2024-08-02
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing technologies have shown that excessive cadmium content in rice poses a potential biotoxic threat to human health, and heavy metal treatment technologies are complex and expensive.

Method used

By editing the rice OsABCG27 gene and inserting specific bases (such as T or C) at target site I, the protein structure and function are altered, reducing cadmium accumulation.

Benefits of technology

Effectively reducing cadmium content in rice and cultivating rice varieties with reduced cadmium absorption provides new ideas for genetic resources and improving the cadmium accumulation characteristics of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879723B_ABST
    Figure CN118879723B_ABST
Patent Text Reader

Abstract

The present disclosure relates to a mutant sequence of rice OsABCG27 gene and its method and application in regulating cadmium accumulation in rice. Specifically, it relates to a mutant sequence of rice OsABCG27 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and its application. The present disclosure makes the function of the gene lost by gene mutation at the target site I of rice OsABCG27 gene, thereby reducing the accumulation of cadmium in rice; provides gene resources and technical support for breeding rice varieties with reduced cadmium absorption content, effectively improves the problem of excessive cadmium content in rice, and has important agricultural application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to a mutant sequence of the rice OsABCG27 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its application. Background Technology

[0002] Cadmium, a non-essential heavy metal that is highly toxic to all organisms, easily enters the food chain through other metal ion transport pathways, thus endangering human health. Rice is one of the main food crops for humans, with more than half of the population relying on it as their staple food. In recent years, with the rapid development of industrialization and modernization, environmental pollution from excessive heavy metals has become increasingly difficult to ignore. In cadmium-polluted areas where rice is the staple food, rice cadmium contamination is the main source of cadmium intake for humans, and long-term intake may have potential biotoxicity to human health.

[0003] Currently, heavy metal treatment technologies are complex and expensive. Therefore, before completely eradicating the problem of excessive cadmium content in paddy field soil, screening and cultivating low-cadmium-accumulating rice varieties and improving the molecular breeding approach for high-cadmium-accumulation characteristics of rice are the most economical and effective methods to avoid the harm of cadmium pollution to the human body.

[0004] The ABC (ATP-binding cassette transporter) family, also known as adenosine triphosphate (ATP)-binding cassette transporters, is one of the largest and oldest families discovered in plants. This family includes eight subfamilies, such as ABCA, ABCB, and ABCI, with the ABCG subfamily being the most numerous. These proteins are widely distributed in plant cell biomembrane systems, such as the plasma membrane, vacuolar membrane, and endoplasmic reticulum membrane, and can transport various substrates, including metals and proteins. They also play a crucial role in plant responses to external stresses, such as the detoxification of heavy metal ions like cadmium and ion transport. [2] Reports indicate that the OsABCG36 protein is cadmium-induced in rice root cells, transporting cadmium from root cells to the apoplast, thereby reducing cadmium content in the plant and enhancing its tolerance to the heavy metal cadmium. However, there are fewer reports on the regulation of cadmium transport in rice by other proteins in the ABCG subfamily. Therefore, identifying target genes that can reduce cadmium content in rice can provide genetic resources for low-cadmium rice breeding and has significant agricultural application value. Summary of the Invention

[0005] In order to address the problem of excessive cadmium in rice in existing technologies, the purpose of this disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption.

[0006] To achieve the above objectives, the first aspect of this disclosure provides a mutant sequence of the rice OsABCG27 gene, said mutant sequence being obtained by mutation of the nucleotide sequence of the rice OsABCG27 gene; said mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCG27 gene.

[0007] The nucleotide sequence of the rice OsABCG27 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCG27 gene is shown in SEQ ID NO: 3.

[0008] Optionally, the mutant sequence is selected from at least one of the following sequences:

[0009] (1) The nucleotide sequence shown in SEQ ID NO:2 was obtained by inserting a base T between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0010] (2) The nucleotide sequence shown in SEQ ID NO:5 was obtained by inserting a base C between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0011] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0012] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 4 and / or SEQ ID NO: 6.

[0013] A third aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with a target site I and produces a mutant sequence as described in the first aspect;

[0014] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0015] The fourth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;

[0016] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0017] The fifth aspect of this disclosure provides a method for reducing cadmium accumulation in rice plants, the method comprising:

[0018] Gene editing of the rice OsABCG27 gene mutated the nucleotide sequence of the OsABCG27 gene and altered the protein encoded by the OsABCG27 gene.

[0019] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCG27 gene.

[0020] Optionally, the gene editing method includes:

[0021] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG27 gene;

[0022] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium. Mutations were randomly performed at the target site I in the rice plants. Then, the designed primers were used for detection to screen and obtain T0 generation positive plants with functional defect mutations.

[0023] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0024] The nucleotide sequence of target site I is shown in SEQ ID NO: 7;

[0025] The sequences of the primers are shown in SEQ ID NO: 8 and SEQ ID NO: 9.

[0026] Optionally, in step S2, the mutation includes one of the following:

[0027] (a) Insert a T base between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0028] (b) Insert a base C between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene.

[0029] The sixth aspect of this disclosure provides the application of the rice OsABCG27 gene and / or the protein encoded by the rice OsABCG27 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.

[0030] The seventh aspect of this disclosure provides the application of the mutant sequence of the rice OsABCG27 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0031] Through the above technical solution, this disclosure achieves the loss of function of the rice OsABCG27 gene by mutating at target site I, thereby reducing cadmium accumulation in rice. This provides genetic resources and technical support for breeding rice varieties with reduced cadmium content, and offers new insights into the genetic improvement of cadmium accumulation traits in rice. This disclosure can effectively address the problem of excessive cadmium content in rice and has significant agricultural application value.

[0032] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0033] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0034] Figure 1 It uses CRISPR / Cas9 to obtain mutants osabcg27-1 and osabcg27-2 Genotypic analysis diagram of wild type.

[0035] Figure 2 Gene-edited rice osabcg27-1 and osabcg27-2 Cadmium content test results for mutants and wild-type (WT). Detailed Implementation

[0036] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0037] The first aspect of this disclosure provides a mutant sequence of the rice OsABCG27 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCG27 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCG27 gene.

[0038] In this disclosure, the NCBI genome database was used to perform sequence alignment analysis to find the homologous gene of the Arabidopsis ABCG gene in rice. The homologous gene was found in the rice genome and named OsABCG27. The nucleotide sequence of the rice OsABCG27 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCG27 gene is shown in SEQ ID NO: 3.

[0039] In this disclosure, the inventors have made a surprising discovery that the OsABCG27 gene (accession number: LOC_Os11g07600) can regulate the accumulation of cadmium in rice. This disclosure reduces the accumulation of cadmium in rice by causing gene mutation at target site I of the rice OsABCG27 gene to lose the function of the gene.

[0040] In one specific embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:

[0041] (1) The nucleotide sequence shown in SEQ ID NO:2 was obtained by inserting a base T between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0042] (2) The nucleotide sequence shown in SEQ ID NO:5 was obtained by inserting a base C between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0043] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0044] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, mutation sequence detection was performed using designed primers, selecting mutant lines with T and C base insertions. The insertion of either T or C bases into the sequence at target site I caused corresponding changes in the codon sequence and composition after the insertion site, resulting in the premature appearance of the stop codon, producing a shorter peptide chain, and ultimately altering the protein's structure and function. Furthermore, the inventors of this disclosure also discovered that homozygous mutant plants with OsABCG27 gene function defect mutations obtained through transgenic methods, exhibiting significantly lower cadmium content in rice grains compared to wild-type plants, can be used to analyze the biological function of the OsABCG27 gene in rice, and has potential application value in agricultural development.

[0045] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 4 and / or SEQ ID NO: 6.

[0046] According to this disclosure, the nucleotide sequence shown in SEQ ID NO: 2 encodes the protein shown in SEQ ID NO: 4; the nucleotide sequence shown in SEQ ID NO: 5 encodes the protein shown in SEQ ID NO: 6.

[0047] A third aspect of this disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with a target site I and produces a mutant sequence as described in the first aspect;

[0048] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0049] The fourth aspect of this disclosure provides a transformant, the host of which is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;

[0050] The nucleotide sequence of target site I is shown in SEQ ID NO: 7.

[0051] In this disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.

[0052] The fifth aspect of this disclosure provides a method for reducing cadmium accumulation in rice plants, the method comprising:

[0053] Gene editing of the rice OsABCG27 gene mutated the nucleotide sequence of the OsABCG27 gene and altered the protein encoded by the OsABCG27 gene.

[0054] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCG27 gene.

[0055] In this disclosure, gene editing of the rice OsABCG27 gene alters the protein encoded by the OsABCG27 gene, thereby reducing or eliminating the expression level of the OsABCG27 gene and decreasing the activity of the protein encoded by the rice OsABCG27 gene. This is beneficial for cultivating rice varieties with reduced cadmium content and effectively solves the problem of excessive cadmium content in rice.

[0056] In one specific embodiment of this disclosure, the gene editing method includes:

[0057] S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG27 gene;

[0058] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.

[0059] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0060] The nucleotide sequence of target site I is shown in SEQ ID NO: 7;

[0061] The sequences of the primers are shown in SEQ ID NO: 8 and SEQ ID NO: 9.

[0062] In this disclosure, the inventors used CRISPR / CAS9 technology to edit the OsABCG27 gene, reducing the expression level and activity of the protein encoded by the rice OsABCG27 gene, thereby obtaining rice mutants with reduced cadmium content. The inventors found that homozygous lines with functional defect mutations obtained by editing the OsABCG27 gene exhibited a phenotype that reduced cadmium content in rice, indicating that re-editing the OsABCG27 gene has certain application value in improving the cadmium accumulation characteristics of rice.

[0063] In a preferred embodiment of this disclosure, in step S1, the mutation includes one of the following:

[0064] (a) Insert a T base between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene;

[0065] (b) Insert a base C between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene.

[0066] The sixth aspect of this disclosure provides the application of the rice OsABCG27 gene and / or the protein encoded by the rice OsABCG27 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.

[0067] The seventh aspect of this disclosure provides the application of the mutant sequence of the rice OsABCG27 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0068] In this disclosure, by mutating the rice OsABCG27 gene and altering the structure and function of the protein encoded by the OsABCG27 gene, the cadmium content in the rice grains of the resulting mutant plants was significantly reduced. This demonstrates that the mutation of the rice OsABCG27 gene can effectively reduce the cadmium content in rice grains. Developing rice varieties with reduced cadmium uptake using mutants of the rice OsABCG27 gene has potential application value in agriculture.

[0069] The present disclosure is further described in detail below through examples.

[0070] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.

[0071] Example 1

[0072] This embodiment is used to illustrate rice. osabcc27-1 and osabcc27-2 Obtaining mutants.

[0073] To study the function of the rice OsABCG27 gene, the nucleotide sequence of the rice OsABCG27 gene was edited at a specific site using CRISPR / Cas9 technology. The nucleotide sequence of the target site I is shown in SEQ ID NO.1. The sequence of target site I is: GTCGAACATGCGGTAGACGC (SEQ ID NO: 7).

[0074] Specific methods include:

[0075] 1. Constructing CRISPR / Cas9 recombination vectors:

[0076] (1) Sequence alignment analysis was performed using the NCBI database to find the homologous gene of the Arabidopsis ABCG gene in rice. The homologous gene was found in the rice genome and named OsABCG27. Its nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence of the rice transport protein OsABCG27 encoded by it is shown in SEQ ID NO: 3.

[0077] (2) The target site I of the OsABCG27 gene mutation, identified in the rice genome, is GTCGAACATGCGGTAGACGC. A CRISPR / Cas9 editing vector is designed based on target site I. This vector is then introduced into rice plants via Agrobacterium infection, where mutations are performed at target site I within the rice plant. Figure 1 As shown, inserting either the base T or C between positions 17 and 18 of the sequence at target site I yields two types of mutation-editing vectors.

[0078] 2. Obtaining pure genetically modified rice:

[0079] (1) Using the japonica rice variety Nipponbare as the recipient material, the T0 generation transgenic rice plants were obtained by transforming rice callus tissue using Agrobacterium-mediated transformation.

[0080] PCR amplification was performed using two pairs of primers: AAGGTCGAGCATGAAGTCGG (SEQ ID NO: 8) and GCGGAGACGCTCCTCTTCTG (SEQ ID NO: 9) to amplify the fragment containing the target site. After gel extraction and sequencing, plants with mutations at the target site were detected.

[0081] (2) The results showed that the T0 generation transgenic plants contained OsABCG27, and the OsABCG27 gene target site I contained a T base insertion target site I ( osabcc27-1 SEQ ID NO: 2;) or C base insertion target site I ( osabcc27-2 (SEQ ID NO: 5), causing the stop codon to appear prematurely and terminate translation, resulting in a frameshift of amino acids and changes in the structure and function of the protein.

[0082] (3) Harvest osabcc27-1 and osabcc27-2 Seeds of homozygous mutants with functional defects were used for next-generation propagation. Mixed DNA samples were taken from T1 generation homozygous mutant seedlings for sequencing identification. The results showed that all T1 generation plants were homozygous mutant plants. The harvested seeds were T1 generation gene-edited rice. Cadmium content in the grains of the T1 generation homozygous mutant plants was determined, and the results are as follows... Figure 2 As shown, "*" indicates a comparison with the wild type. p <0.05. (By...) Figure 2 It can be seen that, osabcc27-1 and osabcc27-2 The cadmium content in the grains of the functional defect homozygous mutant rice was significantly higher or lower than that in wild-type rice.

[0083] The results above demonstrate that gene editing can reduce the cadmium content in rice grains by mutating the OsABCG27 gene. This provides insights for breeding rice varieties with low cadmium accumulation.

[0084] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0085] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0086] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A method for reducing cadmium accumulation in rice grains, characterized in that, The method includes: Gene editing of the rice OsABCG27 gene mutated the nucleotide sequence of the OsABCG27 gene and altered the protein encoded by the OsABCG27 gene. The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCG27 gene; The gene editing method includes: S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCG27 gene; S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium. Mutations were randomly performed at the target site I in the rice plants. Then, the designed primers were used for detection to screen and obtain T0 generation positive plants with functional defect mutations. S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content in rice grains. The nucleotide sequence of target site I is shown in SEQ ID NO: 7; The sequences of the primers are shown in SEQ ID NO: 8 and SEQ ID NO: 9; The nucleotide sequence of the rice OsABCG27 gene is shown in SEQ ID NO:

1.

2. The method according to claim 1, wherein, In step S2, the mutation is one of the following: (a) Insert a T base between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene; (b) Insert a base C between the 17th and 18th bases of the target site I sequence of the rice OsABCG27 gene.

3. Application of knocking out the rice OsABCG27 gene or its encoded protein in breeding rice varieties with reduced cadmium content in rice grains; among which, The nucleotide sequence of the rice OsABCG27 gene is shown in SEQ ID NO: 1.