A Cmozf mutant for increasing the carotenoid content in Cordyceps militaris mycelium and its construction method and application

Abstract

The present invention discloses a Cmozf mutant for increasing the carotenoid content in Cordyceps militaris hyphae and a construction method and application thereof, and belongs to the field of biotechnology. The present invention obtains a Cmozf mutant by knocking out the Cmozf gene in a wild-type Cordyceps militaris. It is found through experiments that the carotenoid content in the hyphae of the mutant is significantly increased by about 1 times compared with the wild-type Cordyceps militaris strain. The present invention provides a high-yield Cordyceps militaris mutant strain by a genetic modification method, and the carotenoid content in the hyphae of the Cordyceps militaris mutant strain is significantly increased, which provides a new method and direction for efficient and high-yield carotenoids, and is suitable for large-scale industrial production.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a Cmozf mutant for increasing the carotenoid content in Cordyceps militaris mycelium, and a construction method and application thereof. Background Art

[0002] Carotenoids are a class of natural pigments widely found in nature. They have antioxidant, anti-tumor, and cardiovascular disease prevention effects and are used in food, medicine, nutrition and health care industries. Compared with other fat-soluble carotenoids, water-soluble carotenoids from Cordyceps militaris have a wider range of applications and use value. Studies have reported that the genes involved in the biosynthesis of carotenoids were found by comparing the transcripts of Cordyceps militaris with the carotenoid biosynthesis pathway in the KEGG database. Li Dong et al. found that carotenoid dioxygenase (CCD) is a key enzyme in the carotenoid biosynthesis pathway. After the heme protein gene Cmfhp was knocked out, the carotenoids and spore production of Cordyceps militaris decreased. The synthesis of carotenoids is affected by external factors such as light, temperature and inducers. The blue light receptor gene Cmwc-1 knockout strain cannot form primordia and fruiting bodies, does not change color after light, and the production of conidia, carotenoids and cordycepin is lower than that of the wild type. However, the regulatory mechanism of carotenoid biosynthesis in Cordyceps militaris is not clear, and there are no reports of obtaining high-yield carotenoid strains through genetic engineering methods. Summary of the invention

[0003] The purpose of the present invention is to provide a Cmozf mutant for increasing the carotenoid content in Cordyceps militaris mycelium, and a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art. The Cmozf mutant is obtained by knocking out the Cmozf gene in the wild-type Cordyceps militaris. Compared with the wild-type Cordyceps militaris strain, the carotenoid content in the mycelium of the mutant is significantly increased.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The invention provides a Cmozf mutant for improving the carotenoid content in Cordyceps militaris mycelium. The Cmozf mutant is a strain obtained by taking a wild-type Cordyceps militaris strain as a starting strain and knocking out a Cmozf gene.

[0006] The present invention also provides a method for constructing the Cmozf mutant, comprising the following steps:

[0007] constructing a knockout vector of the Cmozf gene, and transferring the knockout vector into Agrobacterium to construct a recombinant Agrobacterium;

[0008] The recombinant Agrobacterium is transformed into a wild-type Cordyceps militaris strain, and positive transformants are screened to obtain a Cmozf mutant with increased carotenoid content in Cordyceps militaris hyphae.

[0009] Preferably, the method for constructing the knockout vector comprises the following steps:

[0010] The gene fragments flanking the 5' and 3' ends of the Cmozf gene were cloned to obtain the left and right arms;

[0011] The left arm and the right arm are cloned into the upstream and downstream sides of the gene bar of the pK2-bar backbone vector respectively as homology arms to obtain the knockout vector.

[0012] Preferably, the nucleotide sequence of the left arm is as shown in SEQ ID NO:1, and the nucleotide sequence of the right arm is as shown in SEQ ID NO:2.

[0013] Preferably, the wild-type Cordyceps militaris conidia are used as the receptor material, glufosinate-ammonium is used as the selection marker, the recombinant Agrobacterium is transferred into the wild-type Cordyceps militaris strain for homologous recombination replacement, and positive transformants are obtained by resistance screening.

[0014] Preferably, the volume ratio of the wild-type Cordyceps militaris conidia suspension to the recombinant Agrobacterium suspension is 1:1, and the concentration of the wild-type Cordyceps militaris conidia suspension is 5×10 4 / mL, the OD of the bacterial suspension of the recombinant Agrobacterium 600 The value is 0.3-0.5.

[0015] Preferably, the wild-type Cordyceps militaris strain includes the Cordyceps militaris CM01 strain.

[0016] Preferably, the Cmozf mutant is used in any of the following:

[0017] (1) Application in the preparation of carotenoids;

[0018] (2) Application in increasing the carotenoid content in Cordyceps militaris mycelium.

[0019] The present invention also provides a method for obtaining carotenoids from Cordyceps militaris hyphae, comprising the steps of culturing the Cmozf mutant and extracting carotenoids from the hyphae of the Cmozf mutant.

[0020] Preferably, the culture conditions are: culture on PDA medium for 15 days.

[0021] The present invention discloses the following technical effects:

[0022] The present invention takes Cordyceps militaris CM01 strain as the research object, selects two sections of about 1500bp sequences (referred to as left arm and right arm respectively) on the 5' and 3' flanks of Cmozf gene for cloning. The left arm and right arm fragments are respectively cloned to the upstream and downstream sides of the pK2-bar backbone vector gene bar as homology arms, and a knockout vector pK2-bar-Cmozf with glufosinate (bar) resistance as a screening marker is constructed. Cordyceps militaris conidia is used as a receptor material, glufosinate (bar) is used as a screening marker, and Cordyceps militaris is transformed by Agrobacterium-mediated homologous recombination replacement, and resistance culture medium is used for screening and PCR verification to obtain ΔCmozf mutants. It is found through experimental verification that the mutant strain can produce a large amount of carotenoids on PDA culture medium. The present invention provides a high-yield Cordyceps militaris mutant strain by a genetic modification method, and the carotenoid content in the mycelium of the Cordyceps militaris mutant strain is significantly improved, which provides a new method and direction for efficient and high-yield carotenoids, and is suitable for large-scale industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 The PCR amplification results of the left and right arm genes of Cmozf; lanes 1 and 2 are the right arm of the gene, and lanes 3 and 4 are the left arm of the gene;

[0025] Figure 2 The vector pK2-bar-Cmozf is verified by restriction digestion; Lane 1 is verified by EcoRI digestion; Lane 2 is verified by XbaI digestion;

[0026] Figure 3 PCR verification of transformed Agrobacterium; lane 1 is the bar gene, and lanes 2 and 3 are the left and right arm genes, respectively;

[0027] Figure 4 is the PCR identification result of ΔCmozf mutant; A is the amplification result using Cmozf-left-arm-F / PtrpC-anti-30 as primers; B is the amplification result using QCmozf-F / R as primers; Note: 1, 2, 3, 4 represent different transformants, WT is the wild-type strain, H2O is the negative control, and Maker is the standard DNA molecule;

[0028] Figure 5The results of the carotenoid content detection in the hyphae of the ΔCmozf mutant; A: a photograph of the carotenoid content in the strain after 15 days of growth on PDA solid medium; B: the detection results of the carotenoid content; Note: ** represents p<0.01. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] The main experimental supplies involved in the following examples:

[0035] (1) Experimental Materials

[0036] Escherichia coli competent cells DH5α were purchased from Beijing Qingke Biotechnology Co., Ltd. The vector pK2-bar (preparation method refers to the application of aspartic protease gene in improving Beauveria bassiana varieties in CN113403209A), Agrobacterium AGL-1 and Cordyceps militaris CM01 strains have been made public and are preserved by the Microbiology Experiment Center of Chongqing Second Normal University. DNA gel recovery kit, plasmid extraction kit, ClonExpress One Step Cloning Kit, Phanta Max Super-FidelityDNA Polymerase were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; restriction endonucleases were purchased from Thermo Fisher Scientific; 1.1×T3 Super PCR Mix was purchased from Beijing Qingke Biotechnology Co., Ltd.; 5000DNAMarker was purchased from Beijing Bomade Gene Technology Co., Ltd.

[0037] (2) Experimental reagents

[0038] Lysis solution (0.3 mol / L NaOH solution): Dissolve 1.2 g of NaOH in distilled water and make up to 100 mL.

[0039] Neutralizing solution (Tris-HCl): Dissolve 12.114 g of Tris in distilled water, make up to 100 mL, and adjust the pH to 8.0 with HCl; take 5 mL of Tris-HCl mixed solution and mix it evenly with 20 mL of 0.3 mol / L HCl, make up to 100 mL with distilled water, and dilute it 4 times when used.

[0040] M-100 trace element solution: Add 0.06 g H3BO3, 0.14 g MnCl2·4H2O, 0.4 g ZnCl2, 0.04 g Na2MoO4·2H2O, 0.1 g FeCl3·6H2O, and 0.4 g CuSO4·5H2O to an appropriate amount of distilled water and adjust the volume to 1 L after dissolving.

[0041] M-100 salt solution: Add KH2PO4 16.0 g, Na2SO4·10H2O 9.064 g, KCl 8.0 g, MgSO4·7H2O 2.0 g, CaCl2 1.0 g, and M-100 trace element solution 8.0 mL to an appropriate amount of distilled water and dilute to 1 L after dissolving.

[0042] 40 mg / mL acetosyringone solution: 0.2 g acetosyringone was dissolved in 5 mL dimethyl sulfoxide.

[0043] (3) Culture medium

[0044] The culture medium formula required by the present invention is as follows: The culture medium needs to be sterilized at 121°C for 20 minutes under high temperature and high pressure, and acetosyringone (AS) and corresponding antibiotics can be added after cooling to 55°C, and 1.5% agar powder needs to be added to the solid culture medium.

[0045] PDA solid culture medium (pH 5.4-5.8): purchased from Guangdong Zhongshan Bai Microbiological Technology Co., Ltd. Formula: potato extract powder 6.0 g / L, glucose 20.0 g / L, agar 20.0 g / L.

[0046] LB medium: yeast powder 0.5%, NaCl 1.0%, peptone 1.0%.

[0047] LK liquid medium: Add kanamycin solution with a final concentration of 50 μg / mL to LB medium.

[0048] YEB liquid medium: 0.1% yeast powder, 0.05% MgSO4·7H2O, 1.0% peptone, 0.5% sucrose. YEB liquid medium is then added with kanamycin at a final concentration of 50 μg / mL to form YCK medium.

[0049] IM induction liquid culture medium (pH 5.3-5.8): K2HPO4 2.28 g / L, KH2PO4 1.36 g / L, FeSO4·7H2O 0.0025 g / L, NaCl 0.15 g / L, 2-(N-morpholine)ethanesulfonic acid (MES) 8.53 g / L, MgSO4·7H2O 0.49 g / L, (NH4)2SO4 0.53 g / L, CaCl2 0.07 g / L, glycerol 5.0 g / L, 1 mol / L glucose 1.0%, 200 μg / mL acetosyringone.

[0050] IM co-culture solid medium: 1 mol / L glucose 0.5%, agar powder 1.5%, other ingredients are the same as IM induction liquid medium.

[0051] M-100 medium: glucose 1.0%, KNO3 0.3%, M-100 salt solution 6.25%, agar powder 1.5%.

[0052] Example 1 Construction method of Cmozf mutant strain

[0053] 1. Preparation of Cordyceps militaris DNA template

[0054] The wild type (WT) strain of Cordyceps militaris was inoculated on PDA solid medium, cultured in the dark at 25°C for 3 days, and then cultured in the light for 7 days. 5 μL of lysis solution was added to the PCR tube, the mycelium of Cordyceps militaris was immersed in the lysis solution, placed on the PCR instrument at 95°C for 3 minutes, and then 106 μL of neutralization solution was added, and the mixture was mixed by brief centrifugation.

[0055] 2. PCR reaction

[0056] The left arm (1593 bp, SEQ ID NO: 1) of Cmozf (locus_tag = "CCM_03777") of Cordyceps militaris was cloned using primers Cmozf-left-arm-F / Cmozf-left-arm-R, and the right arm (1500 bp, SEQ ID NO: 2) of Cmozf (locus_tag = "CCM_03777") of Cordyceps militaris was cloned using primers Cmozf-right-arm-F / Cmozf-right-arm-R. PCR primers are shown in Table 1, and the reaction system is shown in Table 2.

[0057] Table 1 Primer sequences

[0058]

[0059] Table 2 PCR reaction system for left and right arm gene amplification

[0060]

[0061]

[0062] PCR reaction conditions: pre-denaturation at 95°C for 3 min; 30 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 90 s; and 72°C for 5 min.

[0063] The left arm of Cmozf (1593 bp, SEQ ID NO: 1):

[0064] GACTCCCTCTGGTATCGCCGTGCCTCGGCCGCTAATCACTTTGCTCACCAGTCGCCACCATGTTCATCG

[0065] TCCACAACGCTCAGCTGGTCTGGCAATATCCAAAGAGCTACCCATTCGAACGGCGCAAAATCATGACC

[0066] CAATCCCATCTCTTACCTCGTGGCCGTCGCTCCTCGATGTTCGCATTAAGTCATTTCCACCTCGTATCGT

[0067] CGTTCCATGGCGCTCGACGACTCCGAGAGATTATGATGGATGAGGGAGAGCTCCCAAGCCCGGCCCG

[0068] CCCAAACCACTTATTTCGTGGCTGCGTTATATAGCCGGGAGGCTTTCCAACGTCTACTCGGCGTCTGTG

[0069] TTCAAATCTTTTGCCCGCCGGATCCAATTGTCCCGGCAGTCTGGCCTATTCCCCCCATCCGCCTCGCAT

[0070] CCGCGTCGACGGAGCACCGCCCACCCACCCCCAGCCACGAACTTCCTCCCTTGGACCCTTCTGGCCA

[0071] CTGGCTGTCCAGAAGATGCCGCAAAACGCCTGGTTTTGGTGGCTGCCTCCTCCACAGGTAGCGTCGT

[0072] GCTTGGCTTCTGCCACCAAAATGGGACGAATTGTCTTGCTCCATCGATGCCGGCGCCCGTCTCAAGAA

[0073] GTACTCTGCCTTAGTTGCGCCGAACCCCCCCAGCTCTCTTCAGGCCATGGCGCTTTCATGGCACTGGG

[0074] TACTCCGTACGGTACTGGTAGTTGTCAGTAGATGACAGGTCAAGTACAATGGCTCCGCGGCGTCTGTG

[0075] GTGGCCGTGCCTTGCGGTGCTTCTGCAAGATCCTGTACGTACTCTTCGGCGCTCCTCTCCACCCTTCA

[0076] AGAGCAAGCTAACTAACTACATATCGAGTAGCCAGTACCGGTAGCGTACTGGTAGCGGCGGACTTGTT

[0077] GGTCATTATCCGACTCTTCTGTACCTTTTTGTCTACACACCAAAAGCATTAGCCCGCATCTCACCCGCT

[0078] CAGCTCGCCCACCTTGACCTGTCTACGAATAACGAGTTAACTACTGGTACTAGCCAGCCTGGCTTGGC

[0079] CGGCGACCTCGATCGCAACTCGTCCCACCTTCTTACCCACCACCCCTGGTCCATCTCTGAACCTCTGA

[0080] AGCAATACGCCGTCCGTGCCCTCTCCTCTGGTCTCTTGCTATTCATACTCCGCCCTCATCCGTTCCCTTG

[0081] CCACCCCTCCCCCCCCCGGCCCGGCGCTCCTCACACACCTCTCACTCTCACCTCCCACACCAGCCTCA

[0082] CACACCACACGCCCTGGAACCCTCTCTCGCCTCAGATACCACCTCAACAAAGACGCCCATTATGGGTA

[0083] CATCTCAAGCCTGCCAGCCGCGATGGGACCTGACCCCGGTGGGCGAGAAAAAAGCCACTGCTTGCCT

[0084] CTGGTCTAATGCAGGCCTCCTCTGAGCCAAGATCTCCGACCCAGAATCCCGGTCCACTCCCTGTCCTA

[0085] AAACTTACACCACTCTGGACCTCTCTTGTCTAACTCTACACCTGAATGCTTGCTCTGCAGCCTCGCCG

[0086] GATACTTAACCCCCTCATCCACCACGTCAAGACCCCCCGTCCGCCTCTACAAAACATCTCGAACATATATACCCTCATTCCCTCCGCCTTTCT。

[0087] Right arm of Cmozf (1500 bp, SEQ ID NO: 2):

[0088] CATGATTTTCCAGCGCGACTCCAAGTCTCTCCACGAGATGCAGGCTCCTTCTCCTTCTACTCGCAGCG

[0089] AGTCTCGGGGCTCTGTCAGCCGTTCTTCTGTTTCTTCGCACCCTACCGCCTCCGCCAAAACGATTACCT

[0090] ACAACGAGACCCTCAACCCCGTTGACCGAGTCAACTTTGACACTGATGTCGATGAGCTCATGAAGGC

[0091] TATCCAGAGAAAGAAGTCTGAGGCCAAGGTCGAGGCCTCCCAGGGCCCTACACCTGCTCACACTCCC

[0092] CGCGCTGACCACACAGAGCCCTCGTCTCCGTCAAGTATCGCCGCCCCAGCTGAGAGCAAGCCCAAGA

[0093] AGAAGTGGGTTTGCGATGGTCCTAGCTGCCACAAGAGCTTTGTTCAGAAGACTCATCTCGACATCCAC

[0094] CGCCGCACTCACACCGGTGCCAAACCCTACGTCTGCACCAAGGAAAACTGTGGTCTTACCTTCTCCC

[0095] AGCGAGGTAACCTCAAGACACACATGCGCCGCCACACTGGCGAGAAGCCCTTCTGCTGCCGCATCTG

[0096] TGGCAAGACTTTTGCTCAACGTGGCAACGTCCGCTCCCACGAGGAGACTCACAAGGGCATGAAGCCA

[0097] TACGTTTGCAAGCTCGATGACTGCAACAAGACCTTCTCCCAGCTGGGCAACATGAAGACGCACCAGA

[0098] ACAACTTCCACAAGGAGACCATTCAGAGGCTGATTGCCCTGTTCGTCAAGCTTGCTGCCGAGGGCGA

[0099] TATTCCCGAGGAGCACCAGGAGCTCTTTGAGTACTTCAACGAGCACTATAAGAACAGCAACAAGGGT

[0100] GTCAAGGGCCGCGGCAAGGCACGCACCGTGGCGGCGCGCAAGCCCAAGGGTCCGCCCCGATCTCAA

[0101] AGTCTCTCTTGCCCGGTTCCCCAGCTGCCTTTGCCCCAAATTCCCCGGCACCACAGCCTATCTGCCTAC

[0102] GACCTGTCGAGCCAGACCACCACCCCTGGCATGGCCAGCATTCCCAGAACGCACAACCCCGAGTACG

[0103] CCATGTTTGACCAGCCCGACGTCCTCTACGAGGAGGACCACAGCCACATGAGTTTCACCGACCGCCT

[0104] GTACTAAAGGACAAAACTATTATGATTACGAAAAACAACTCGAAACAGCGCTCGGGTGCAAAAGTCG

[0105] ACTCTAGCGGTTGGAGCTGACACGACGTGAACGAATATACTTATGACTGCGCATGGCTGACCTGGCGG

[0106] GGACGATTTACTCTGTCAACAGTCAGATCCCGCCCAGAGTCTTGGGAAAGTTTCTTGTTTGGCGCTTT

[0107] TGCTCTTGGATGCGATTTGATTTTGGATCTGGACTTGAAAAAATTGGCGATTTGAGGCGGCACACGAG

[0108] GCGTGTCTGTGACTTGCATCGCGTGGAGCGTTGCAACGGCAGCAACACGATCCCAAGGAAAAGTTGG

[0109] GGGGGTATTCTGTCTTTACTAATGGCTTTATTGTTTCGTTTGGCTGTCTGAACTATCACTATTGTACTGCGCCGCCTCTTTTTCA.

[0110] 3. Enzyme digestion reaction

[0111] The recombinant vector was digested with restriction endonucleases in a PCR instrument. The digestion reaction system is shown in Table 3. The reaction conditions were: incubation at 37°C for 1 hour.

[0112] Table 3 Restriction endonuclease digestion reaction system

[0113]

[0114]

[0115] 4. Ligation reaction

[0116] The linearized vector recovered by enzyme digestion and the DNA fragment were homologously recombined under the action of ligase. Each ligation component was added to the PCR tube in order, centrifuged briefly to mix, and placed in a PCR instrument for 0.5 h at 37°C. The ligation reaction system is shown in Table 4.

[0117] Table 4 Ligation reaction system

[0118]

[0119] 5. Transformation of E. coli competent cells

[0120] Mix 10 μL of the recombinant ligation product with 50 μL of E. coli competent cells, place in an ice bath for 30 minutes, and heat shock in a 42°C metal bath for 45 seconds. After a 2-minute ice bath, add 900 μL of LB medium and culture at 37°C, 150 r / min for 1 hour. Centrifuge at 12000 r / min for 1 minute, discard 900 μL of supernatant, mix the remaining 100 μL of supernatant and bacterial precipitate evenly, spread on LK medium, and culture at 37°C inverted for 16 hours.

[0121] 6. Preparation of Agrobacterium Competent Cells

[0122] Pick a single colony of Agrobacterium and inoculate it into 50 mL YEB liquid medium (containing rifampicin at a final concentration of 50 μg / mL) in a sterile test tube, and shake culture at 180 rpm and 28°C until OD 600The pH value was about 0.5; centrifuged at 4°C and 5000r / min for 5min, discarded the supernatant, added 1mL of pre-cooled 20mmol / L CaCl2 to the bacterial precipitate, gently mixed, and placed in an ice bath for 30min; centrifuged at 12000r / min for 1min, discarded the supernatant, added 1mL of pre-cooled 20mmol / L CaCl2 and glycerol with a final concentration of 20% to the precipitate and mixed evenly; divided into 50μL portions, quickly frozen in liquid nitrogen, and stored in a -70°C refrigerator for later use.

[0123] 7. Transformation of recombinant vector into Agrobacterium

[0124] The knockout vector is transferred into Agrobacterium using the chemical method. The specific steps are as follows:

[0125] (1) Use a pipette to draw 4 μL of plasmid into 50 μL of competent cells and mix them evenly. Place them in an ice bath, liquid nitrogen, and a 37°C constant temperature metal bath for 5 min respectively.

[0126] (2) Add 1 mL YEB liquid culture medium to the centrifuge tube and place it on a shaker at 150 rpm and 28°C for about 3 hours.

[0127] (3) Centrifuge at 12000 r / min for 1 min, discard part of the filtrate, retain 100 μL of the supernatant, mix the bacteria, spread it on YCK medium, and culture it upside down in a 28°C incubator for 2 to 3 days until a single colony grows.

[0128] (4) PCR verification of the transformed Agrobacterium. PCR primers are shown in Table 1, and the specific reaction system is shown in Table 5 below.

[0129] Table 5 Agrobacterium colony PCR verification reaction system

[0130]

[0131] PCR reaction conditions: 98°C / 10s pre-denaturation, 55°C / 15s, 72°C / 60s, 25 cycles; 72°C / 5min.

[0132] 8. Agrobacterium-mediated transformation of Cordyceps militaris

[0133] (1) Activation and induction culture of Agrobacterium

[0134] Agrobacterium was inoculated into YCK liquid medium and cultured on a shaker at 180 r / min at 28°C until OD 600 Take 1 mL of bacterial solution and place it in a 1.5 mL centrifuge tube. Centrifuge at 12000 r / min for 1 min. Discard the supernatant and adjust the bacterial solution concentration to OD 0. 600 About 0.4, 28℃, 180r / min, dark culture for 6h.

[0135] (2) Preparation of Cordyceps militaris conidia suspension

[0136] The strain cultured on PDA solid medium at 25°C for 5 to 7 days was resuspended in 0.05% Tween 80 and filtered through double-layer lens paper to obtain a conidia suspension. The conidia concentration was adjusted to 5 × 10 4 Pieces / mL.

[0137] (3) Co-cultivation and screening

[0138] Vortex and mix the Agrobacterium suspension and conidia suspension at a volume ratio of 1:1, take 100 μL of the mixed bacterial solution and evenly spread it on the IM solid medium covered with a microporous filter membrane, and culture it at 25°C in the dark for 48 to 60 hours. According to the method of "Identification and Application of Synthetic Gene Cluster of Cordycepin" by Wang Chengshu et al., use M-100 medium for preliminary screening, sterilize and cool the M-100 medium to 55°C, add 0.1% glufosinate solution and 200 μg / mL cefotaxime sodium solution, and pour the plate. After the culture medium solidifies, transfer the microporous filter membrane on the IM medium to the plate, and culture it in a 25°C incubator for 6 to 10 days until transformants grow.

[0139] (4) Identification of Cordyceps militaris transformants

[0140] Add 600 μL of M-100 medium containing the same resistance to a 48-well culture plate, inoculate a single, well-growing transformant into the 48-well plate with a sterilized toothpick, and culture at 25°C for 5 to 6 days for secondary screening. Use a toothpick to pick the hyphae of the well-growing transformant in the 48-well culture plate and invade the lysis solution, place it on a PCR instrument at 95°C for 3 minutes, then add 106 μL of neutralizing solution, centrifuge briefly to mix, and prepare a simple PCR template. Use Cmozf-left arm-F / PtrpC-anti-30 and QCmozf-F / R as primers (see Table 1) for PCR reaction identification, and the PCR reaction system and conditions are the same as "7. Transformation of recombinant vector into Agrobacterium".

[0141] 9. Determination of carotenoid content

[0142] Weigh the mycelium of Cordyceps militaris cultured on PDA medium for 15 days and dry it in a 55℃ oven to constant weight. Grind 0.1g of dried mycelium and add 70% ethanol for ultrasonic extraction at a solid-liquid ratio of 1:60, with an ultrasonic power of 418W and an ultrasonic time of 20min. Then continue to extract in a 50℃ water bath for 15min, centrifuge at 5000r / min for 10min, discard the precipitate, and the supernatant is the test solution. Detect the absorbance of the test solution at a wavelength of 470nm.

[0143]

[0144] Where A: absorbance; V: 70% ethanol usage; D: dilution factor of extract; 0.16: extinction coefficient; W: dry weight of sample (g).

[0145] 10. Results and Analysis

[0146] 10.1 PCR Amplification of the Left and Right Arms of the Cmozf Gene of Cordyceps militaris

[0147] Using the mycelial lysate of Cordyceps militaris as a template, the left and right arm fragments of the Cmozf gene were cloned according to the designed amplification primers. Figure 1 As shown, lanes 1 and 2 are cloned right-arm gene fragments with obvious bands at about 1500 bp; lanes 3 and 4 are cloned left-arm gene fragments with obvious fragments at about 1600 bp.

[0148] 10.2 Enzyme Digestion Verification of Knockout Vector pK2-bar-Cmozf

[0149] The linear vector pK2-bar recovered by EcoRI digestion was homologously recombined with the left arm of Cmozf, and the obtained recombinant vector pK2-bar-Cmozf (left arm) was digested with XbaI and then connected with the right arm of Cmozf to finally obtain the gene knockout vector pK2-bar-Cmozf. The knockout vector was then digested with EcoRI and XbaI for verification. The results are shown in Figure 2 As shown, lane 1 is the EcoRI digestion product, with a corresponding band at about 1600 bp; lane 2 is the XbaI digestion product, with a corresponding band at 1500 bp, which was confirmed by sequence determination, and the knockout vector was successfully constructed.

[0150] 10.3 PCR identification of Agrobacterium transformants

[0151] The knockout vector pK2-bar-Cmozf was transformed into Agrobacterium. Figure 3 As shown, lane 1 uses the left and right arm terminal sequences Cmozf-up / down as upstream and downstream primers (see Table 1), which can amplify a band of about 2000bp on the vector (bar gene); lanes 2 and 3 amplify the left and right arms of the Cmozf gene, respectively, with corresponding bands at about 1500bp and 1600bp. Agrobacterium was verified using 3 different pairs of primers, and the amplified fragments were consistent with the expected size, indicating that the recombinant vector was successfully transferred into Agrobacterium.

[0152] 10.4 Screening and identification of Cordyceps militaris transformants

[0153] PCR verification was performed using the mycelial lysate of Cordyceps militaris screened twice as a template. Figure 4As shown in A, the mutant had a clear band at about 1600bp using Cmozf-left-arm-F / PtrpC-anti-30 as primers for verification, while no band was found using H2O and WT as templates. The replaced gene fragment was amplified using QCmozf-F / R as primers, and the mutant had no wild-type band, while WT amplified a fragment at 150bp, indicating that the Cmozf gene was knocked out. Two of the strains were selected as subsequent experimental materials and named ΔCmozf-7 and ΔCmozf-11, respectively.

[0154] 10.5 Results of carotenoid content detection in ΔCmozf strain

[0155] Compared with WT, the carotenoid content in the ΔCmozf strain increased by about 1 times, reaching a maximum of 450.4 μg / g, which was higher than WT (207.6 μg / g), and the difference was extremely significant (p<0.01). Figure 5 shown.

[0156] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A Cmozf mutant for increasing the carotenoid content in Cordyceps militaris mycelium, characterized in that: The Cmozf mutant is obtained by using a wild-type Cordyceps militaris strain as a starting strain, selecting a nucleotide sequence such as a left arm shown in SEQ ID NO: 1 and a nucleotide sequence such as a right arm shown in SEQ ID NO: 2 on the 5' and 3' flanks of the Cmozf gene to construct a knockout vector, and knocking out the Cmozf gene of the Cordyceps militaris strain using a homologous recombination method.

2. A method for constructing a Cmozf mutant according to claim 1, characterized in that: The following steps are involved: constructing a knockout vector of the Cmozf gene, and transferring the knockout vector into Agrobacterium to construct a recombinant Agrobacterium; Transforming the recombinant Agrobacterium into a wild-type Cordyceps militaris strain, and screening positive transformants to obtain a Cmozf mutant that increases the carotenoid content in Cordyceps militaris mycelium; The method for constructing the knockout vector comprises the following steps: The gene fragments flanking the 5' and 3' ends of the Cmozf gene were cloned to obtain the left and right arms; The left arm and the right arm are cloned into the upstream and downstream sides of the gene bar of the pK2-bar backbone vector as homology arms, thereby obtaining the knockout vector; The nucleotide sequence of the left arm is shown in SEQ ID NO:1, and the nucleotide sequence of the right arm is shown in SEQ ID NO:

2.

3. The construction method according to claim 2, characterized in that: The wild-type Cordyceps militaris conidia is used as a receptor material and glufosinate-ammonium is used as a screening marker. The recombinant Agrobacterium is transferred into the wild-type Cordyceps militaris strain for homologous recombination replacement, and positive transformants are obtained through resistance screening.

4. The construction method according to claim 3, characterized in that: The volume ratio of the wild-type Cordyceps militaris conidia suspension to the recombinant Agrobacterium suspension is 1:1, and the concentration of the wild-type Cordyceps militaris conidia suspension is 5×10 4 / mL, the OD of the bacterial suspension of the recombinant Agrobacterium 600 The value is 0.3-0.

5.

5. The construction method according to claim 2, characterized in that: The wild-type Cordyceps militaris strain includes the Cordyceps militaris CM01 strain.

6. Use of the Cmozf mutant according to claim 1 in any of the following: (1) Application in the preparation of carotenoids; (2) Application in increasing the carotenoid content in Cordyceps militaris mycelium.

7. A method for obtaining carotenoids from Cordyceps militaris mycelium, characterized in that: The method comprises the steps of culturing the Cmozf mutant according to claim 1 and extracting carotenoids from the mycelium of the Cmozf mutant.

8. The method according to claim 7, characterized in that The culture conditions are: culture on PDA medium for 15 days.

Images