A molecular marker for the detection of primary hepatocellular carcinoma and its application

Abstract

The present invention discloses an application of a reagent for detecting the methylation level of molecular markers in the preparation of a reagent product for detecting primary hepatocellular carcinoma, belonging to the technical field of gene detection. This solution can identify whether the patient from whom the sample is derived is a patient with primary hepatocellular carcinoma by detecting the methylation level of CpG sites in the region of chr17: 30970241-30970741. If the target sample is from a patient with primary hepatocellular carcinoma, the CpG sites in the above region are at a high methylation level; if the target sample is from a healthy person or a patient with a benign liver disease (such as cirrhosis, hepatitis, etc.), the CpG sites in the above region are at a low methylation level. The CpG sites in this region can be used to distinguish between samples from patients with primary hepatocellular carcinoma and samples from healthy people, as well as between samples from patients with primary hepatocellular carcinoma and samples from patients with benign diseases (such as cirrhosis, hepatitis, etc.).

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and particularly relates to a molecular marker for detecting primary hepatocellular carcinoma and its application. Background Art

[0002] Primary liver cancer (PHC) is the sixth most common cancer globally. It has a hidden onset, rapid disease progression, poor prognosis, and relatively high incidence and mortality rates. Epidemiological data shows that there are 90 million hepatitis B virus carriers, and the number of liver cancer cases accounts for 54% of the global total. Liver cancer is a serious public health problem threatening people's lives and health.

[0003] The liver is hidden deep in the upper abdomen and is not easily detected in the early stage of enlargement. At the same time, the liver has a strong compensatory ability and often has no symptoms or very mild symptoms in the early stage. Patients usually only show non-specific digestive tract symptoms such as loss of appetite, nausea, and vomiting. Therefore, it is very difficult to make a diagnosis in the early stage. According to relevant data, the 5-year survival rate after radical surgical resection of small liver cancers with a diameter less than 5 cm is 72.9%, and the 5-year survival rate after surgical resection of liver cancers with a diameter less than 2 cm is 86.4%. However, the overall 5-year survival rate of current clinical liver cancer cases is only about 20%. More than 85% of liver cancer patients are in the middle and late stages when they seek medical treatment, and the survival period of patients is less than 2 years. Early screening, early diagnosis, and early treatment are of great significance for the diagnosis and treatment of liver cancer. At the same time, it can significantly improve the survival period and quality of life of patients, and also greatly reduce the treatment costs of patients.

[0004] Currently, the commonly used clinical diagnostic methods for liver cancer include: abdominal ultrasound, serological alpha-fetoprotein (AFP) detection, X-ray computed tomography (CT), magnetic resonance imaging (MRI), and fine needle aspiration biopsy, etc. As a widely used tumor marker for primary liver cancer, when the AFP is greater than 400 μg / L or its content is continuously rising, it has a definite diagnostic significance. However, about 40% of small liver cancer patients have normal levels of alpha-fetoprotein. At the same time, non-malignant diseases such as acute and chronic hepatitis, convalescence of severe hepatitis, cirrhosis, and congenital biliary atresia can also cause an increase in alpha-fetoprotein. Therefore, according to relevant research statistics, the sensitivity of single serum alpha-fetoprotein (AFP) detection for the diagnosis of early liver cancer is about 32%-49%, and the sensitivity is relatively low. The combined detection of color Doppler ultrasound and serum alpha-fetoprotein can increase the sensitivity of liver cancer diagnosis to about 63%, but the sensitivity is still relatively low. Other imaging examinations such as CT or MRI are radioactive, and multiple detections are harmful to human health to a certain extent, and the cost is relatively high. Fine needle aspiration biopsy and the like are invasive operations, and the patient compliance is relatively low.

[0005] There is still a need in this field for an accurate early liver cancer diagnosis method that is non-invasive, low-cost, highly sensitive and specific, and suitable for large-scale screening. Summary of the Invention

[0006] The first object of the present invention is to provide a molecular marker for the detection of primary hepatocellular carcinoma. The reagent for detecting the methylation level of this molecular marker can be effectively applied in the preparation of products for the detection of primary hepatocellular carcinoma. Using the hg38 genome as the reference genome, by detecting the methylation level of CpG sites in the genomic region of chr17: 30970241-30970741, it has good sensitivity and specificity for the screening and auxiliary diagnosis of primary hepatocellular carcinoma, and can be used to distinguish samples from patients with primary hepatocellular carcinoma from samples of patients with benign liver diseases (such as liver cirrhosis, hepatitis, etc.) and healthy people.

[0007] The second object of the present invention is to provide a non-invasive, convenient, safe, fast and highly accurate product for detecting methylation level for the screening and auxiliary diagnosis of primary hepatocellular carcinoma.

[0008] The present invention is achieved through the following technical solutions:

[0009] A molecular marker for the detection of primary hepatocellular carcinoma, wherein the molecular marker is a nucleic acid molecule containing at least one CpG site in the genomic region sequence of chr17: 30970241-30970741;

[0010] The genomic region is from the hg38 human reference genome.

[0011] The application of a reagent for detecting the methylation level of a molecular marker in the preparation of a product for the detection of primary hepatocellular carcinoma, comprising the molecular marker for the detection of primary hepatocellular carcinoma as described above.

[0012] Preferably, the molecular marker is located in the following region containing at least one CpG site:

[0013] Region 1, Region 2, Region 3, Region 4;

[0014] Region 1 is selected from chr17: 30970270-30970355, Region 2 is selected from chr17: 30970348-30970428, Region 3 is selected from chr17: 30970452-30970550, and Region 4 is selected from chr17: 30970629-30970741.

[0015] Preferably, the detection product is any one of a reagent, a kit, a chip and a sequencing library.

[0016] Preferably, when the test product is a reagent, the test reagent includes one or more combinations selected from nucleic acid combination 1 for detecting region 1, nucleic acid combination 2 for detecting region 2, nucleic acid combination 3 for detecting region 3, and nucleic acid combination 4 for detecting region 4.

[0017] Preferably, nucleic acid combination 1 includes primer combination 1, nucleic acid combination 2 includes primer combination 2, nucleic acid combination 3 includes primer combination 3, and nucleic acid combination 4 includes primer combination 4;

[0018] The base sequence of primer combination 1 has at least 90% identity with the base sequences shown in SEQ ID NO.1-2;

[0019] The base sequence of primer combination 2 has at least 90% identity with the base sequences shown in SEQ ID NO.4-5;

[0020] The base sequence of primer combination 3 has at least 90% identity with the base sequences shown in SEQ ID NO.7-8;

[0021] The base sequence of primer combination 4 has at least 90% identity with the base sequences shown in SEQ ID NO.10-11.

[0022] Preferably, nucleic acid combination 1 further includes probe 1, nucleic acid combination 2 further includes probe 2, nucleic acid combination 3 further includes probe 3, and nucleic acid combination 4 further includes probe 4;

[0023] The base sequence of probe 1 has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the base sequence shown in SEQ ID NO.3;

[0024] The base sequence of probe 2 has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the base sequence shown in SEQ ID NO.6;

[0025] The base sequence of probe 3 has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the base sequence shown in SEQ ID NO.9;

[0026] The base sequence of probe 4 has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the base sequence shown in SEQ ID NO.12.

[0027] Preferably, the methylation level of the molecular marker is detected by any one of the following methods: MSP method, high-throughput sequencing method, methylation-specific high performance liquid chromatography method, ddPCR method, methylation-specific high-resolution melting curve method, methylation-specific microarray method, methylation-sensitive restriction enzyme method, and Methylight method;

[0028] The sequencing method includes bisulfite sequencing method, whole-genome methylation sequencing method, or sequencing-by-synthesis method.

[0029] A kit for detecting primary hepatocellular carcinoma includes the nucleic acid combination, positive control, negative control, detection primers for internal reference genes, detection probes for internal reference genes, DNA polymerase, and buffer.

[0030] Preferably, the test samples of the kit are ex vivo blood samples, ex vivo tissue samples, and ex vivo white blood cell samples.

[0031] Compared with the prior art, the present invention has at least the following technical effects:

[0032] (1) The present invention provides a molecular marker for detecting primary hepatocellular carcinoma. The reagent for detecting the methylation level of the molecular marker can be effectively applied in the preparation of products for detecting primary hepatocellular carcinoma. Taking the hg38 genome as the reference genome, by detecting the methylation level of CpG sites in the genomic region of chr17: 30970241-30970741, it has good sensitivity and specificity for the screening and auxiliary diagnosis of primary hepatocellular carcinoma, and can be used to distinguish samples from patients with primary hepatocellular carcinoma from samples of patients with liver benign diseases (such as cirrhosis, hepatitis, etc.) and healthy people.

[0033] (2) The present invention provides a non-invasive, convenient, safe, fast, and highly accurate product for detecting methylation level for the screening and auxiliary diagnosis of primary hepatocellular carcinoma.

[0034] (3) By detecting the methylation level of CpG sites in the sequence of the region chr17: 30970241-30970741, the present invention can identify whether the patient from whom the sample is derived is a patient with primary hepatocellular carcinoma.

[0035] If the target sample is from a patient with primary hepatocellular carcinoma, the CpG sites in the above region are at a high methylation level. If the target sample is from a healthy person or a patient with a liver benign disease (such as cirrhosis, hepatitis, etc.), the CpG sites in the above region are at a low methylation level.

[0036] The CpG sites in the above-mentioned regions can be used to distinguish between samples from patients with primary hepatocellular carcinoma and healthy individuals, as well as between samples from patients with primary hepatocellular carcinoma and patients with benign diseases (such as cirrhosis, hepatitis, etc.).

[0037] (IV) The present invention provides good molecular markers for the early screening and auxiliary diagnosis of primary hepatocellular carcinoma, which have the advantages of non-invasive, convenient, safe, fast, and high accuracy.

[0038] (V) The detection reagent and application for detecting the methylation level of the molecular marker provided by the present invention can improve the detection rate of primary hepatocellular carcinoma in high-risk populations and the general population of hepatocellular carcinoma, thereby meeting the clinical needs of early screening and early diagnosis of hepatocellular carcinoma. Reduce the mortality rate of patients with hepatocellular carcinoma and reduce the expenditure of medical costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is the R & D flow chart for the mining and screening of methylation markers for detecting liver cancer in Example 1;

[0040] Figure 2 is the ROC graph for the detection of methylation markers in ex vivo blood samples of liver cancer in Example 3. DETAILED DESCRIPTION OF THE INVENTION

[0041] The following will describe the implementation plan of the present invention in detail in combination with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments not specified by the manufacturer can be obtained as conventional products through commercial purchase.

[0042] The technical solution of a specific implementation manner of the present invention is as follows:

[0043] The terms "complementary" and "complementarity" refer to deoxyribonucleotides / ribonucleotides (such as 1 base) or polynucleotides / ribonucleotides (such as base sequences) related to the base pairing rules. For example, the sequence 5'-T-A-T-3 is complementary to the sequence 3'-A-T-A-5. Complementarity can be "partial", where only some nucleic acid bases are matched according to the base pairing rules. Alternatively, there may be "complete" complementarity between nucleic acids, and the degree of complementarity between nucleic acid strands affects the binding efficiency of hybridization between primers and nucleic acid sequences and between probes and nucleic acid sequences.

[0044] The term "polymerase chain reaction" is used to amplify a target sequence. This method consists of the following steps: adding a large excess of primers to a reaction system of a DNA mixture with the desired target sequence, and then performing precise thermal cycling reactions in the presence of a DNA polymerase. According to the principle of "partial" or "complete" complementarity between the primer and the template strand, denaturation-complementary sequence annealing-extension is carried out according to the reaction program and multiple rounds of repeated thermal reactions are performed to obtain a high concentration of amplified fragments of the desired target sequence. Due to the repetitive aspect of this method, this method is called "polymerase chain reaction" ("PCR"). Its product is a "PCR product" or "amplicon". Therefore, the nucleic acid detection and determination methods of the present invention include, but are not limited to, DNA sequencing methods, probe hybridization methods, methylation-specific high-performance liquid chromatography methods, ddPCR methods, methylation-specific high-resolution melting curve methods, methylation-specific microarray methods, methylation-sensitive restriction enzyme methods, and Methylight methods.

[0045] The term "methylation level" is the same as the general understanding, referring to whether one or more cytosines in a CpG dinucleotide in a DNA sequence are methylated, or the frequency / proportion / percentage of methylation, which represents both a qualitative concept and a quantitative concept. For example, if the cytosine (C) residue in a nucleic acid sequence is methylated, it can be called "hypermethylated" or have "increased methylation". In practical applications, different detection indicators can be used to compare the DNA methylation level according to the actual situation. For example, in some cases, comparison can be made according to the Ct value of the sample detection. In some cases, the methylation ratio of the marker in the sample can be calculated, that is, the number of methylated molecules / (the number of methylated molecules + the number of unmethylated molecules) × 100, and then comparison can be made. In some cases, statistical analysis and integration of each indicator are also required to obtain the final determination indicator.

[0046] Example 1: Screening process of methylation markers for liver cancer detection

[0047] This example discloses a methylation marker composition for detecting early liver cancer and its screening process. The specific process is as Figure 1 shown

[0048] To discover and screen methylation markers with excellent detection performance, in this embodiment, a customized hybridization capture large panel was first used for targeted methylation sequencing. This hybridization capture panel covered 3.98 million CpG methylation sites in the human genome, covering most of the CpG island regions and genes related to cancer occurrence, with a coverage range 10 times that of traditional DNA methylation chips. By performing targeted sequencing on 82 clinical frozen tissue samples and 115 in vitro blood samples and comparing the changes in methylation patterns between the cancer group and the non-cancer group, this embodiment preliminarily identified 30,008 methylation sites that could significantly distinguish cancer samples from non-cancer samples in both tissue samples and blood samples as potential cancer markers.

[0049] Furthermore, a hybridization capture panel was designed based on the above 30,008 preliminarily screened methylation sites for the second round of targeted methylation sequencing. This round of sequencing adopted a deep sequencing strategy, with an average sequencing depth reaching 500X, significantly improving the accuracy of methylation level calculation and facilitating the precise screening of the second-round markers. By performing targeted methylation sequencing on 218 in vitro plasma samples of clinical liver cancer patients and 196 in vitro plasma samples of the non-cancer group, and using univariate statistical analysis and machine learning methods, 12 DNA methylation markers with the best liver cancer detection performance were precisely screened out.

[0050] Finally, primer and probe nucleic acid combinations for the qPCR detection platform were designed for the genomic regions of the 12 selected methylation markers, and the performance verification of liver cancer detection was carried out on the qPCR platform using 32 in vitro plasma samples of clinical liver cancer patients and 47 in vitro plasma samples of the non-cancer group. Finally, the DNA methylation marker with the best liver cancer detection performance was determined through univariate performance analysis, that is, the methylation level of the genomic region chr17: 30970241-30970741. The primer combinations for detecting the methylation level of this marker include any one of SEQ ID NO.1-2, SEQ ID NO.4-5, SEQ ID NO.7-8, and SEQ ID NO.10-11.

[0051] The nucleic acid probes for detection include any one of SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.12.

[0052] Example 2: Detection performance of the screened markers in liver cancer tissue samples

[0053] Thirty-three clinical liver cancer tissue samples and 49 non-cancer control tissue samples were collected, and genomic extraction, methylation conversion based on enzymatic conversion, and targeted methylation sequencing were performed on the tissue samples. The specific experimental steps are as follows:

[0054] 1. Extraction of DNA samples: When the sample is a frozen fresh tissue sample, the genomic DNA is extracted using the "Blood&Tissue Kit#69506" from QIAGEN. For the specific operation, refer to the kit instruction manual. The genomic DNA is fragmented using a Covaris M220 ultrasonic disruptor. When extracting cfDNA from plasma samples, the "Cell-Free DNA Extraction Kit (Filtration Method)#C02-1" from Guangzhou Youze Biotechnology is used. For the specific operation, refer to the kit instruction manual. 2. Fragment screening of the extracted DNA samples using SPRIselect magnetic beads according to the recommended steps in the instruction manual to filter out DNA molecules larger than 200 bp.

[0055] 3. Preparation of quality control products: 10 μL of 0.1 ng / μL CpG-methylated pUC19 and 10 μL of 2 ng / μL non-methylated λDNA need to be added to each sample.

[0056] 4. Library construction for methylation sequencing: The NEBNext Enzymatic Methyl-Seq kit is used for library construction.

[0057] 4.1 End repair and addition of "A" at the 3' end

[0058] 4.1.1 Take 50 ng of the sample to be tested, dilute it to 50 μL with NF water, and then add the following reagents for reaction.

[0059] 4.1.2 Place it in a PCR instrument and perform the reaction according to the following program

[0060] Component Volume (μL) Control DNA Working Solution 20 End Repair Reaction Solution 5 End Repair Enzyme Mix 5

[0061] 4.2 Ligation of adapters

[0062]

[0063] 4.2.1 Add the following reagents to the end repair product for reaction

[0064] 4.2.2 Place it in a PCR instrument and set the PCR reaction program according to the following conditions: 60 °C, 60 min, heat lid closed.

[0065]

[0066] 4.2.3 Purification of the adapter ligation product

[0067] A. Equilibrate the purification magnetic beads at room temperature for 30 min and mix the purification magnetic beads thoroughly on a vortex mixer.

[0068] A. Equilibrate the purification magnetic beads at room temperature for 30 min and mix the purification magnetic beads thoroughly on a vortex mixer.

[0069] B. Prepare 80% ethanol in the ratio of absolute ethanol: nuclease-free water = 8:2 for later use.

[0070] C. Add 55 μL of purified magnetic beads to the ligation product respectively, pipette and mix well, incubate at room temperature for 5 minutes, place on a magnetic stand, and discard the supernatant after the solution becomes clear; wash with freshly prepared 80% ethanol and discard the supernatant, repeat this step once; air dry, elute with 15 μL of elution buffer, and pipette 14 μL of the supernatant for the next reaction.

[0071] 4.3 Methylation: Oxidation reaction

[0072] 4.3.1 Prepare buffer:

[0073] a. Add 400 μL of E1 reaction buffer supplement to 100 μL of E1 reaction buffer, shake and mix well, and label the preparation date.

[0074] b. Take 10 μL of 500 mM Fe(II) and add it to 1249 μL of nuclease-free water. The diluted solution should be used immediately and freshly prepared, and cannot be stored.

[0075] c. Dilute the termination buffer with nuclease-free water in a ratio of 1:10.

[0076] 4.3.2 Add the following reagents to 14 μL of the purified ligation product and mix well, then add 10 μL of the diluted Fe(II) to the purified ligation product already added with oxidase and mix well and centrifuge.

[0077]

[0078]

[0079] 4.3.3 Place on a PCR instrument and react under the following conditions: 37°C, 1 h, hot lid temperature ≥ 45°C.

[0080] 4.3.4 After the reaction is completed, add 1 μL of the diluted reaction termination solution to the product, and place on a PCR instrument and react under the following conditions: 37°C, 30 min, hot lid temperature ≥ 45°C.

[0081] 4.3.5 Purification of the oxidation reaction product

[0082] A. Equilibrate the purified magnetic beads at room temperature for 30 min, and mix the purified magnetic beads well on a vortex mixer;

[0083] B. Prepare 80% ethanol in the ratio of absolute ethanol: nuclease-free water = 8:2 for later use;

[0084] C. Add 45 μL of NEB Next Sample purification magnetic beads to the ligation product respectively, pipette and mix well, incubate at room temperature for 5 minutes, place on a magnetic stand, and discard the supernatant after the solution becomes clear; wash with freshly prepared 80% ethanol and discard the supernatant, repeat this step once; air dry, elute with 9.5 μL of elution buffer, and pipette 8 μL of the supernatant for the next reaction.

[0085] 4.4 Methylation: Cytosine Deamination

[0086] 4.4.1 Denaturation:

[0087] a Preheat the PCR instrument to 85 °C in advance and turn on the heated lid.

[0088] b Add 2 μL of formamide to 8 μL of the purified oxidation reaction product, vortex and mix well, and centrifuge briefly.

[0089] 4.4.2 Add the following reagents to the denatured product for reaction

[0090]

[0091]

[0092] 4.4.3 Place on the PCR instrument and react under the following conditions: 37 °C, 3 h, heated lid temperature ≥ 45 °C.

[0093] 4.4.4 Purification of the cytosine deamination reaction product

[0094] a Equilibrate the purification magnetic beads at room temperature for 30 min and mix well on a vortex mixer.

[0095] b Prepare 80% ethanol by mixing absolute ethanol and nuclease-free water in a ratio of 8:2 for later use.

[0096] c Add 50 μL of NEB Next Sample purification magnetic beads to the ligation product respectively, pipette and mix well, incubate at room temperature for 5 minutes, place on a magnetic stand, and discard the supernatant after the solution becomes clear; wash with freshly prepared 80% ethanol and discard the supernatant, repeat this step once; air dry, elute with 11 μL of elution buffer, and pipette 10 μL of the supernatant for the next reaction.

[0097] 4.5 PCR Amplification and Purification

[0098] 4.5.1 Add the following reagents to the above purified product for reaction

[0099] Component Volume (μL) Primer 2.5 Enzyme Mix 12.5

[0100] 4.5.2 Place on the PCR instrument and react under the following conditions

[0101]

[0102] 4.5.3 Purification of PCR Amplification Products

[0103] a Equilibrate the purification magnetic beads at room temperature for 30 min and mix the purification magnetic beads thoroughly on a vortex mixer;

[0104] b Prepare 80% ethanol in the ratio of absolute ethanol: nuclease-free water = 8:2 and set aside;

[0105] c Add 22.5 μL of NEB purification magnetic beads to the ligation product respectively, pipette and mix well, incubate at room temperature for 5 minutes, place on a magnetic stand, and discard the supernatant after the solution becomes clear; wash with freshly prepared 80% ethanol and discard the supernatant, repeat this step once; air dry, elute with 15 μL of elution buffer, aspirate 14 μL of the supernatant for quality inspection.

[0106] 5. Hybridization Elution

[0107] 5.1 Hybridization:

[0108] a Take 10 ng from each library to be hybridized, calculate the volume of the libraries required for combined hybridization, and mix 12 libraries together;

[0109] b Add the following reagents to the library mixture for reaction;

[0110] c Turn on the vacuum concentrator, set the V-AQ mode, and concentrate into dry powder at room temperature;

[0111] d Immediately take 20 μL of the hybridization mixture and add it to the concentrated dry powder, mix well and let stand at room temperature for 5 minutes, then add 30 μL of hybridization enhancer, mix well and centrifuge;

[0112] e Place it on a PCR instrument and react under the following conditions.

[0113] Reagent Composition Table

[0114]

[0115] PCR Reaction Condition Table

[0116]

[0117] 5.2 Capture Elution

[0118] 5.2.1 Buffer Preheating:

[0119] Preheat the rapid binding solution and rapid wash solution 2 at 48 °C until the precipitate dissolves, preheat the rapid wash solution 1 at 63 °C until the precipitate dissolves, and equilibrate the streptavidin magnetic beads at room temperature for at least 30 min.

[0120] 5.2.2 Magnetic Bead Capture

[0121] a Vortex and mix the streptavidin magnetic beads that have been equilibrated to room temperature;

[0122] b Take 70 μL of streptavidin magnetic beads and add them to a 1.5 mL centrifuge tube;

[0123] c Add 20 μL of binding buffer, pipette to mix well, perform a short centrifugation, then place on a magnetic stand and let stand for 1 min, discard the supernatant;

[0124] d Repeat steps b and c twice, for a total of three washes of the streptavidin magnetic beads;

[0125] e Resuspend the streptavidin magnetic beads with 20 μL of binding buffer;

[0126] f Transfer 20 μL of the resuspended streptavidin magnetic beads to a hybridization reaction tube, then transfer all the liquid to a 1.5 mL centrifuge tube.

[0127] g At room temperature, mix on a mixer for 30 minutes, do not vortex;

[0128] h After mixing is complete, perform a short centrifugation, place on a magnetic stand, let stand for 1 minute, and discard the supernatant.

[0129] 5.2.3 Elution

[0130] a Add 200 μL of pre-warmed (54 °C) rapid wash buffer 1, pipette to mix well, incubate in a thermostatic metal bath at 54 °C for 5 min;

[0131] b After incubation, perform a short centrifugation, transfer all the liquid to a new 1.5 mL centrifuge tube to remove non-specific capture fragments bound to the surface of the centrifuge tube;

[0132] c Place on a magnetic stand, let stand for 1 minute, and discard the supernatant;

[0133] d Add 200 μL of pre-warmed (63 °C) wash buffer 1, pipette to mix well, incubate in a thermostatic metal bath at 54 °C for 5 minutes;

[0134] e After incubation, perform a short centrifugation, place on a magnetic stand, let stand for 1 min, and discard the supernatant;

[0135] f Add 200 μL of pre-warmed (54 °C) wash buffer 2, pipette to mix well, incubate in a thermostatic metal bath at 54 °C for 5 minutes;

[0136] g After incubation, perform a short centrifugation, place on a magnetic stand, let stand for 1 minute, and discard the supernatant;

[0137] h Repeat steps a to g twice, for a total of three washes;

[0138] i. Immediately centrifuge, discard the remaining supernatant with a 10 μL pipette tip, immediately add 45 μL of nuclease-free water, pipette to mix well, and incubate on ice.

[0139] 5.3 PCR Enrichment of Captured Products

[0140] 5.3.1 Add 22.5 μL of the captured product (streptavidin magnetic bead suspension) to the following reagents for reaction.

[0141]

[0142] Place on a PCR instrument and react under the following conditions

[0143]

[0144] 5.3.2 Purification of PCR Products

[0145] a. Equilibrate the DNA purification magnetic beads at room temperature for 30 min and mix well on a vortex mixer;

[0146] b. Prepare 80% ethanol by mixing absolute ethanol and nuclease-free water at a ratio of 8:2 for later use;

[0147] c. Add 90 μL of DNA purification magnetic beads to the ligation product respectively, pipette to mix well, incubate at room temperature for 5 minutes, place on a magnetic stand, and discard the supernatant after the solution becomes clear; wash with freshly prepared 80% ethanol and discard the supernatant, repeat this step once; air dry, elute with 32 μL of elution buffer, aspirate 30 μL of the supernatant for quality control, and sequence on the machine.

[0148] 6. Analysis of Sequencing Data:

[0149] The raw data downloaded from the machine is first used to filter out low-quality sequences (phred33 score ≤ 20), adapter sequences, and polyA / T sequences in the reads using fastQC. The filtered high-quality reads are mapped to the hg38 human genome using BSMAP, and reads with higher mapping quality are selected. After removing PCR duplicates using picard, reads mapped to the target genomic region (the region corresponding to DNA methylation markers) are selected using samtools, and the methylation levels of each DNA methylation marker are calculated.

[0150] The detection performance of the determined methylation markers and the composition in differentiating liver cancer tissues from non-cancerous tissues is as follows in the table:

[0151] Methylation Marker Specificity Sensitivity chr17: 30970241 - 30970741 0.918 0.909

[0152] Example 3: Detection Performance of the Screened Markers in Blood Samples of Liver Cancer

[0153] A total of 414 clinical blood samples were collected, including blood samples from 218 patients with primary liver cancer, blood samples from 173 patients with benign liver diseases, and blood samples from 23 healthy individuals. The free DNA was extracted, methylated, and targeted methylation sequencing was performed on the blood samples according to the method described in Example 2, and the methylation levels of each methylation marker were calculated.

[0154] Statistical results of blood samples

[0155]

[0156]

[0157] Univariate statistical analysis was performed on a single methylation marker to calculate the detection performance of in vitro blood samples for differentiating liver cancer patients and the control group. The sensitivity and specificity of the determined methylation markers for liver cancer detection are as follows:

[0158] Methylation Marker Specificity Sensitivity chr17: 30970241 - 30970741 0.903 0.835

[0159] As Figure 2 shown, the AUC value of the determined methylation marker for methylation sequencing detection of in vitro blood samples of liver cancer is 0.932.

[0160] Example 4: Performance of the determined methylation markers in the qPCR detection dataset of in vitro blood samples of liver cancer

[0161] This example provides a diagnostic reagent for primary liver cancer, specifically comprising the following nucleic acid combinations for detecting CpG methylation in the gene region of chr17: 30970241-30970741: Nucleic acid combination 1, Nucleic acid combination 2, Nucleic acid combination 3, and Nucleic acid combination 4.

[0162] Target region and primer-probe: The PCR detection region and the corresponding detection primer-probes are as follows:

[0163] Region 1: chr17: 30970270-30970355, and the primer-probe nucleic acid combination 1 is as follows:

[0164] F-01: 5’-GCGTTTAGGATTGGGATGCG-3’ (SEQ ID NO.1)

[0165] R-01: 5’-CCAACAAACACTCGAACAAAA-3’ (SEQ ID NO.2)

[0166] P-01: 5’-AGTGAGTTTTTTTAGGAAAATATT-3’ (SEQ ID NO.3)

[0167] Region 2: chr17: 30970348 - 30970428, the primer - probe nucleic acid combination 2 is as follows:

[0168] F - 02: 5’ - TTTGTTGGGAAACGCGTTTA - 3’(SEQ ID NO.4)

[0169] R - 02: 5’ - TTTTAACTCGCAAATATAAT - 3’(SEQ ID NO.5)

[0170] P - 02: 5’ - AAGGCGGTAAGGATATAGCG - 3’(SEQ ID NO.6)

[0171] Region 3: chr17: 30970452 - 30970550, the primer - probe nucleic acid combination 3 is as follows:

[0172] F - 03: 5’ - ATGTTCGGTTTCGTTCG - 3’(SEQ ID NO.7)

[0173] R - 03: 5’ - CTTAAATACGCGTCAAAATC - 3’(SEQ ID NO.8)

[0174] P - 03: 5’ - TGGAGTACGGGTATTTTGTAA - 3’(SEQ ID NO.9)

[0175] Region 4: chr17: 30970505 - 30970451, the primer - probe nucleic acid combination 4 is as follows:

[0176] F - 04: 5’ - TCGTTCGTTGGTTTAAAAAAA - 3’(SEQ ID NO.10)

[0177] R - 04: 5’ - ACACTTCGTAAACTCATTC - 3’(SEQ ID NO.11)

[0178] P - 04: 5’ - AAGATGTAATATCGATAATTT - 3’(SEQ ID NO.12)

[0179] Internal standard, β - actin gene, the primer - probe nucleic acid combination is as follows:

[0180] b - actin - F01: 5’ - GTGATGGAGGAGGTTTAGTAAGTT - 3’(SEQ ID NO.13)

[0181] b-actin-R01: 5’-ACCACCACCCAACACACAATAACAAACACA-3’ (SEQ ID NO.14)

[0182] b-actin-P01: 5’-CCAATAAAACCTACTCCTCCCTTAA-3’ (SEQ ID NO.15)

[0183] A total of 79 clinical blood samples were collected in this experiment, including 32 blood samples from patients with primary liver cancer, 32 blood samples from patients with benign liver diseases, and 15 blood samples from healthy individuals.

[0184] Sample Group Sample Type Detection Object Number of Samples Detection Method Hepatocellular Carcinoma Blood Sample Cell - free DNA 32 qPCR Method Benign Liver Disease Blood Sample Cell - free DNA 32 qPCR Method Healthy Individuals Blood Sample Cell - free DNA 15 qPCR Method

[0185] The above 79 collected blood samples were subjected to methylation quantitative qPCR detection, and the Ct values of the qPCR detection were recorded. The specific experimental steps are as follows:

[0186] 1. Plasma separation: First, centrifuge the collected 10 mL clinical blood sample at 1600×g for 10 minutes to separate the plasma. Then, centrifuge the separated plasma at 16000×g for 10 minutes to separate impurities. The plasma sample after separating and purifying impurities should be stored at -80 °C in the refrigerator for later use.

[0187] 2. Extraction of cell-free DNA: Use the "Cell-free DNA Extraction Kit" (product number: C03-2) of Guangzhou Youze Biotechnology Co., Ltd. to extract cell-free DNA from the separated plasma sample.

[0188] 3. Conversion of cell-free DNA: Use the "EZ-96 DNA Methvlation-Lightning MagPrep" of ZYMO company to perform methylation C->T conversion on the extracted cell-free DNA sample.

[0189] 4. Negative and positive controls for methylation quantitative PCR: The negative control is the genomic DNA of the cell line (cell line: QSG-7701) after being converted by the ZYMO kit, with a concentration of 1 ng / μL. After conversion, all C's in the negative control become T. The positive control is the genomic DNA of the cell line (cell line: HepG2) after being bisulfite-converted by the ZYMO kit, with a concentration of 1 ng / μL. After conversion of the positive control, the C at the methylated CpG positions does not change, while the C at other positions becomes T.

[0190] 5. Reaction system for methylation quantitative PCR:

[0191] Component Concentration Volume (μL) Target Site - Forward Primer F 10μM 1 Target Site - Fluorescent Probe P 10μM 0.5 Target Site - Reverse Primer R 10μM 1 Internal Standard Site - Forward Primer F 10μM 1 Internal Standard Site - Fluorescent Probe P 10μM 0.5 Internal Standard Site - Reverse Primer R 10μM 1 Reaction Buffer 10X 2.5 DNA Polymerase 5U / μL 1 dNTPs 2.5mM 2 Test Cell - free DNA Approximately 1ng / μL 4 Water / 5.5 Total / 20

[0192] 6. Reaction program for methylation quantitative PCR:

[0193]

[0194] 7. Detection on the instrument: Mix the DNA sample to be detected, negative reference, and positive reference well according to the reaction system of methylation quantitative PCR in step 5. Put the sample into the Shanghai Hongshi SLAN-96S quantitative PCR instrument, and after setting the quantitative PCR instrument according to the program conditions in step 6, conduct the detection, and collect the fluorescence values of each channel of HEX / ROX / FAM / CY5.

[0195] 8. Result recording: After the methylation quantitative PCR reaction is completed, set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of the sample to be detected at the methylation site to be detected.

[0196] 9. Quality control: Synchronously detect the negative reference and positive reference during each detection. The negative control is the genomic DNA of the transformed cells containing the β-actin gene and the low-methylated target gene sequence (cell line: QSG-7701), and the positive control is the cfDNA of the transformed cells containing the β-actin gene and the high-methylated target gene sequence (cell line: HepG2), and the concentration of both is 1 ng / μL. When the following conditions are met: no amplification in the negative reference, the Ct value of the positive reference is between 28 and 32, and the Ct value of the internal reference gene is less than 38, this experiment is valid and the determination of the sample results in the next step can be carried out. Otherwise, the result is invalid and the detection must be carried out again.

[0197] 10. Result determination: If the Ct value of the target marker is less than 35, the detection result is positive; otherwise, the detection result is negative.

[0198] Use the Ct values obtained from qPCR detection of the designed primer-probe combination in ex vivo blood samples to distinguish liver cancer and non-cancer samples. The detection performance is as follows in the table,

[0199]

[0200] It can be seen from the blood qPCR detection results that the liver cancer detection performances of different primer-probe combinations designed for the chr17: 30970241-30970741 marker are similar, with a specificity of 91.5% and a sensitivity of 84.4 - 87.5%. Compared with traditional liver cancer screening methods, the detection performance of this single methylation marker is ideal, easy to use, and has a low cost, which is of great significance for the popularization and promotion of early screening and treatment of liver cancer.

[0201] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a molecular marker methylation level detection reagent in the preparation of a primary hepatocellular carcinoma detection product, characterized in that: The molecular marker is a CpG methylation site in the chr17:30970241-30970741 genomic region; The genomic region is from the hg38 human reference genome; The molecular marker is located in the following region containing a CpG site: The area 1, area 2, area 3, area 4; The region 1 is chr17: 30970270-30970355, the region 2 is chr17: 30970348-30970428, the region 3 is chr17: 30970452-30970550, and the region 4 is chr17: 30970629-30970741; The detection reagents include a nucleic acid combination 1 for detecting the region 1, a nucleic acid combination 2 for detecting the region 2, a nucleic acid combination 3 for detecting the region 3, and a nucleic acid combination 4 for detecting the region 4; The nucleic acid combination 1 includes a primer combination 1, the nucleic acid combination 2 includes a primer combination 2, the nucleic acid combination 3 includes a primer combination 3, and the nucleic acid combination 4 includes a primer combination 4; The base sequences of the primer combinations 1-4 are shown in SEQ ID NOs. 1-2, 4-5, 7-8, and 10-11, respectively; The nucleic acid combination 1 further includes probe 1, the nucleic acid combination 2 further includes probe 2, the nucleic acid combination 3 further includes probe 3, and the nucleic acid combination 4 further includes probe 4; The base sequences of the probes 1-4 are shown in SEQ ID NOs. 3, 6, 9 and 12 respectively.

2. An application according to claim 1, characterized in that: The detection product is any one of a detection reagent, a detection kit, a detection chip and a sequencing library.

3. An application according to claim 2, characterized in that: The methylation level of the molecular marker is detected by any one of the following methods: MSP method, high-throughput sequencing method, methylation-specific high-performance liquid chromatography method, ddPCR method, methylation-specific high-resolution melting curve method, methylation-specific microarray method, methylation-sensitive restriction endonuclease method and Methylight method; The high-throughput sequencing method includes bisulfite sequencing, whole genome methylation sequencing or sequencing by synthesis.

Images