A molecular marker related to the oxidation ability of Tibetan sheep and its application

Abstract

The present invention belongs to the technical field of molecular biology detection, and particularly relates to a molecular marker related to the oxidation ability of Tibetan sheep and its application. The present invention screens out an SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 33,589,883rd base on chromosome 11 of the international sheep genome version Oar_v4.0, and the mutated base is C or T. Using this SNP molecular marker, the contents of ROS and MDA in Tibetan sheep individuals can be detected, providing a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, providing a basis for screening Tibetan sheep with strong antioxidant stress ability, and providing a new direction for the assisted breeding of Tibetan sheep.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology detection, and particularly relates to a molecular marker related to the oxidation ability of Tibetan sheep and its application. Background Art

[0002] Tibetan sheep is an important part of the grassland animal husbandry in the alpine pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau region are: high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, etc. Due to the harsh environment in the Qinghai-Tibet Plateau region, a series of non-specific reactions of Tibetan sheep will be caused, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one. After being stimulated by stressors, the dynamic balance of the oxidation system and antioxidant system in the body of Tibetan sheep is damaged, the contents of reactive oxygen species (ROS) and malondialdehyde (MDA) increase, the content of antioxidants decreases, and the body will be oxidatively damaged, thus affecting the growth performance and reproductive performance of Tibetan sheep.

[0003] Reactive oxygen species (ROS) and malondialdehyde (MDA) are important indicators in the detection of oxidative stress reactions. By detecting the contents of reactive oxygen species (ROS) and malondialdehyde (MDA), the oxidative stress ability and health status of Tibetan sheep can be evaluated. By detecting the indicators of antioxidant stress, the oxidative stress response ability of Tibetan sheep can be found in time, and certain measures can be taken to improve its oxidative stress ability, so that it can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, providing a basis for the assisted breeding of Tibetan sheep.

[0004] With the rapid development of molecular marker technology, searching for variant sites in genes at the gene level, discovering the relationship between genes and traits through the association analysis between them, and conducting early selection, so as to improve the selection efficiency and accuracy, can fundamentally improve the oxidative stress ability of Tibetan sheep, and has broad application value. Therefore, molecular markers lay a foundation for people to study the genetic mechanism of the oxidative stress ability of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in the breeding of Tibetan sheep is an important issue in this field. There are not many studies on using molecular markers related to the oxidative stress ability of Tibetan sheep for assisted breeding in the prior art. It is particularly important to provide a molecular marker related to the oxidative stress ability of Tibetan sheep, so as to be used in the molecular marker-assisted breeding of Tibetan sheep and screen Tibetan sheep with strong antioxidant stress ability. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker related to the oxidation ability of Tibetan sheep and its application.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides an SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 33,589,881st base on chromosome 11 of the international sheep genome version Oar_v4.0, and the mutated base is C or T.

[0008] Preferably, the genotype of Tibetan sheep with the mutated base C is CC or CT;

[0009] The genotype of Tibetan sheep with the mutated base T is TT;

[0010] The content of reactive oxygen species, an antioxidant stress index, in Tibetan sheep individuals with the genotype TT is significantly higher than that in Tibetan sheep individuals with the genotypes CC and CT;

[0011] The content of reactive oxygen species, an antioxidant stress index, in Tibetan sheep individuals with the genotype CT is significantly higher than that in Tibetan sheep individuals with the genotype CC;

[0012] The content of malondialdehyde, an antioxidant stress index, in Tibetan sheep individuals with the genotypes TT and CT is significantly higher than that in Tibetan sheep individuals with the genotype CC;

[0013] There is no significant difference in the content of malondialdehyde, an antioxidant stress index, between Tibetan sheep individuals with the genotypes TT and CT.

[0014] The present invention also provides the application of the said SNP molecular marker in marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0015] The present invention also provides the application of the said SNP molecular marker in the assisted breeding of Tibetan sheep.

[0016] The present invention also provides a primer pair for amplifying the said SNP, and the primer pair is shown as SEQ ID NO.2 - 3.

[0017] The present invention also provides the application of the said primer pair in the preparation of products for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0018] The present invention also provides the application of the said primer pair in the preparation of products for the assisted breeding of Tibetan sheep.

[0019] The present invention also provides a method for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, including the following steps:

[0020] (1) Extract the genomic DNA of Tibetan sheep;

[0021] (2) Using the genomic DNA of Tibetan sheep obtained in step (1) as a template, amplify with the said primer pair to obtain an amplification product;

[0022] (3) Perform genotype analysis on the amplified product to obtain Tibetan sheep of different genotypes; correlate the genotype of Tibetan sheep with antioxidant stress indicators;

[0023] The antioxidant stress indicators include reactive oxygen species and / or malondialdehyde.

[0024] Preferably, the amplification system in step (2) is: 22 μL of GoldMix (green), 1 μL each of the upstream and downstream primers, and 1 μL of template DNA;

[0025] The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, a total of 40 cycles; 72°C for extension for 2 min.

[0026] The present invention also provides a kit for marker-assisted selection of antioxidant stress traits of Tibetan sheep and / or assisted breeding of Tibetan sheep for non-diagnostic purposes, including reagents for detecting the SNP molecular markers or the primer pairs.

[0027] The present invention provides a molecular marker related to the oxidation ability of Tibetan sheep and its application. The SNP molecular marker of the present invention is located at the 33,589,881st base on chromosome 11 of the international sheep genome version Oar_v4.0; when the 33,589,881st base on the chromosome is C, the genotype of Tibetan sheep is CC or CT; when the 33,589,881st base on the chromosome is T, the genotype of Tibetan sheep is TT; through the correlation analysis of different genotypes with the antioxidant stress indicators ROS and MDA contents, it is found that the antioxidant stress indicator ROS of Tibetan sheep individuals with the TT genotype is significantly higher than that of CC and CT genotype individuals (p<0.05), and the antioxidant stress indicator ROS of Tibetan sheep individuals with the CT genotype is significantly higher than that of CC genotype individuals (p<0.05); the antioxidant stress indicator MDA of Tibetan sheep individuals with the TT and CT genotypes is significantly higher than that of CC genotype individuals (p<0.05), and there is no significant difference in the antioxidant stress indicator MDA between Tibetan sheep individuals with the TT and CT genotypes (p>0.05). By detecting the base at the 33,589,881st nucleotide site on chromosome 11 of Tibetan sheep, the contents of antioxidant stress indicators ROS and MDA of Tibetan sheep individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, provides a basis for screening Tibetan sheep with strong antioxidant stress ability, and provides a new direction for the assisted breeding of Tibetan sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the amplified product of the SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of replicates;

[0029] Figure 2 The peak map and sequence obtained after purification and sequencing of the PCR amplification product. Detailed implementation manners

[0030] The present invention provides an SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 33,589,881st base on chromosome 11 of the international sheep genome version Oar_v4.0, and the mutated base is C or T.

[0031] In the present invention, the genotype of Tibetan sheep with the mutated base C is CC or CT;

[0032] The genotype of Tibetan sheep with the mutated base T is TT;

[0033] In Tibetan sheep individuals with the genotype TT, the content of reactive oxygen species, an antioxidant stress index, is significantly higher than that in Tibetan sheep individuals with the genotypes CC and CT;

[0034] In Tibetan sheep individuals with the genotype CT, the content of reactive oxygen species, an antioxidant stress index, is significantly higher than that in Tibetan sheep individuals with the genotype CC;

[0035] In Tibetan sheep individuals with the genotypes TT and CT, the content of malondialdehyde, an antioxidant stress index, is significantly higher than that in Tibetan sheep individuals with the genotype CC;

[0036] There is no significant difference in the content of malondialdehyde, an antioxidant stress index, between Tibetan sheep individuals with the genotypes TT and CT.

[0037] The present invention also provides the application of the described SNP molecular marker in marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0038] The present invention also provides the application of the described SNP molecular marker in the assisted breeding of Tibetan sheep.

[0039] The present invention also provides a primer pair for amplifying the described SNP. The primer pair is shown as SEQ ID NO.2 to 3.

[0040] SEQ ID NO.2 is the upstream primer, and the specific sequence is 5'- CTGCCTTACCCAGCCAGTACTCC -3'; SEQ ID NO.3 is the downstream primer, and the specific sequence is 5'- GGCGTGTACCTCATCTACCCCTC -3'. The primer pair of the present invention was synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0041] The length of the amplified fragment obtained by amplifying with the primer pair is 605 bp, specifically as shown in SEQ ID NO.1: CTGCCTTACCCAGCCAGTACTCCCCGTCAGCCCGGCCAAAGCCCAGCTTGTAGTCATTCCAGCCCCGGAAGAAGCTCACTGAGCCGTTGAATCTCTTCTGGAAAACCTGGAGCAGAGAGGGTGGGCCTGGGTGCCTGAGGGGCTGGGGGCAGTGCCCTCACCCAGGCACAGACCCTGTGAGGCTAAGGTGGTTTGTGAAAGGACCAAGTGGGGGCCAAGAGGAGGTGCGTGCTGGCCCCGGGGGCAAGAGCAGGTGGAGGGAGCCGGCGGGCTGGAGTTCAGGCACCTGGGGTGGAGTCTGGCACTGGCTGTGTGACTTGGGCAAGTTATTGCACCTCTCTGGGCTCCAGACTGTCATTTGTAAGGGGCACCTTGCTCCCAGGGTTATGGTGCGATGCAGTGCAGCCCCTAACCTACCTTAGGTGCCTAGTGTTTGGGGGTGGTGGCGCTCCACACACTGCTGTGAGCATCGTCCCAGGCTCACAGCCATGCAATGTGCCCCCTGTCCCCCCTCCACTCACCGTCCACTTCCCGCCCTCCGTGGTCATGTCGCAGAAGACAGGCACGGGCACGCTGGGGCCTGAGGGGTAGATGAGGTACACGCC。

[0042] The mutation site is located at the 330th position of SEQ ID NO.1.

[0043] The present invention also provides the application of the primer pair in the preparation of products for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes.

[0044] The present invention also provides the application of the primer pair in the preparation of products for the assisted breeding of Tibetan sheep.

[0045] The present invention also provides a method for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, comprising the following steps:

[0046] (1) Extract the genomic DNA of Tibetan sheep;

[0047] (2) Using the Tibetan sheep genomic DNA obtained in step (1) as a template, amplify using the primer pair described above to obtain an amplification product;

[0048] (3) Perform genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; correlate the genotypes of Tibetan sheep with antioxidant stress indicators;

[0049] The antioxidant stress indicators include reactive oxygen species and / or malondialdehyde.

[0050] In the present invention, the amplification system in step (2) is: 22 μL of GoldMix (green), 1 μL each of the upstream and downstream primers, and 1 μL of template DNA;

[0051] The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; 72°C for extension for 2 min.

[0052] The present invention also provides a kit for marker-assisted selection of antioxidant stress traits in Tibetan sheep and / or Tibetan sheep assisted breeding for non-diagnostic purposes, including reagents for detecting the SNP molecular markers described above or the primer pair.

[0053] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention. Example 1

[0054] 1 Sample collection

[0055] The samples were from Tibetan sheep populations under natural grazing conditions, including 68 from Gannan Tibetan Autonomous Prefecture, Gansu Province, 64 from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 61 from Shigatse City, Tibet Autonomous Region. 5 mL of fasting Tibetan sheep blood samples were collected in clean coagulant vacuum blood collection tubes, left standing for 30 min, then centrifuged at 3500 r / min for 15 min, and the supernatant was aspirated into a clean PE tube, sealed and stored in a -20°C low-temperature refrigerator; another 5 mL of blood samples were added to blood collection tubes containing EDTA-K2 anticoagulant, quickly mixed after blood sample collection, placed in a sampling box with ice packs for temporary storage, and frozen in a -20°C refrigerator after being transported back to the laboratory for genomic DNA extraction.

[0056] 2 Main reagents and instruments

[0057] The EDTA-K2 vacuum blood collection tube was purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific Company in the United States; the DL2000 Marker, agarose, and nucleic acid dye were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; the GoldMix (green) was purchased from Beijing Tsingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; the PCR instrument was purchased from BioRad Company. The detection kits for reactive oxygen species ROS (E004-1-1) and malondialdehyde MDA (A003-1-2) were purchased from Nanjing Jiancheng Bioengineering Institute.

[0058] 3 Methods

[0059] 3.1 Detection of ROS and MDA in Serum

[0060] According to the ROS detection kit of Nanjing Jiancheng Bioengineering Institute, the DCFH-DA probe was used for determination. The determination steps were as follows: (1) Add 190 μL of serum and 10 μL of 1 mmol / L DCFH-DA solution (the final concentration of DCFH-DA was 50 μmol / L) to a 96-well microplate, and pipette and mix well with a micropipette; (2) Place it in a microplate reader, incubate at 37 °C for 30 min, and then detect the fluorescence intensity at an excitation wavelength of 485 nm and an emission wavelength of 538 nm; (3) Take 50 μL of serum, dilute it 30 times, and take 100 μL for protein quantification; (4) The results were expressed as fluorescence intensity / milligram of protein.

[0061] According to the MDA detection kit of Nanjing Jiancheng Bioengineering Institute, the TBA method was used for determination. The determination steps were as follows: (1) Add 0.2 mL of absolute ethanol and 0.2 mL of reagent one to the blank tube, add 0.2 mL of 10 nmol / mL standard product and 0.2 mL of reagent one to the standard tube, add 0.2 mL of the serum to be tested and 0.2 mL of reagent one to the determination tube, and add 0.2 mL of the serum to be tested and 0.2 mL of reagent one to the control tube, and shake and mix well; (2) Add 3 mL of reagent two and 1 mL of reagent three to the blank tube, standard tube, and determination tube, add 3 mL of reagent two and 1 mL of 50% glacial acetic acid to the control tube, vortex and mix well, then incubate in a water bath at 95 °C for 40 min, take it out, cool it with running water, and centrifuge at 4000 r / min for 10 min; (3) Take the supernatant and measure the absorbance value of each tube at 532 nm; (4) Calculate the MDA content according to the formula provided in the kit instruction manual.

[0062] 3.2 Extraction of Blood Genomic DNA

[0063] Use the blood genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract genomic DNA from blood samples. Place the extracted DNA under an ultraviolet spectrophotometer to detect the concentration and purity. A concentration > 20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 meet the experimental requirements, and store it at -20°C for future use.

[0064] 3.3 Primer design

[0065] Refer to the gene sequence of chromosome 11 in the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019468.2), and use primer premier5.0 software to design a pair of specific primers. The nucleotides of the primer pair are shown in SEQ ID NO.2~3. SEQ ID NO.2 is the upstream primer, and its sequence is: 5'- CTGCCTTACCCAGCCAGTACTCC -3'; SEQ ID NO.3 is the downstream primer, and the sequence is: 5'- GGCGTGTACCTCATCTACCCCTC -3'.

[0066] The amplified fragment length is 605 bp, and the primers are synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0067] 3.4 PCR amplification and sequencing

[0068] The PCR amplification system is 25 μL: 22 μL of GoldMix (green), 1 μL of each upstream and downstream primer, and 1 μL of template DNA.

[0069] The PCR amplification program: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, a total of 40 cycles; 72°C for extension for 2 min.

[0070] The PCR products are detected by 1.5% agarose gel electrophoresis. After the PCR products are qualified by agarose gel electrophoresis, direct sequencing is used for sequencing, which is completed by Beijing Tsingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, and the SNP marker is located at position 330 of the nucleotide sequence shown in SEQ ID NO.1.

[0071] Use the biological analysis software MEGA 6.0 to compare the sequencing results of the PCR products, analyze the sequencing peak map, and complete the genotyping.

[0072] SEQ ID NO.1: CTGCCTTACCCAGCCAGTACTCCCCGTCAGCCCGGCCAAAGCCCAGCTTGTAGTCATTCCAGCCCCGGAAGAAGCTCACTGAGCCGTTGAATCTCTTCTGGAAAACCTGGAGCAGAGAGGGTGGGCCTGGGTGCCTGAGGGGCTGGGGGCAGTGCCCTCACCCAGGCACAGACCCTGTGAGGCTAAGGTGGTTTGTGAAAGGACCAAGTGGGGGCCAAGAGGAGGTGCGTGCTGGCCCCGGGGGCAAGAGCAGGTGGAGGGAGCCGGCGGGCTGGAGTTCAGGCACCTGGGGTGGAGTCTGGCACTGGCTGTGTGACTTGGGCAAGTTATTGCACCTCTCTGGGCTCCAGACTGTCATTTGTAAGGGGCACCTTGCTCCCAGGGTTATGGTGCGATGCAGTGCAGCCCCTAACCTACCTTAGGTGCCTAGTGTTTGGGGGTGGTGGCGCTCCACACACTGCTGTGAGCATCGTCCCAGGCTCACAGCCATGCAATGTGCCCCCTGTCCCCCCTCCACTCACCGTCCACTTCCCGCCCTCCGTGGTCATGTCGCAGAAGACAGGCACGGGCACGCTGGGGCCTGAGGGGTAGATGAGGTACACGCC。

[0073] 4 Statistical Analysis

[0074] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g33589881C>T gene, and the polymorphism information content (PIC) was calculated using the PIC (polymorphism information content) calculation software. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the antioxidant stress indices ROS and MDA, and the results were expressed as "mean ± standard error".

[0075] 5 Results

[0076] 5.1 PCR Amplification and Sequencing Results

[0077] The amplification products of the g33589881C>T SNP locus on chromosome 11 of Tibetan sheep were detected using 1.5% agarose gel (see Figure 1 ). The bands were clear without background bands, showing good specificity. The size of the PCR product fragment was 605 bp, which was consistent with the expected size, and the next experiment could be carried out.

[0078] The peak maps and sequences obtained after purification and sequencing of the PCR products are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g33589881C>T SNP locus, and there were three genotypes: CC, CT, and TT.

[0079] 5.2 Statistical analysis results

[0080] The genotypes and allele frequencies of the g33589881C>T SNP locus on chromosome 11 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g33589881C>T SNP locus, the CC genotype frequency was the highest, being the dominant genotype, and the C allele frequency was 93.0%, showing the dominant allele. The χ2 goodness-of-fit test indicated that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.150, and the PIC was 0.122, with PIC<0.25, belonging to low polymorphism.

[0081]

[0082] 5.3 Correlation analysis of antioxidant stress indices reactive oxygen species (ROS) and malondialdehyde (MDA) in different genotypes

[0083] The general linear model in IBM SPSS Statistics 22 software was used to analyze the correlation between different genotypes of Tibetan sheep and the contents of antioxidant stress indices ROS and MDA. The results showed that the antioxidant stress index ROS of Tibetan sheep individuals with the TT genotype was significantly higher than that of CC and CT genotype individuals (p<0.05), and the antioxidant stress index ROS of Tibetan sheep individuals with the CT genotype was significantly higher than that of CC genotype individuals (p<0.05); the antioxidant stress index MDA of Tibetan sheep individuals with the TT and CT genotypes was significantly higher than that of CC genotype individuals (p<0.05), and there was no significant difference in the antioxidant stress index MDA between Tibetan sheep individuals with the TT and CT genotypes (p>0.05). The results indicated that the base at the g33589881C>T SNP locus on chromosome 11 of Tibetan sheep was significantly correlated with ROS and MDA in Tibetan sheep, and it was an SNP marker related to ROS and MDA in Tibetan sheep. The results are shown in Table 2.

[0084]

[0085] The present invention provides an SNP molecular marker for detecting the oxidative stress ability of Tibetan sheep and its application. The SNP molecular marker of the present invention is located at the 33,589,881st base on chromosome 11 of the international sheep genome version Oar_v4.0; the mutation type is C / T, named g33589881C>T, and there are three genotypes. When the 33,589,881st base on chromosome 11 is C, the genotype of Tibetan sheep is CC or CT; when the 33,589,881st base on chromosome 11 is T, the genotype of Tibetan sheep is TT; through the correlation analysis of different genotypes with the antioxidant stress indexes ROS and MDA contents, it is found that the antioxidant stress index ROS of Tibetan sheep individuals with the TT genotype is significantly higher than that of CC and CT genotype individuals (p<0.05), and the antioxidant stress index ROS of Tibetan sheep individuals with the CT genotype is significantly higher than that of CC genotype individuals (p<0.05); the antioxidant stress index MDA of Tibetan sheep individuals with the TT and CT genotypes is significantly higher than that of CC genotype individuals (p<0.05), and there is no significant difference in the antioxidant stress index MDA between Tibetan sheep individuals with the TT and CT genotypes (p>0.05). By detecting the base at the 33,589,881st nucleotide site on chromosome 11 of Tibetan sheep, the contents of the antioxidant stress indexes ROS and MDA of Tibetan sheep individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of the antioxidant stress trait of Tibetan sheep for non-diagnostic purposes, provides a basis for screening Tibetan sheep with strong antioxidant stress ability, and provides a new direction for the assisted breeding of Tibetan sheep.

[0086] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Application of reagents for detecting SNP molecular markers in marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes; The SNP molecular marker is located at the 33589881st base on chromosome 11 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype TT was significantly higher than that in Tibetan sheep with genotype CC and CT. The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype CT was significantly higher than that in Tibetan sheep with genotype CC. The content of malondialdehyde, an anti-oxidative stress index, in Tibetan sheep with genotypes TT and CT was significantly higher than that in Tibetan sheep with genotype CC. There was no significant difference in the content of malondialdehyde, an anti-oxidative stress index, between Tibetan sheep with genotypes TT and CT. The reagent for detecting SNP molecular markers is a primer pair shown in SEQ ID NO.2~3.

2. Application of primer pairs in the preparation of marker-assisted selection products for the antioxidant stress resistance traits of Tibetan sheep for non-diagnostic purposes; The primer pair is shown in SEQ ID NO.2-3; The primer pair is used to detect SNP molecular markers; The SNP molecular marker is located at the 33589881st base on chromosome 11 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype TT was significantly higher than that in Tibetan sheep with genotype CC and CT. The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype CT was significantly higher than that in Tibetan sheep with genotype CC. The content of malondialdehyde, an anti-oxidative stress index, in Tibetan sheep with genotypes TT and CT was significantly higher than that in Tibetan sheep with genotype CC. There was no significant difference in the content of malondialdehyde, an anti-oxidative stress indicator, between Tibetan sheep with genotypes TT and CT.

3. Application of primer pairs in the preparation of marker-assisted breeding products for the antioxidant stress trait of Tibetan sheep; The primer pair is shown in SEQ ID NO.2-3; The primer pair is used to detect SNP molecular markers; The SNP molecular marker is located at the 33589881st base on chromosome 11 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype TT was significantly higher than that in Tibetan sheep with genotype CC and CT. The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype CT was significantly higher than that in Tibetan sheep with genotype CC. The content of malondialdehyde, an anti-oxidative stress index, in Tibetan sheep with genotypes TT and CT was significantly higher than that in Tibetan sheep with genotype CC. There was no significant difference in the content of malondialdehyde, an anti-oxidative stress indicator, between Tibetan sheep with genotypes TT and CT.

4. A method for marker-assisted selection of antioxidant stress traits in Tibetan sheep for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Tibetan sheep genomic DNA; (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, amplifying using a primer pair to obtain an amplified product; (3) performing genotyping analysis on the amplified product to obtain Tibetan sheep with different genotypes; and correlating the genotype of the Tibetan sheep with an anti-oxidative stress index; The anti-oxidative stress index includes reactive oxygen species and / or malondialdehyde; The primer pair is shown in SEQ ID NO.2-3; The product obtained by amplification of the primer pair contains a SNP molecular marker; The SNP molecular marker is located at the 33589881st base on chromosome 11 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; According to the molecular marker alleles, Tibetan sheep have three genotypes: CC, CT or TT; The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype TT was significantly higher than that in Tibetan sheep with genotype CC and CT. The content of reactive oxygen species, an indicator of anti-oxidative stress, in Tibetan sheep with genotype CT was significantly higher than that in Tibetan sheep with genotype CC. The content of malondialdehyde, an anti-oxidative stress index, in Tibetan sheep with genotypes TT and CT was significantly higher than that in Tibetan sheep with genotype CC. There was no significant difference in the content of malondialdehyde, an anti-oxidative stress indicator, between Tibetan sheep with genotypes TT and CT.

Images