A trametes versicolor and a culture method and application thereof

By screening the YH-DB-1 strain of *Trametes versicolor* and using liquid fermentation culture, the problem of low *Trametes versicolor* glycopeptide content was solved, achieving efficient production of high-content *Trametes versicolor* glycopeptides that meet pharmaceutical standards.

CN118909795BActive Publication Date: 2026-06-23SHANDONG YUANHE BIOENGINEERING CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANDONG YUANHE BIOENGINEERING CO LTD
Filing Date
2024-09-05
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The content of glycopeptides in existing technologies is low, wild resources are scarce, and traditional solid-state fermentation culture is inefficient and costly, making it difficult to meet pharmaceutical standards.

Method used

The *Trametes versicolor* strain YH-DB-1 was screened out and cultured using liquid fermentation. High-content *Trametes versicolor* glycopeptides were prepared, with the peptide content in the mycelial extract reaching over 45%, meeting national pharmaceutical standards.

Benefits of technology

This method enables the efficient production of Yunzhi glycopeptides, with a peptide content of over 45%, meeting national pharmaceutical standards. It solves the problem of low peptide content in traditional methods and improves production efficiency and yield.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to the technical field of microbial fermentation, in particular to a polyporus arctorus and a culture method and application thereof. A polyporus arctorus YH-DB-1 is screened in the present application, and a large amount of glycopeptide can be extracted from the mycelium of the strain by culturing the strain, the peptide content in the glycopeptide can reach more than 45%, and the present application solves the problem of low peptide yield in the existing polyporus arctorus glycopeptide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, specifically to a *Geobacillus yunnanensis* strain, its cultivation method, and its applications. Background Technology

[0002] Trametes versicolor, also known as Yunzhi Cork Fungus, is taxonomically classified as belonging to the kingdom Fungi, phylum Basidiomycota, class Agaricomycetes, order Polyporaceae, family Polyporaceae, and genus Trametes. Some literature classifies it under the genus Trametes. Trametes versicolor is a wood-rotting medicinal fungus. One of the main active ingredients in the extract of Trametes versicolor fruiting bodies is glycopeptide, which possesses pharmacological activities such as enhancing immunity, regulating and protecting the functions of various organs in the human body, and assisting in cancer treatment, making it an important raw material for pharmaceuticals. However, current research both domestically and internationally shows that the peptide content in the extracted glycopeptides is generally low, mostly below 20%, failing to meet relevant pharmaceutical standards.

[0003] The main reasons for the low peptide content in *Trametes versicolor* glycopeptides are twofold: firstly, wild resources are increasingly scarce, and various environmental factors have led to many glycopeptides failing to meet the peptide content requirements stipulated in the National Pharmacopoeia; secondly, there is a lack of dominant strains of *Trametes versicolor* glycopeptides. Furthermore, traditional production methods mostly involve solid-state fermentation to collect *Trametes versicolor* mycelium for peptide extraction. This method is not only costly and inefficient, but also results in low yields and long production cycles. Summary of the Invention

[0004] To address the aforementioned problems, the main objective of this invention is to provide a *Trametes versicolor* strain, its cultivation method, and its applications. This invention screened and obtained a *Trametes versicolor* strain YH-DB-1. By culturing this strain, a large amount of glycopeptides can be extracted from its mycelium, with a peptide content exceeding 45%. This invention solves the problem of low peptide yield in existing *Trametes versicolor* glycopeptides.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] This invention provides a strain of *Trametes versicolor*, which is classified and named *Trametes versicolor* (…). Trametes versicolor YH-DB-1 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41418.

[0007] Furthermore, the nucleotide sequence of the ITS region of the rRNA gene of *Trametes versicolor* YH-DB-1 is shown in SEQ ID NO. 1.

[0008] Furthermore, the peptide content in the mycelial extract of *Geobacillus yunnanensis* YH-DB-1 is ≥45%.

[0009] This invention also provides a method for culturing the above-mentioned *Trametes versicolor*, the method comprising the following steps:

[0010] (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into an agar slant culture medium and culture at 25-30℃ for 2-6 days to obtain an activated strain;

[0011] (2) Inoculate the activated strain into seed culture medium and culture at 25-30℃ and 150-200 rpm for 24-120 h to obtain seed liquid;

[0012] (3) Inoculate the seed liquid into the liquid fermentation medium and incubate at 25~30℃ for 60~120h.

[0013] Furthermore, the slant culture medium is a solid PDA culture medium.

[0014] Furthermore, the seed culture medium is composed of the following components by mass percentage: 1.0%~5.0% soybean flour, 0.1%~1.0% potato starch, 1.0%~5.0% glucose, 0.5%~1.0% potassium dihydrogen phosphate, 0.01%~0.1% magnesium sulfate, 0.001%~0.005% vitamin B1, with the balance being water.

[0015] Further, the liquid fermentation medium is composed of the following components, by mass percentage: glucose 1.0%~5.0%, soybean flour 1.0%~5.0%, yeast powder 0.1%~0.5%, corn steep liquor 0.1%~0.5%, corn starch 1.0%~5.0%, peptone 0.5%~1.0%, potassium dihydrogen phosphate 0.1%~1.0%, magnesium sulfate 0.01%~0.1%, high-temperature amylase 0.04mL / L, ammonium sulfate 0.1%~0.5%, vitamin B1 5~10mg / L, with the balance being water.

[0016] The present invention also provides the application of the above-described *Trametes versicolor* in the preparation of *Trametes versicolor* glycopeptides.

[0017] This invention provides a method for producing glycopeptides from Ganoderma lucidum, the method comprising the following steps:

[0018] (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into solid PDA slant medium and culture at 25-30℃ for 2-6 days to obtain an activated strain;

[0019] (2) The activated strain is inoculated into seed culture medium and cultured at 25-30℃ and 150-200 rpm for 24-120 h with shaking to obtain seed liquid; the seed culture medium is composed of the following components, in mass percentage: soybean flour 1.0%-5.0%, potato starch 0.1%-1.0%, glucose 1.0%-5.0%, potassium dihydrogen phosphate 0.5%-1.0%, magnesium sulfate 0.01%-0.1%, VB1 0.001%-0.005%, with the remainder being water;

[0020] (3) Inoculate the seed culture into the liquid fermentation medium and culture at 25-30℃ for 60-120h; the liquid fermentation medium consists of the following components, by mass percentage: glucose 1.0%-5.0%, soybean powder 1.0%-5.0%, yeast powder 0.1%-0.5%, corn steep liquor 0.1%-0.5%, corn starch 1.0%-5.0%, peptone 0.5%-1.0%, potassium dihydrogen phosphate 0.1%-1.0%, magnesium sulfate 0.01%-0.1%, high temperature amylase 0.04mL / L, ammonium sulfate 0.1%-0.5%, VB1 5-10mg / L, with the remainder being water.

[0021] Compared with the prior art, the present invention has the following technical advantages:

[0022] (1) The present invention screened and obtained a strain of Ganoderma lucidum YH-DB-1. The peptide content in the mycelial extract of this strain can reach more than 45%, and the total sugar content is greater than 35%. The obtained extract meets the national drug standard WS-XG-021-2002.

[0023] (2) The Yunzhi Cork Fungi YH-DB-1 described in this invention can produce a large amount of mycelium through liquid fermentation culture and can extract a large amount of glycopeptides. Compared with the traditional solid-state fermentation method, the culture method described in this invention is more efficient. Detailed Implementation

[0024] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0025] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms “comprising” and / or “including” are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0026] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments. Example 1

[0027] The Yunzhi Cork Fungi YH-DB-1 described in this invention is obtained from decayed wood in Northeast China through separation, purification, and screening.

[0028] Tissue blocks of wild *Trametes versicolor* fruiting bodies were collected from decaying wood in Northeast China and inoculated onto solid PDA medium. The medium was then incubated at 28°C in the dark for 2 days. The resulting mycelia were picked and inoculated onto fresh solid PDA medium for purification (28°C, 4 days) until pure mycelia were obtained. The mycelia were then washed with sterile water and collected. The mycelia were added to a triangular flask containing 100 ml of sterile water and glass beads and shaken well to prepare a spore suspension. 100 μL of the spore suspension was spread onto solid PDA medium and incubated at 28°C for 3 days to allow spores to grow. After spore germination, spore colonies were inoculated onto solid PDA medium using an inoculation spatula and incubated at 28°C for 3 days. The colonies were then observed.

[0029] The culture characteristics and morphological features are as follows: It grows rapidly on solid PDA medium. After 3 days of culture at 28℃, the colony diameter reaches about 5 cm. The colony morphology is white and round with irregular edges, radiating outwards, and the back is colorless. After 7 days of culture, the hyphae are white and the back is colorless.

[0030] The nucleotide sequence of the ITS region of the rRNA gene of this strain is shown in SEQ ID NO.1:

[0031] AAAAAATGACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAACGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTAT CAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGC GCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTATAAATCCTTGTGATCTATAAGCTTGGACTTGGAGGCTTGCTGGCCCTTGTTGGTCGGCTCCTCTTGAATGCATTAGCTCGATTCCGTACGG ATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGTGTTTTGGCGAGCTTCTAACCGTCCATTAGGACAACTTTTTAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCGGGAGGAA

[0032] The sequencing sequence of the ITS region of the rRNA gene was compared with that in the NCBI database, and the results showed that this strain was similar to... Trametes versicolor Because they share a common origin, the strain was identified as *Trametes versicolor*. Trametes versicolor ), named Yunzhi Cork Fungi ( Trametes versicolor YH-DB-1. This strain was deposited on August 2, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO. 41418.

[0033] The activated strain was obtained by inoculating the Yunzhi Cork Fungi YH-DB-1 onto solid PDA slant medium and culturing it at 28°C for 3 days.

[0034] The solid PDA culture medium comprises, by mass percentage: 0.6% potato starch, 2% glucose, 0.4% peptone, 0.3% yeast extract, 0.6% potassium dihydrogen phosphate, 0.05% magnesium sulfate, 0.001% vitamin B1, 2% agar, with the remainder being deionized water at natural pH.

[0035] (2) The activated strain was inoculated into the seed culture medium and cultured at 28°C and 160 rpm for 48 h to obtain the seed liquid; the seed culture medium was composed of the following components, by mass percentage: 1.5% soybean flour, 0.7% potato starch, 3.5% glucose, 0.6% potassium dihydrogen phosphate, 0.05% magnesium sulfate, 0.001% VB1, natural pH, and the remainder being water;

[0036] (3) The seed liquid was inoculated into the liquid fermentation medium at an inoculation rate of 10 wt% and cultured at 28℃ for 68 h to obtain the fermentation culture medium. The liquid fermentation medium was composed of the following components, by mass percentage: glucose 1.5%, soybean powder 1.5%, corn steep liquor 0.2%, corn starch 2.5%, yeast powder 0.2%, peptone 0.8%, potassium dihydrogen phosphate 0.6%, magnesium sulfate 0.05%, high temperature amylase 0.04 mL / L (200,000 U / mL), ammonium sulfate 0.1%, VB1 8 mg / L, natural pH, and the remainder was water.

[0037] The fermentation broth was centrifuged at 10,000 rpm for 10 min to separate the supernatant and mycelium. The mixture was washed twice with 3 times its volume of deionized water and then centrifuged again in the same way to extract the glycopeptides from the Yunzhi.

[0038] Extraction of Yunzhi glycopeptides:

[0039] After washing and centrifugation, the wet mycelium obtained was dried at 75℃ and pulverized. The pulverized mycelium was then extracted in hot water with 10 times its volume of deionized water for 2 hours, centrifuged at 8000 rpm for 10 minutes, and the supernatant was collected. The filter residue was then extracted again with 5 times its volume of deionized water for 1 hour, filtered again, and the two filtrates were combined. The solution was concentrated to 10 mL and precipitated with alcohol at approximately 70%. The solution was then refrigerated at 4℃ for 8-12 hours, and the precipitate was dried to obtain crude glycopeptides from the *Trametes versicolor*. The total sugar and peptide content were determined according to the national drug standard WS-XG 021-2002. The obtained crude glycopeptides from *Trametes versicolor* contained 45.36% peptides, 35.03% total sugars, and 1.3% monosaccharides, meeting the requirements of the national drug standard WS-XG-021-2002 (total sugar ≥35%, monosaccharides ≤10%, peptides ≥20%), and exceeding the peptide content by 25%.

[0040] The Yunzhi Cork Fungi YH-DB-1 strain was cultured three times using the method described above, and Yunzhi glycopeptides were extracted from each strain. The results are shown in Table 1 below.

[0041] Table 1

[0042] batch Total sugar content of Ganoderma lucidum (%) Yunzhi peptide content (%) Monosaccharides (%) 1 35.1 45.09 1.3 2 35.0 46.78 1.1 3 35.7 46.61 1.0 average 35.3 46.16 1.1

[0043] As can be seen from the results in Table 1 above, the peptides in the glycopeptides produced by *Trametes versicolor* YH-DB-1 are very stable. Example 2

[0044] A method for producing Yunzhi glycopeptides:

[0045] (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into solid PDA slant medium and culture at 28℃ for 3 days to obtain an activated strain;

[0046] (2) The activated strain was inoculated into the seed culture medium and cultured at 28°C and 160 rpm for 48 h to obtain the seed liquid; the seed culture medium was composed of the following components, in mass percentage: 1.0% soybean flour, 1.0% potato starch, 1.0% glucose, 0.5% potassium dihydrogen phosphate, 0.01% magnesium sulfate, 0.001% VB1, and the remainder was water;

[0047] (3) Inoculate the seed culture into the liquid fermentation medium and culture at 28°C and 160 rpm for 60 h. The liquid fermentation medium consists of the following components, by mass percentage: glucose 1.0%, soybean powder 1.0%, yeast powder 0.1%, corn steep liquor 0.1%, corn starch 1.0%, peptone 0.5%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.01%, high temperature amylase 0.04 mL / L, ammonium sulfate 0.1%, VB1 5 mg / L, and the remainder is water. Example 3

[0048] A method for producing Yunzhi glycopeptides:

[0049] (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into solid PDA slant medium and culture at 28℃ for 3 days to obtain an activated strain;

[0050] (2) The activated strain was inoculated into the seed culture medium and cultured at 28°C and 160 rpm for 36 h to obtain the seed liquid; the seed culture medium was composed of the following components, by mass percentage: 5.0% soybean flour, 1.0% potato starch, 5.0% glucose, 1.0% potassium dihydrogen phosphate, 0.1% magnesium sulfate, 0.005% VB1, and the remainder was water;

[0051] (3) The seed culture was inoculated into the liquid fermentation medium and cultured at 28°C for 120 h. The liquid fermentation medium consisted of the following components, by mass percentage: glucose 5.0%, soybean powder 5.0%, yeast powder 0.5%, corn steep liquor 0.5%, corn starch 5.0%, peptone 1.0%, potassium dihydrogen phosphate 1.0%, magnesium sulfate 0.1%, high temperature amylase 0.04 mL / L, ammonium sulfate 0.5%, VB1 10 mg / L, and the remainder was water.

[0052] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A strain of Trametes versicolor, classified as Trametes versicolor YH-DB-1, has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41418. The nucleotide sequence of the ITS region of the rRNA gene of *Trametes versicolor* YH-DB-1 is shown in SEQ ID NO.1; The peptide content in the mycelial extract of *Geobacillus yunnanensis* YH-DB-1 is ≥45%.

2. The method for culturing *Trametes versicolor* according to claim 1, characterized in that, The method includes the following steps: (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into an agar slant culture medium and culture at 25-30℃ for 2-6 days to obtain an activated strain; (2) Inoculate the activated strain into seed culture medium and culture at 25-30℃ and 150-200rpm for 24-120h to obtain seed liquid; (3) Inoculate the seed liquid into the liquid fermentation medium and incubate at 25~30℃ for 60~120h.

3. The cultivation method according to claim 2, characterized in that, The slant culture medium is a solid PDA medium.

4. The cultivation method according to claim 2, characterized in that, The seed culture medium consists of the following components by mass percentage: 1.0%~5.0% soybean flour, 0.1%~1.0% potato starch, 1.0%~5.0% glucose, 0.5%~1.0% potassium dihydrogen phosphate, 0.01%~0.1% magnesium sulfate, 0.001%~0.005% vitamin B1, with the balance being water.

5. The cultivation method according to claim 2, characterized in that, The liquid fermentation medium consists of the following components, by mass percentage: glucose 1.0%~5.0%, soybean flour 1.0%~5.0%, yeast powder 0.1%~0.5%, corn steep liquor 0.1%~0.5%, corn starch 1.0%~5.0%, peptone 0.5%~1.0%, potassium dihydrogen phosphate 0.1%~1.0%, magnesium sulfate 0.01%~0.1%, high-temperature amylase 0.04mL / L, ammonium sulfate 0.1%~0.5%, vitamin B1 5~10mg / L, with the balance being water.

6. The use of the *Trametes versicolor* strain according to claim 1 in the preparation of *Trametes versicolor* glycopeptides.

7. A method for producing *Trametes versicolor* glycopeptides using a strain of *Trametes versicolor* as described in claim 1, characterized in that, The method includes the following steps: (1) Inoculate the Yunzhi Cork Fungi YH-DB-1 strain into solid PDA slant medium and culture at 25-30℃ for 2-6 days to obtain an activated strain; (2) The activated strain is inoculated into seed culture medium and cultured at 25-30℃ and 150-200 rpm for 24-120 h with shaking to obtain seed liquid; the seed culture medium is composed of the following components, in mass percentage: soybean flour 1.0%-5.0%, potato starch 0.1%-1.0%, glucose 1.0%-5.0%, potassium dihydrogen phosphate 0.5%-1.0%, magnesium sulfate 0.01%-0.1%, VB1 0.001%-0.005%, with the remainder being water; (3) Inoculate the seed culture into the liquid fermentation medium and culture at 25-30℃ for 60-120h; the liquid fermentation medium consists of the following components, by mass percentage: glucose 1.0%-5.0%, soybean powder 1.0%-5.0%, yeast powder 0.1%-0.5%, corn steep liquor 0.1%-0.5%, corn starch 1.0%-5.0%, peptone 0.5%-1.0%, potassium dihydrogen phosphate 0.1%-1.0%, magnesium sulfate 0.01%-0.1%, high temperature amylase 0.04mL / L, ammonium sulfate 0.1%-0.5%, VB1 5-10mg / L, with the remainder being water.

Citation Information

Patent Citations

  • Method for efficiently preparing polysaccharopeptide

    CN103408645A

  • Coriolus versicolor strain and method for producing Coriolus versicolor intracellular glycopeptide using the strain

    CN1807573A