A test strip for detecting African swine fever virus P72 protein
By developing a rapid detection card based on colloidal gold immunochromatography technology, using monoclonal antibodies to combine with colloidal gold markers, the problems of cumbersome detection operations and equipment dependence in the existing technology are solved, and a fast, simple and low-cost detection of African swine fever virus is achieved.
Patent Information
- Application Number
- CN202411174630.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-26
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-08-26
AI Technical Summary
The methods used in the prior art for African swine fever virus detection are cumbersome, requiring expensive equipment and professional personnel, which limits the detection application at the grassroots level.
A rapid detection card based on colloidal gold immunochromatography technology was developed, which uses monoclonal antibodies secreted by hybridoma cells to combine with colloidal gold labels to achieve rapid and simple detection of African swine fever virus P72 protein.
It realizes fast, simple and low-cost African swine fever virus detection, avoids dependence on expensive equipment and professionals, and improves grassroots detection capabilities.
Smart Images

Figure CN118909961B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of medical detection and relates to a test strip for detecting African swine fever virus P72 protein. Background Art
[0002] African swine fever virus (ASFV) is the only member of the genus Asfivirus in the family Asfarviridae, and is also the only known arthropod-borne double-stranded DNA virus. According to the viral hemagglutinin CD2-like protein (CD2v) and C-type lectin (EP153R), the known ASFV can be divided into eight serotypes. Based on the 478 bp bases at the C-terminus of the B646L gene encoding the major capsid protein P72 of ASFV, it can be divided into 24 genotypes. The known 24 genotypes of ASFV are distributed in Africa. So far, only ASFV of genotype I and genotype II has spread to regions outside Africa, and genotype II ASFV is the main strain currently prevalent globally. ASFV is an enveloped double-stranded linear DNA virus. Mature ASFV particles are spherical with a diameter of 260 nm - 300 nm, and mainly consist of five parts: outer envelope, viral capsid, inner envelope, nucleocapsid, and nucleolus. The ASFV genome consists of a double-stranded linear DNA molecule with a size of 170 - 194 kb located within an icosahedral capsid, encoding 151 - 167 open reading frames and expressing a variety of proteins. ASF is a disease characterized by high pathogenicity, high mortality, and severe hemorrhagic fever. The outbreak of African swine fever has brought a devastating blow to the pig farming industry, causing huge economic losses. Currently, there are still no effective commercial vaccines and drugs for the prevention and treatment of this disease, and ASF prevention and control strategies still focus on biosafety measures such as early detection, restricting livestock activities, and culling potentially infected herds. In 2018, the first case of African swine fever was confirmed in China, and the highly virulent genotype II strain became the main prevalent strain in the country. In 2020, the moderately virulent genotype II strain was first reported, with local epidemics. Subsequently, the low-virulence genotype I strain emerged, with local epidemics. In 2021, the recombinant highly virulent genotype I / II strain was first discovered and has now become the dominant prevalent strain. The emergence of multiple strains has made the African swine fever epidemic in China more complex, bringing new challenges to ASF prevention and control.
[0003] So far, there is still no effective commercial vaccine in China. Therefore, a rapid and effective diagnostic method is crucial for the prevention and control of African swine fever. The detection of African swine fever virus requires appropriate sample collection, preservation, and reliable detection methods. Antigen detection can target viral proteins or viral nucleic acids; antibody detection targets virus-specific antibodies. The currently commonly used antigen detection method is qPCR detection, which can detect the ASFV genome in any clinical sample of domestic pigs, wild boars, soft ticks, and the environment. However, the operation is cumbersome, requiring expensive real-time fluorescence quantitative PCR instrument equipment and professional personnel, and its application at the grass-roots level is severely restricted; antibody detection, represented by ELISA, can detect the level of ASFV-specific antibodies in pigs in a high-throughput manner, but there are still problems such as cumbersome operation, requiring equipment such as enzyme-labeled instruments and incubators, and limited on-site detection. Summary of the Invention
[0004] With the rapid development of colloidal gold immunochromatography technology, it has shown great detection advantages, solving the problems of complex virus detection processes, long time, and high loss in real life. The present invention has developed a colloidal gold test strip with rapid detection, simple operation, low price, and no need for professional equipment.
[0005] To solve the problems existing in the prior art, the first aspect of the present invention provides a hybridoma cell, which is a first hybridoma cell, a second hybridoma cell, or a combination of the first hybridoma cell and the second hybridoma cell;
[0006] The first hybridoma cell is a hybridoma cell with a microbial deposit number of CCTCC NO: C2024209 or a passage cell of a hybridoma cell with a microbial deposit number of CCTCC NO: C2024209; the monoclonal antibody secreted by the passage cell of the hybridoma cell with a microbial deposit number of CCTCC NO: C2024209 maintains specific binding activity to the African swine fever virus P72 protein;
[0007] The second hybridoma cell is a hybridoma cell with a microbial deposit number of CCTCC NO: C2024214 or a passage cell of a hybridoma cell with a microbial deposit number of CCTCC NO: C2024214; the monoclonal antibody secreted by the passage cell of the hybridoma cell with a microbial deposit number of CCTCC NO: C2024214 maintains specific binding activity to the African swine fever virus P72 protein.
[0008] The second aspect of the present invention provides a biological material, which is any one of the following P1, P2, P3, P4, P5, P6, P7, P8, P9, and P10;
[0009] P1: Monoclonal antibody
[0010] The monoclonal antibody is a first monoclonal antibody, a second monoclonal antibody, or a combination of the first monoclonal antibody and the second monoclonal antibody;
[0011] The first monoclonal antibody maintains specific binding activity to the African swine fever virus P72 protein;
[0012] The first monoclonal antibody includes a first monoclonal antibody heavy chain and a first monoclonal antibody light chain;
[0013] The first monoclonal antibody heavy chain includes a first monoclonal antibody heavy chain CDR1, a first monoclonal antibody heavy chain CDR2, and a first monoclonal antibody heavy chain CDR3;
[0014] The first monoclonal antibody light chain includes a first monoclonal antibody light chain CDR1, a first monoclonal antibody light chain CDR2, and a first monoclonal antibody light chain CDR3;
[0015] The protein sequence of the first monoclonal antibody heavy chain CDR1 is as shown in SEQ ID NO.3;
[0016] The protein sequence of the first monoclonal antibody heavy chain CDR2 is as shown in SEQ ID NO.5;
[0017] The protein sequence of the first monoclonal antibody heavy chain CDR3 is as shown in SEQ ID NO.7;
[0018] The protein sequence of the first monoclonal antibody light chain CDR1 is as shown in SEQ ID NO.9;
[0019] The protein sequence of the first monoclonal antibody light chain CDR2 is as shown in SEQ ID NO.11;
[0020] The protein sequence of the first monoclonal antibody light chain CDR3 is as shown in SEQ ID NO.13;
[0021] The second monoclonal antibody maintains specific binding activity to the African swine fever virus P72 protein;
[0022] The second monoclonal antibody includes a second monoclonal antibody heavy chain and a second monoclonal antibody light chain;
[0023] The second monoclonal antibody heavy chain includes a second monoclonal antibody heavy chain CDR1, a second monoclonal antibody heavy chain CDR2, and a second monoclonal antibody heavy chain CDR3;
[0024] The second monoclonal antibody light chain includes a second monoclonal antibody light chain CDR1, a second monoclonal antibody light chain CDR2, and a second monoclonal antibody light chain CDR3;
[0025] The protein sequence of the CDR1 of the second monoclonal antibody heavy chain is as shown in SEQ ID NO.15;
[0026] The protein sequence of the CDR2 of the second monoclonal antibody heavy chain is as shown in SEQ ID NO.17;
[0027] The protein sequence of the CDR3 of the second monoclonal antibody heavy chain is as shown in SEQ ID NO.19;
[0028] The protein sequence of the CDR1 of the second monoclonal antibody light chain is as shown in SEQ ID NO.21;
[0029] The protein sequence of the CDR2 of the second monoclonal antibody light chain is as shown in SEQ ID NO.23;
[0030] The protein sequence of the CDR3 of the second monoclonal antibody light chain is as shown in SEQ ID NO.25;
[0031] P2: The combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain
[0032] The combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain includes the combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 1, the combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 2, or the combination of the combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 1 and the combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 2;
[0033] The combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 1 maintains the specific binding activity to the African swine fever virus P72 protein;
[0034] The combination of the monoclonal antibody heavy chain and the monoclonal antibody light chain 1 includes the first monoclonal antibody heavy chain and the first monoclonal antibody light chain;
[0035] The first monoclonal antibody heavy chain includes the amino acid sequences of the first monoclonal antibody heavy chain CDR1, the first monoclonal antibody heavy chain CDR2, the first monoclonal antibody heavy chain CDR3 and a functional protein fragment or an inert protein fragment;
[0036] The first monoclonal antibody light chain includes the amino acid sequences of the first monoclonal antibody light chain CDR1, the first monoclonal antibody light chain CDR2, the first monoclonal antibody light chain CDR3 and a functional protein fragment or an inert protein fragment;
[0037] The protein sequence of the CDR1 of the first monoclonal antibody heavy chain is as shown in SEQ ID NO.3;
[0038] The protein sequence of the CDR2 of the first monoclonal antibody heavy chain is as shown in SEQ ID NO.5;
[0039] The amino acid sequence of the CDR3 of the heavy chain of the first monoclonal antibody is shown in SEQ ID NO.7;
[0040] The amino acid sequence of the CDR1 of the light chain of the first monoclonal antibody is shown in SEQ ID NO.9;
[0041] The amino acid sequence of the CDR2 of the light chain of the first monoclonal antibody is shown in SEQ ID NO.11;
[0042] The amino acid sequence of the CDR3 of the light chain of the first monoclonal antibody is shown in SEQ ID NO.13;
[0043] The combination 2 of the heavy chain and the light chain of the monoclonal antibody retains the specific binding activity to the African swine fever virus P72 protein;
[0044] The combination 2 of the heavy chain and the light chain of the monoclonal antibody includes the heavy chain of the second monoclonal antibody and the light chain of the second monoclonal antibody;
[0045] The heavy chain of the second monoclonal antibody includes the amino acid sequences of CDR1 of the heavy chain of the second monoclonal antibody, CDR2 of the heavy chain of the second monoclonal antibody, CDR3 of the heavy chain of the second monoclonal antibody and a functional protein fragment or an inert protein fragment;
[0046] The light chain of the second monoclonal antibody includes the amino acid sequences of CDR1 of the light chain of the second monoclonal antibody, CDR2 of the light chain of the second monoclonal antibody, CDR3 of the light chain of the second monoclonal antibody and a functional protein fragment or an inert protein fragment;
[0047] The amino acid sequence of the CDR1 of the heavy chain of the second monoclonal antibody is shown in SEQ ID NO.15;
[0048] The amino acid sequence of the CDR2 of the heavy chain of the second monoclonal antibody is shown in SEQ ID NO.17;
[0049] The amino acid sequence of the CDR3 of the heavy chain of the second monoclonal antibody is shown in SEQ ID NO.19;
[0050] The amino acid sequence of the CDR1 of the light chain of the second monoclonal antibody is shown in SEQ ID NO.21;
[0051] The amino acid sequence of the CDR2 of the light chain of the second monoclonal antibody is shown in SEQ ID NO.23;
[0052] The amino acid sequence of the CDR3 of the light chain of the second monoclonal antibody is shown in SEQ ID NO.25;
[0053] P3: Antibody derivative
[0054] The forms of the antibody derivatives are selected from: enzyme-labeled antibodies, fluorescently labeled antibodies, chemically modified antibodies, antibody Fab fragments, porcineized antibodies, single-chain antibodies, chimeric monoclonal antibodies, and modified monoclonal antibodies;
[0055] The antibody derivative is a first antibody derivative, a second antibody derivative, or a combination of the first antibody derivative and the second antibody derivative;
[0056] The first antibody derivative retains the specific binding activity to the African swine fever virus P72 protein;
[0057] The protein sequence portion of the antibody derivative contains a first monoclonal antibody heavy chain CDR1, a first monoclonal antibody heavy chain CDR2, a first monoclonal antibody heavy chain CDR3, a first monoclonal antibody light chain CDR1, a first monoclonal antibody light chain CDR2, and a first monoclonal antibody light chain CDR3;
[0058] The protein sequence of the first monoclonal antibody heavy chain CDR1 is as shown in SEQ ID NO.3;
[0059] The protein sequence of the first monoclonal antibody heavy chain CDR2 is as shown in SEQ ID NO.5;
[0060] The protein sequence of the first monoclonal antibody heavy chain CDR3 is as shown in SEQ ID NO.7;
[0061] The protein sequence of the first monoclonal antibody light chain CDR1 is as shown in SEQ ID NO.9;
[0062] The protein sequence of the first monoclonal antibody light chain CDR2 is as shown in SEQ ID NO.11;
[0063] The protein sequence of the first monoclonal antibody light chain CDR3 is as shown in SEQ ID NO.13;
[0064] The second antibody derivative retains the specific binding activity to the African swine fever virus P72 protein;
[0065] The protein sequence portion of the antibody derivative contains a second monoclonal antibody heavy chain CDR1, a second monoclonal antibody heavy chain CDR2, a second monoclonal antibody heavy chain CDR3, a second monoclonal antibody light chain CDR1, a second monoclonal antibody light chain CDR2, and a second monoclonal antibody light chain CDR3;
[0066] The protein sequence of the second monoclonal antibody heavy chain CDR1 is as shown in SEQ ID NO.15;
[0067] The protein sequence of the second monoclonal antibody heavy chain CDR2 is as shown in SEQ ID NO.17;
[0068] The CDR3 protein sequence of the heavy chain of the second monoclonal antibody is as shown in SEQ ID NO. 19;
[0069] The CDR1 protein sequence of the light chain of the second monoclonal antibody is as shown in SEQ ID NO. 21;
[0070] The CDR2 protein sequence of the light chain of the second monoclonal antibody is as shown in SEQ ID NO. 23;
[0071] The CDR3 protein sequence of the light chain of the second monoclonal antibody is as shown in SEQ ID NO. 25;
[0072] P4: RNA combination
[0073] The RNA combination includes a first RNA combination, a second RNA combination, or a combination of the first RNA combination and the second RNA combination;
[0074] The first RNA combination includes a first monoclonal antibody heavy chain RNA and a first monoclonal antibody light chain RNA;
[0075] The first monoclonal antibody heavy chain RNA can be translated to obtain the first monoclonal antibody heavy chain described in P1 or P2;
[0076] The first monoclonal antibody light chain RNA can be translated to obtain the first monoclonal antibody light chain described in P1 or P2;
[0077] The second RNA combination includes a second monoclonal antibody heavy chain RNA and a second monoclonal antibody light chain RNA;
[0078] The second monoclonal antibody heavy chain RNA can be translated to obtain the second monoclonal antibody heavy chain described in P1 or P2;
[0079] The second monoclonal antibody light chain RNA can be translated to obtain the second monoclonal antibody light chain described in P1 or P2;
[0080] P5: Gene combination
[0081] The gene combination includes a first gene combination, a second gene combination, or a combination of the first gene combination and the second gene combination;
[0082] The coding sequence of the first gene combination can encode the first monoclonal antibody heavy chain described in P1 or P2 and the first monoclonal antibody light chain described in P1 or P2;
[0083] The coding sequence of the second gene combination can encode the heavy chain of the second monoclonal antibody described in P1 or P2 and the light chain of the second monoclonal antibody described in P1 or P2;
[0084] P6: Gene expression cassette combination
[0085] The gene expression cassette combination includes a first gene expression cassette combination, a second gene expression cassette combination, or a combination of the first gene expression cassette combination and the second gene expression cassette combination;
[0086] The gene expression product in the first gene expression cassette combination is the first RNA combination described in P4;
[0087] The gene expression product in the second gene expression cassette combination is the second RNA combination described in P4;
[0088] P7: Genetic engineering vector
[0089] The genetic engineering vector includes a first genetic engineering vector, a second genetic engineering vector, or a combination of the first genetic engineering vector and the second genetic engineering vector;
[0090] The first genetic engineering vector contains the first gene expression cassette described in P6;
[0091] The first monoclonal antibody heavy chain RNA and the first monoclonal antibody light chain RNA are encoded in one or two vectors;
[0092] The second genetic engineering vector contains the second gene expression cassette described in P6;
[0093] The second monoclonal antibody heavy chain RNA and the second monoclonal antibody light chain RNA are encoded in one or two vectors;
[0094] P8: Cell
[0095] The cell includes a first cell, a second cell, or a combination of the first cell and the second cell;
[0096] The first cell contains the first genetic engineering vector described in P7;
[0097] The coding RNAs in the gene expression cassette of the first genetic engineering vector are constitutively expressed or artificially induced;
[0098] When the first monoclonal antibody heavy chain RNA and the first monoclonal antibody light chain RNA are encoded in two vectors, the two vectors are in the same cell or different cells;
[0099] The second cell contains the second genetic engineering vector described in P7;
[0100] The coding RNA in the gene expression cassette of the second genetic engineering vector is constitutively expressed or artificially induced to be expressed;
[0101] When the second monoclonal antibody heavy chain RNA and the second monoclonal antibody light chain RNA are encoded in two vectors, the two vectors are in the same cell or different cells;
[0102] P9: Composition
[0103] The composition is a first composition, a second composition, or a combination of the first composition and the second composition;
[0104] The first composition contains the first monoclonal antibody described in P1, the combination 1 of the monoclonal antibody heavy chain and the monoclonal antibody light chain described in P2, the first antibody derivative described in P3, the first RNA combination described in P4, the first genetic engineering vector described in P7, or the first cell described in P8;
[0105] The second composition contains the second monoclonal antibody described in P1, the combination 2 of the monoclonal antibody heavy chain and the monoclonal antibody light chain described in P2, the second antibody derivative described in P3, the second RNA combination described in P4, the second genetic engineering vector described in P7, or the second cell described in P8; and
[0106] P10: Kit
[0107] The kit is a first kit, a second kit, or a combination of the first kit and the second kit;
[0108] The first kit contains the first monoclonal antibody described in P1, the combination 1 of the monoclonal antibody heavy chain and the monoclonal antibody light chain described in P2, the first antibody derivative described in P3, the first RNA combination described in P4, the first genetic engineering vector described in P7, or the first cell described in P8;
[0109] The second kit contains the second monoclonal antibody described in P1, the combination 2 of the monoclonal antibody heavy chain and the monoclonal antibody light chain described in P2, the second antibody derivative described in P3, the second RNA combination described in P4, the second genetic engineering vector described in P7, or the second cell described in P8.
[0110] In some embodiments, it is selected from any one or a combination of the following C1, C2, C3, C4:
[0111] C1: In P1, the first monoclonal antibody is the monoclonal antibody secreted by the first hybridoma cell described in the first aspect of the present invention, and / or
[0112] The second monoclonal antibody is the monoclonal antibody secreted by the second hybridoma cell described in the first aspect of the present invention;
[0113] C2: In P2, the functional protein fragment is a tag peptide and / or a signal peptide for separating and purifying proteins;
[0114] C3: The amino acid sequence of the African swine fever virus P72 protein is as shown in SEQ ID NO.1;
[0115] C4: The chemically modified antibody is a colloidal gold-labeled antibody.
[0116] Use of the hybridoma cell described in the first aspect of the present invention or the biological material described in the second aspect of the present invention in the preparation of a preparation for identifying, detecting or identifying the African swine fever virus P72 protein, African swine fever virus subviral particles containing the African swine fever virus P72 protein or African swine fever virus particles.
[0117] In some embodiments, the amino acid sequence of the African swine fever virus P72 protein is as shown in SEQ ID NO.1.
[0118] The third aspect of the present invention provides a test card for detecting biological substances, and the test card contains a colloidal gold pad and a test line;
[0119] The test card is a first test card or a second test card;
[0120] In the first test card, the colloidal gold pad contains monoclonal antibody a labeled with colloidal gold, and the test line contains monoclonal antibody b;
[0121] The monoclonal antibody a is any one of the first monoclonal antibody and the second monoclonal antibody described in the second aspect of the present invention; the monoclonal antibody b is the other one of the first monoclonal antibody and the second monoclonal antibody described in the second aspect of the present invention;
[0122] In the second test card, the colloidal gold pad contains monoclonal antibody c labeled with colloidal gold, and the test line contains monoclonal antibody d; or the colloidal gold pad contains monoclonal antibody d labeled with colloidal gold, and the test line contains monoclonal antibody c;
[0123] The monoclonal antibody c is the first monoclonal antibody or the second monoclonal antibody described in the second aspect of the present invention; the monoclonal antibody d is a mouse-derived monoclonal antibody IgG against the African swine fever virus P72 protein, and the monoclonal antibody d has different epitopes against the African swine fever virus P72 protein recognized by the first monoclonal antibody and the second monoclonal antibody described in the second aspect of the present invention;
[0124] The biological substance is selected from:
[0125] A mixture containing African swine fever virus P72 protein;
[0126] A mixture containing African swine fever virus particles;
[0127] A mixture containing African swine fever virus sub-virus particles containing African swine fever virus P72 protein.
[0128] In some embodiments, the test card further contains a bottom plate, a sample pad, a water-permeable membrane, an absorbent pad, and a quality control line.
[0129] In some embodiments, the sample pad, the colloidal gold pad, the water-permeable membrane, and the absorbent pad are sequentially arranged from one end to the other end on one side of the bottom plate, and the quality control line and the test line are arranged on the water-permeable membrane.
[0130] In some embodiments, a blood filtration membrane is further arranged between the sample pad and the gold label pad.
[0131] In some embodiments, it is selected from any one or a combination of the following S1, S2, S3, S4, and S5;
[0132] S1: The amino acid sequence of the African swine fever virus P72 protein is as shown in SEQ ID NO.1.
[0133] S2: An anti-mouse IgG antibody is provided on the quality control line;
[0134] S3: The water-permeable membrane is a nitrocellulose membrane;
[0135] S4: The bottom plate is a PVC plate;
[0136] S5: The GenBank number of the African swine fever virus is MZ945537.1 or MW656282.1, or
[0137] The microbial preservation number of the African swine fever virus is: Preservation number: CCTCC NO: V201924. Description of the Drawings
[0138] Figure 1 It is an IFA fluorescence photo of the first monoclonal antibody, and the scale in the photo is 100 μm.
[0139] Figure 2 It is an IFA fluorescence photo of the second monoclonal antibody, and the scale in the photo is 100 μm.
[0140] Figure 3 It is an IFA fluorescence photo of the positive control, and the scale in the photo is 100 μm.
[0141] Figure 4 IFA fluorescence photograph for negative control, with a scale bar of 100 μm in the photograph.
[0142] Figure 5 Schematic diagram of the colloidal gold test strip structure.
[0143] Figure 6 Graph of the specific test results of the colloidal gold test strip.
[0144] Figure 7 Graph of the sensitivity test results of the colloidal gold test strip. Detailed implementation mode
[0145] To make the objectives, technical solutions, and advantages of the present invention clearer, the following will further describe the implementation modes of the present invention in detail with reference to the accompanying drawings. The materials and instruments not described in the present invention are conventional materials and instruments in the art, and the operation details not described in the present invention are conventional operations in the art. Unless otherwise specified, the nucleic acid sequences shown in the present invention are written from left to right in the 5' to 3' direction.
[0146] Viruses, cells, and biological materials
[0147] (1) BK2258 cells
[0148] BK2258 cells are a kind of cells derived from boar kidney (Boar kidney cell), prepared and preserved by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.
[0149] The preparation method of BK2258 cells is recorded in the application documents of the Chinese patent application with the application number CN202211137583.3. The F20-generation cells of the BK2258 strain obtained by isolation and culture are submitted to a patent procedure-recognized preservation institution for preservation. The preservation unit is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microorganism preservation number is CCTCC NO: C2022258; the name of the culture is Boar kidney cell BK2258; the Chinese classification name is: Boar kidney cell; the English classification name is: Boar kidney cell; the preservation time is August 10, 2022; the identification survival time is August 17, 2022.
[0150] (2) Primary porcine alveolar macrophages
[0151] Primary porcine alveolar macrophages (PAMs) were obtained from healthy SPF pigs aged 30 - 50 days and routinely cultured in RPMI 1640 medium containing 10% (v / v) FBS in an incubator at 37°C and 5% CO2. They were prepared and used by the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
[0152] (3) ASFV SD / DY-Ⅰ / 21 strain
[0153] The highly virulent naturally isolated strain of African swine fever (ASFV SD / DY-Ⅰ / 21 strain, abbreviated as SD / DY-Ⅰ / 21 strain) is a genotype I African swine fever virus strain. It was isolated, identified and preserved by the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The corresponding GenBank accession number of this strain is MZ945537.1, and its full name is Pig / SD / DY-I / 2021.
[0154] (4) ASFV HLJ / HRB1 / 20 strain
[0155] The moderately virulent naturally isolated strain of African swine fever (ASFV HLJ / HRB1 / 20 strain, abbreviated as HLJ / HRB1 / 20 strain) is a genotype II African swine fever virus strain. It was isolated, identified and preserved by the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The corresponding GenBank accession number of this strain is MW656282.1, and its full name is Pig / Heilongjiang / HRB1 / 2020.
[0156] (5) ASFV HLJ / 18-7GD strain
[0157] The African swine fever gene-deleted virus strain (ASFV HLJ / 18-7GD strain, abbreviated as HLJ / 18-7GD strain) has six genes in the MGF360 / 505 region and the EP402R gene deleted. It was prepared and preserved by the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The transformation process of the HLJ / 18-7GD strain in this application is described in the patent document with Chinese patent application number 201910348878.7, and its corresponding name therein is rASFVΔCD2V / 360-eGFP-mCherry strain. The depositary institution of this strain is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the deposit number is: CCTCC NO:V201924; the name of the culture is African swine fever virus rASFVΔCD2V / 360-eGFP-mCherry, the Chinese taxonomic name is: African swine fever virus; the English taxonomic name is: African Swine Fever Virus; the deposit date is April 24, 2019.
[0158] Example 1: Preparation and Identification of Monoclonal Antibody
[0159] (I) Preparation of Antigen
[0160] (1) Preparation of Antigen 1
[0161] Preparation of P72 protein: The B646L gene of African swine fever virus strain HLJ / 18 (GenBank accession number MK333180.1) was used in this invention. Its coding sequence is located at positions 103618 - 105558, encoding the P72 protein. The plasmid containing the aforementioned B646L gene coding sequence was transformed into Saccharomyces cerevisiae to induce the expression of the foreign protein, and the obtained protein was purified through the StrepⅡ purification system to obtain purified P72 protein. The operation was carried out according to the method described in the following literature.
[0162] K. Meng, Y. Zhang, Q. Liu, Y. Huyan, W. Zhu, Y. Xiang, G. Meng, Structural Design and Assessing of Recombinantly Expressed African Swine Fever Virus p72 Trimer in Saccharomyces cerevisiae, Frontiers in Microbiology 13(2022).
[0163] The aforementioned P72 protein sequence is as follows (SEQ ID NO.1):
[0164] MASGGAFCLIANDGKADKIILAQDLLNSRISNIKNVNKSYGKPDPEPTLSQIEETHLVHFNAHFKPYVPVGFEYNKVRPHTGTPTLGNKLTFGIPQYGDFFHDMVGHHILGACHSSWQDAPIQGTSQMGAHGQLQTFPRNGYDWDNQTPLEGAVYTLVDPFGRPIVPGTKNAYRNLVYYCEYPGERLYENVRFDVNGNSLDEYSSDVTTLVRKFCIPGDKMTGYKHLVGQEVSVEGTSGPLLCNIHDLHKPHQSKPILTDENDTQRTCSHTNPKFLSQHFPENSHNIQTAGKQDITPITDATYLDIRRNVHYSCNGPQTPKYYQPPLALWIKLRFWFNENVNLAIPSVSIPFGERFITIKLASQKDLVNEFPGLFVRQSRFIAGRPSRRNIRFKPWFIPGVINEISLTNNELYINNLFVTPEIHNLFVKRVRFSLIRVHKTQVTHTNNNHHDEKLMSALKWPIEYMFIGLKPTWNISDQNPHQHRDWHKFGHVVNAIMQPTHHAEISFQDRDTALPDACSSISDISPVTYPITLPIIKNISVTAHGINLIDKFPSKFCSSYIPFHYGGNAIKTPDDPGAMMITFALKPREEYQPSGHINVSRAREFYISWDTDYVGSITTADLVVSASAINFLLLQNGSAVLRYST
[0165] (2) Preparation of Antigen 2
[0166] Virus culture: Dilute the ASFV HLJ / 18 - 7GD strain to 10000 TCID 50 / ml with RPMI Medium 1640 (purchased from Thermo Fisher Scientific Biochemicals (Beijing) Co., Ltd., product number: C11875500BT) complete culture medium (containing 10 v / v% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin). Inoculate the diluted virus strain into primary PAM. Place the culture flask in an incubator at 37°C and 5% CO2, and harvest the virus solution when the CPE reaches 80%.
[0167] Virus inactivation and purification: 0.1% aqueous formaldehyde solution was added to the crudely isolated HLJ / 18-7GD virus solution, and it was inactivated at 37°C for 36 h. Then, after continuous density gradient ultracentrifugation with 30% (w / w) and 55% (w / w) sucrose aqueous solutions, a white virus band was present between the 30% and 55% sucrose layers. The virus between the 55% and 30% sucrose layers was aspirated with a long needle, and after desugaring, it was observed under an electron microscope, and its protein concentration was measured using a Thermo Scientific NanoDrop One.
[0168] (2) Preparation of monoclonal antibodies
[0169] (1) Preparation of the first monoclonal antibody
[0170] The purified P72 protein solution (antigen 1, 1 mg / ml, with the solvent being sterile PBS (0.01 mol / L, pH 7.4)) was mixed and emulsified with an equal volume of complete Freund's adjuvant, and six 6- to 8-week-old female BALB / c mice were immunized subcutaneously. The immunization dose was 50 μg of P72 protein per mouse. Then, an immunogen was prepared by mixing and emulsifying the same P72 protein solution with an equal volume of incomplete Freund's adjuvant for two booster immunizations, with a 2-week interval between each immunization and the same dose each time. Ten days after the second booster immunization, blood was collected from each mouse, the serum was separated, and the antibody titer was measured using the indirect P72-ELISA method. The mouse with the highest antibody titer was selected and given a final booster immunization with the aforementioned purified P72 protein solution without adjuvant, with an immunization dose of 50 μg of P72 protein per mouse. Three days later, the mouse was euthanized, and splenocytes were fused with SP2 / 0 myeloma cells. The fused hybridoma cells were cultured in HAT selection medium for 10 days. Using the aforementioned purified P72 protein as the coating antigen, the P72 antibody in the cell supernatant 10 days after fusion was detected by the indirect ELISA method. For antibody-positive wells, three subclonings were performed by the limiting dilution method, and finally, a positive hybridoma cell with a single genetic background that could secrete antibodies against the P72 protein was obtained. It was named cell line P72-2F3, and the monoclonal antibody secreted by this hybridoma cell was called mAb P72-2F3.
[0171] (2) Preparation of the second monoclonal antibody
[0172] The purified HLJ / 18-7GD virus protein solution (antigen 2, 1 mg / ml, with the solvent being sterile PBS (0.01 mol / L, pH 7.4)) was mixed and emulsified with an equal volume of complete Freund's adjuvant, and six 6- to 8-week-old female BALB / c mice were immunized subcutaneously. The immunization dose was 50 μg protein per mouse. Then, an immunogen was prepared by mixing and emulsifying the same HLJ / 18-7GD virus protein solution with an equal volume of incomplete Freund's adjuvant for two booster immunizations at an interval of two weeks each, with the same dose each time. Ten days after the second booster immunization, blood was collected from each mouse, serum was separated, and the antibody titer was measured using the indirect immunofluorescence assay (IFA). The mouse with the highest antibody titer was given a final booster immunization with the purified HLJ / 18-7GD virus protein solution without adjuvant at a dose of 50 μg protein per mouse. Three days later, the mouse was euthanized, and splenocytes were fused with SP2 / 0 myeloma cells. The fused hybridoma cells were cultured in HAT selective medium for 10 days. The ASFV antibody in the cell supernatant 10 days after fusion was detected using the IFA. For antibody-positive wells, three subclonings were performed by the limiting dilution method, and through target protein identification, a positive hybridoma cell with a single genetic background that could secrete antibodies against the P72 protein, named cell line ASFV-4H7, was finally obtained. The monoclonal antibody secreted by this hybridoma cell was called monoclonal antibody ASFV-4H7.
[0173] The reactivity of monoclonal antibody P72-2F3 with ASFV-infected BK2258 cells was detected by indirect immunofluorescence assay (IFA), and the specific steps were as follows:
[0174] 1. Virus inoculation: The ASFV SD / DY-I / 21 strain (GenBank accession number: MZ945537.1) was inoculated at a dose of 10 3.80 TCID 50 / ml onto the monolayer of BK2258 cells cultured in a 96-well plate with good growth. The culture medium was RPMI 1640 medium, and the inoculation volume was 100 μl / well. The cells were cultured at 37 °C and 5% CO2 for 48 h.
[0175] 2. Cell fixation: The culture medium was discarded, and the cells were washed twice with PBS at 250 μl / well for 1 min each time, and then the PBS was discarded; 100 μl of pre-cooled 4% (w / w) paraformaldehyde fixative (with PBS as the solvent) was added per well, and the cells were left standing at room temperature for 30 min. The fixative was then discarded, and the cells were washed twice with PBS at 250 μl / well for 1 min each time, and then the PBS was discarded.
[0176] 3. Permeabilization treatment: Add 0.25% (v / v) Triton-X100 permeabilization solution (the solvent is PBS), 200 μl / well, and let it stand at room temperature for 15 min. Discard the permeabilization solution, wash twice with PBS, 250 μl / well, 1 min / each time, and discard the PBS.
[0177] 4. Add primary antibody: For the cell monolayer in the aforementioned 96-well plate, add one of the following three primary antibodies to different wells respectively, 100 μl / well, incubate at 37 °C for 30 min. Discard the sample, wash three times with PBS, 250 μl / well, 1 min / each time, and discard the PBS.
[0178] (i) Monoclonal antibody P72-2F3 solution, with a protein concentration of 1 mg / ml, the solvent is PBS, and it is diluted 1:100 by volume with PBS. (ii) Positive control: Mouse polyclonal antiserum against African swine fever virus HLJ / 18-7GD strain, diluted 1:200 by volume with PBS. (iii) Negative control: SP2 / 0 cell culture supernatant.
[0179] 5. Add secondary antibody: Add FITC-labeled goat anti-mouse IgG (purchased from Frdbio), diluted 1:100 by volume with PBS, and the added amount after dilution is 100 μl / well, incubate at 37 °C for 30 min. Discard the secondary antibody, wash three times with PBS, 250 μl / well, 1 min / each time, and do not discard the washing solution for the last wash.
[0180] 6. Result determination: Observe the 96-well plate with a fluorescence microscope and take pictures.
[0181] Use antibody ASFV-4H7 instead of antibody P72-2F3, and other methods and steps are the same as the aforementioned IFA operation.
[0182] Select one field of view for each operation. The test result of antibody 1 (antibody P72-2F3) is as Figure 1 shown, the test result of antibody 2 (antibody ASFV-4H7) is as Figure 2 shown, the test result of the positive control is as Figure 3 shown, and the test and result of the negative control are as Figure 4 shown. It can be seen that in the BK2258 cell test results, the test wells of monoclonal antibody 1 and monoclonal antibody 2 show green fluorescence, the negative control wells have no green fluorescence, and the positive control wells show green fluorescence. It can be seen that monoclonal antibody 1 and monoclonal antibody 2 can bind to African swine fever virus-infected cells.
[0183] Use P72 protein as the detection antigen to perform an indirect ELISA test to determine the reactivity of the first monoclonal antibody and the second monoclonal antibody with P72 protein. The detection procedure is as follows:
[0184] 1. Coating: Dilute the P72 protein antigen prepared in Example 1 of the present invention with an antigen coating solution (carbonate buffer, pH 8.0) to an antigen dilution of 2 μg / ml, add it to a 96-well plate, 100 μl / well, and coat overnight at 4°C.
[0185] 2. Washing: Wash 5 times with 300 μl / well of PBST (phosphate buffered saline containing 0.05 v / v% Tween 20, pH 7.4, the same below), 1 minute each time.
[0186] 3. Blocking: Block with 5 w / v% (5 g / 100 ml) skim milk (solvent is PBS), 200 μl / well, incubate at 37°C for 2 hours.
[0187] 4. Washing: Same as 2.
[0188] 5. Adding antibody: Dilute antibody 1 (antibody P72-2F3, 1 mg / ml) with PBS at a volume ratio of 1:100, add it to a 96-well plate, 100 μl / well, and incubate at 37°C for 2 hours.
[0189] 6. Washing: Same as 2.
[0190] 7. Enzyme-labeled antibody: Dilute the enzyme-labeled antibody (horseradish peroxidase-labeled goat anti-mouse IgG antibody, concentration 0.5 mg / ml, purchased from ZSGB-BIO, product number ZB-5305) with PBS at a volume ratio of 1:10,000, 100 μl / well, and incubate at 37°C for 45 minutes.
[0191] 8. Washing: Same as 2.
[0192] 9. Color development: Add 50 μl of TMB substrate color development solution (InnoReagents, TMB-S-004) to each well for color development, and react at 37°C in the dark for 10 minutes.
[0193] 10. Termination: Add 50 μl of termination solution (2M H2SO4) to each well.
[0194] 11. Reading: Measure the OD 450nm value within 5 minutes after termination.
[0195] Calculate according to the following formula, S / N value = sample OD 450nm / average OD of negative control 450nm .
[0196] The judgment criterion is: S / N value higher than 2.1 is positive, lower than 2.1 is negative.
[0197] Use antibody ASFV-4H7 to replace antibody P72-2F3, set up a positive control (positive mouse serum immunized with P72 protein) and a negative control (ASFV-negative mouse serum), and the other methods and steps are the same as those in the aforementioned ELISA operation.
[0198] The results are shown in Table 1. It can be seen that monoclonal antibody 1 and monoclonal antibody 2 can bind to the p72 protein.
[0199] Table 1. ELISA detection results of P72 protein and monoclonal antibodies
[0200]
[0201] (IV) Typing and gene sequence determination of monoclonal antibodies
[0202] Use a mouse immunoglobulin typing kit (supplier: SouthernBiotech, product number 5300-05) to type and identify monoclonal antibody 1 (antibody P72-2F3) and monoclonal antibody 2 (antibody ASFV-4H7), and it is found that the first monoclonal antibody is of κ light chain and IgG1 type, and the second monoclonal antibody is of κ light chain and IgG1 type.
[0203] Total RNA of hybridoma 1 and hybridoma 2 was obtained by the Trizol method respectively, reverse transcribed into cDNA, multiple primer pairs were designed according to the conserved sequences of mouse antibody genes, cDNA was amplified by PCR, the amplified products were sequenced, and combined with the use of NCBI Nucleotide BLAST, IMGT / V Quest program and NCBI IgBLAST tools, the coding sequences of antibody 1 and antibody 2 were spliced, and their heavy chain coding sequences and light chain coding sequences were sorted out.
[0204] The key sequences of antibody P72-2F3 are as follows:
[0205] Heavy chain CDR1 coding sequence (SEQ ID NO.2):
[0206] AGCTATGTTATGCAC
[0207] Heavy chain CDR1 protein sequence (SEQ ID NO.3):
[0208] SYVMH
[0209] Heavy chain CDR2 coding sequence (SEQ ID NO.4):
[0210] TATATTAATGCATACATTGCTGATACAAAGTACAATGAGAAGTTTAT AGGC
[0211] Heavy chain CDR2 protein sequence (SEQ ID NO.5):
[0212] YINAYIADTKYNEKFIG
[0213] Heavy chain CDR3 coding sequence (SEQ ID NO.6):
[0214] GGGAGAATTTACTACGGTGCAAACTTTTACTTTGACTAC
[0215] Heavy chain CDR3 protein sequence (SEQ ID NO.7):
[0216] GRIYYGANFYFDY
[0217] Light chain CDR1 coding sequence (SEQ ID NO.8):
[0218] AGAGCCAGTAAAGCAGTTGATAGATATGGCAATAGTTTTATGCAT
[0219] Light chain CDR1 protein sequence (SEQ ID NO.9):
[0220] RASKAVDRYGNSFMH
[0221] Light chain CDR2 coding sequence (SEQ ID NO.10):
[0222] CTTGCATCCAACCTAGAAGCA
[0223] Light chain CDR2 protein sequence (SEQ ID NO.11):
[0224] LASNLEA
[0225] Light chain CDR3 coding sequence (SEQ ID NO.12):
[0226] CAGCAAAATAATGAGGATCCTGCAACG
[0227] Light chain CDR3 protein sequence (SEQ ID NO.13):
[0228] QQNNEDPAT
[0229] Key sequences of antibody ASFV-4H7 are as follows:
[0230] Heavy chain CDR1 coding sequence (SEQ ID NO.14):
[0231] TCTGGGTTTTCATTAACCGCATAT
[0232] Heavy chain CDR1 protein sequence (SEQ ID NO.15):
[0233] SGFSLTAY
[0234] Heavy chain CDR2 coding sequence (SEQ ID NO.16):
[0235] CTGGAGGCACTGGGAGTCATATGGGCTGGTGGAAGCACAATTTATA AT
[0236] Heavy chain CDR2 protein sequence (SEQ ID NO.17):
[0237] LEALGVIWAGGSTIYN
[0238] Heavy chain CDR3 coding sequence (SEQ ID NO.18):
[0239] GATCGGAATGATGCATTTGCTTACTGGGGC
[0240] Heavy chain CDR3 protein sequence (SEQ ID NO.19):
[0241] DRNDAFAYWG
[0242] Light chain CDR1 coding sequence (SEQ ID NO.20):
[0243] CAAAGTCTTGCAAAC
[0244] Light chain CDR1 protein sequence (SEQ ID NO.21):
[0245] QSLAN
[0246] Light chain CDR2 coding sequence (SEQ ID NO.22):
[0247] CCAAGGCTTCTCATCAAGTATGCTGCACAGTCCATC
[0248] Light chain CDR2 protein sequence (SEQ ID NO.23):
[0249] PRLLIKYAAQSI
[0250] Light chain CDR3 coding sequence (SEQ ID NO.24):
[0251] AGTGACGCATGGCCTCTC
[0252] Light chain CDR3 protein sequence (SEQ ID NO.25):
[0253] SDAWPL
[0254] The hybridoma cell 1 (secreting monoclonal antibody 1, P72-2F3) prepared in the present invention was deposited with a patent procedure-approved preservation institution. The preservation unit is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial deposit number is CCTCC NO: C2024209; the name of the culture is Hybridoma cell line 2F3; the Chinese taxonomic name is: Hybridoma cell; the English taxonomic name is: Hybridoma Cell; the preservation time is July 26, 2024; the identification survival time is July 31, 2024.
[0255] The hybridoma cell 2 (secreting monoclonal antibody 2, ASFV-4H7) prepared in the present invention was deposited with a patent procedure-approved preservation institution. The preservation unit is the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the microbial deposit number is CCTCC NO: C2024214; the name of the culture is Hybridoma cell line 4H7; the Chinese taxonomic name is: Hybridoma cell; the English taxonomic name is: Hybridoma Cell; the preservation time is July 26, 2024; the identification survival time is July 31, 2024.
[0256] Example 2: Preparation of an African swine fever P72 protein detection test card
[0257] (I) Structure of the test card
[0258] As Figure 5 shown, the African swine fever antigen detection test strip of the present invention comprises a sample pad, a blood filtration membrane, a gold pad, a nitrocellulose membrane and a water absorption pad which are sequentially overlapped on a PVC board, and a detection line and a quality control line are provided on the nitrocellulose membrane.
[0259] II. Preparation of colloidal gold-labeled antibody
[0260] (1) Preparation of colloidal gold solution
[0261] Take 1 ml of 1% chloroauric acid solution (the solvent is ultrapure water), add it to a conical flask containing 99 ml of ultrapure water to make a 0.01% chloroauric acid solution, shake well and then place it in an intelligent heating sleeve and heat it to boiling. Quickly add 1.6 ml of 1% trisodium citrate aqueous solution, shake well, and continue heating for about 10 minutes until the solution turns into a bright wine red color. Turn off the heating switch, cool to room temperature (15 - 25°C), restore the volume to the original volume with ultrapure water, dispense it into brown reagent bottles, and store it in the dark at 2 - 8°C.
[0262] (2) Preparation of the First Monoclonal Antibody Labeled with Gold
[0263] Take 100 ml of colloidal gold solution and place it on a magnetic stirrer. Adjust the pH value to 8.2 with 0.1 mol / L aqueous potassium carbonate solution. Take 0.15 ml of a 10 mg / ml solution of the first monoclonal antibody protein (antibody P72-2F3) (the solvent is PBS), and add it drop by drop to the colloidal gold solution while stirring (stirring speed 200 r / min). After adding, continue stirring for 60 minutes. Add 10% bovine serum albumin solution (the solvent is PBS) to a final concentration of 1%, add it while stirring, and continue stirring for 60 minutes after adding. Centrifuge the gold-labeled first monoclonal antibody at 2000 g for 20 minutes at 2 - 8°C, and take the supernatant; centrifuge the supernatant at 10000 g for 20 minutes at 2 - 8°C, discard the supernatant and the purple-black gold particles on the tube wall, and carefully aspirate the flowable dark red precipitate at the bottom of the tube. Dissolve the precipitate with 5 ml of gold-labeled diluent (Preparation method of gold-labeled diluent: Weigh 1.0 g of bovine serum albumin, 5.0 g of sucrose, and 2.0 g of trehalose, dissolve them in 100 mL of phosphate (20 mmol / L, pH value 7.4) buffer solution, stir until completely dissolved, add 150 μL of TritonX-100, stir evenly, and filter and sterilize with a 0.22 μm filter membrane. Store at 2 - 8°C.). Mix well and store in the dark at 2 - 8°C.
[0264] (3) Preparation of the Gold Pad
[0265] Soak glass fiber in the gold pad treatment solution (Preparation method of gold pad treatment solution: Weigh 1.0 g of bovine serum albumin, 0.5 g of PVP-40, and 1.5 g of sucrose, dissolve them in 100 mL of phosphate (20 mmol / L, pH value 7.4) buffer solution, stir until completely dissolved, add 500 μL of TritonX-100 and 100 μL of proclin-300, stir evenly, and filter and sterilize with a 0.22 μm filter membrane. Store at 2 - 8°C.) for 30 minutes, take it out and drain, then dry it in a room temperature drying room with a humidity of 10 - 30% for 12 - 16 hours. Inject the prepared first monoclonal antibody into the gold spraying instrument, adjust the parameters of the gold spraying instrument to 2.0 μl / cm, and spray the colloidal gold solution onto the treated glass fiber (gold pad). Place the glass fiber sprayed with gold in a drying room with a humidity of 10 - 30% and a temperature of 37°C for 12 - 16 hours. Put the dried glass fiber into a self-sealing bag containing desiccant, label it, and store it sealed.
[0266] (4) Preparation of the Nitrocellulose Coated Membrane
[0267] Cut the NC membrane into strips 30 cm long. Take out the PVC board, which has three double-sided adhesive strips of different widths. The narrow side is on top. Carefully attach the cut blank NC membrane to the PVC board, with the front side of the membrane corresponding to the upper part of the bottom board. Fix the dotting needle above the NC membrane, slightly touching the NC membrane, and adjust the spacing between the two nozzles of the membrane scribing instrument for the test line (T line) and the quality control line (C line) to about 6 mm, corresponding to the T and C marks on the cartridge. Dilute the goat anti-mouse IgG polyclonal antibody (self-made) and the second monoclonal antibody against ASFV (ASFV-4H7) with PBS (0.01 mol / L, pH 7.4) to a final concentration of 1.0 mg / ml. Adjust the parameters of the membrane scribing instrument and spray the diluted goat anti-mouse IgG polyclonal antibody and the second monoclonal antibody onto the quality control line and test line areas of the NC membrane on the PVC bottom board in sequence according to the amount of 1 μl / cm, preparing the C line and the T line. Place the membrane scribing board in a drying room with a humidity of 10 - 30% and a temperature of 37°C and dry it for 12 hours.
[0268] (5) Assembly of the large test card
[0269] Assemble the test strip according to the conventional steps. Attach the NC membrane (with the second monoclonal antibody scribed as the test line and the goat anti-mouse IgG as the quality control line) to the middle of the support plate (PVC board), fix the absorbent paper at one end, attach the gold conjugate pad (sprayed with the first monoclonal antibody labeled with gold) at the other end, and then attach the blood filtration membrane and the sample pad to the gold conjugate pad to assemble a long test strip. Use a strip cutter to cut the assembled test strip into strips with a width of 2.8 mm, finally fix the test strip in the test card and dry it in a drying oven, then package it with an aluminum foil bag, write the date and batch number, and store it for later use.
[0270] (II) Usage and determination
[0271] (1) Usage
[0272] Before use, restore the test strip, sample diluent (PBS), and the sample to be tested to room temperature. Take out the test strip from the packaging aluminum foil bag, and place it flat on the table with the sample hole (S) and the test area facing up. Use a sample dropper to suck the serum or whole blood sample, and drop 1 drop (about 20 μl) into the sample hole (S, corresponding to the sample pad in position), then drop 2 drops (about 80 μl) of the sample diluent into the sample addition hole (S). Start timing after adding the sample. Let it stand for 10 - 15 minutes, and carefully observe the color reaction of the T line (test line) and the C line (quality control line) in the test area window.
[0273] (2) Determination
[0274] If two purple-red bands (T line and C line) appear on the test strip, it is judged as positive. If only one purple-red band (C line) appears on the test strip, it is judged as negative. If no purple-red band appears at the C line on the test strip, it is judged as invalid.
[0275] Example 3: Test on the specificity of the African swine fever P72 protein detection card
[0276] Take 10 6.5 TCID 50 / ml PCV (Porcine circovirus) strain 2d, 10 7.5 TCID 50 / ml PRRSV (Porcine reproductive and respiratory syndrome virus) strain HuN4, 10 8.0 TCID 50 / ml PRV (Pseudorabies virus) strain HeN1, 10 6.0 TCID 50 / ml PEDV (Porcine epidemic diarrhea virus) strain LN-NY, 10 6.7 TCID 50 / ml TGEV (Transmissible gastroenteritis virus of swine) strain JMS, 10 7.0 TCID 50 / ml ASFV (African swine fever virus) strain HLJ / HRB1 / 20 as the test samples, and the supernatant of PAM cell culture as the negative control (Neg). Add the samples to the sample addition hole of the detection card and perform the detection according to the usage and judgment of the detection card in Example 2. The results are shown in Figure 6 .
[0277] It can be seen that both the test line and the quality control line of the detection card with the addition of African swine fever virus are colored, and only the quality control line of the detection cards of other samples is colored. The detection card prepared in Example 2 has good specificity for the detection of African swine fever virus.
[0278] Example 4: Test on the detection limit (sensitivity) of the African swine fever P72 protein detection card
[0279] Inoculate PAM cells with good growth at a dose of 10000 TCID 50 / ml with ASFV strain HLJ / HRB1 / 20 (GenBank accession number MW656282.1). Place the culture flask in an incubator at 37°C and 5% CO2 for culture. Harvest the virus solution when the CPE reaches 80%, and measure its virus titer to be 10 7.2 TCID 50 / ml. At the same time, add 0.1% formaldehyde aqueous solution to the virus solution and inactivate it at 37°C for 36 h. Then dilute the culture with PBS into a series of concentrations of 10 7.2 TCID 50 / ml, 10 6.2 TCID 50 / ml, 10 5.2 TCID 50 / ml, 10 4.2TCID 50 / ml, 10 3.2 TCID 50 / ml.
[0280] Drop the aforementioned diluted samples into the sample adding holes of the test cards in Example 2 respectively, and perform the detection according to the method in Example 2. For the results, see Figure 7 , in Figure 7 , from left to right, the five test cards respectively represent the display conditions of the test cards corresponding to the aforementioned 5 diluted samples in sequence.
[0281] Thus, it can be seen that the sensitivity of the test card is good and it can detect African swine fever virus particles with a content as low as 10 3.2 TCID 50 / ml.
[0282] As is known by common technical knowledge, the present invention can be implemented by other embodiments that do not depart from its spiritual essence or essential features. Therefore, the above-disclosed embodiments are illustrative in all aspects and not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are encompassed by the present invention.
Claims
1. A hybridoma cell, wherein the hybridoma cell is a first hybridoma cell, a second hybridoma cell, or a combination of the first hybridoma cell and the second hybridoma cell; The first hybridoma cell is a hybridoma cell with a microbial deposit number of CCTCC NO: C2024209; The second hybridoma cell is a hybridoma cell with a microbial preservation number of CCTCC NO: C2024214.
2. A monoclonal antibody, wherein the monoclonal antibody is a first monoclonal antibody, a second monoclonal antibody, or a combination of the first monoclonal antibody and the second monoclonal antibody; The first monoclonal antibody maintains specific binding activity to the P72 protein of African swine fever virus; The first monoclonal antibody comprises a first monoclonal antibody heavy chain and a first monoclonal antibody light chain; The first monoclonal antibody heavy chain comprises a first monoclonal antibody heavy chain CDR1, a first monoclonal antibody heavy chain CDR2 and a first monoclonal antibody heavy chain CDR3; The first monoclonal antibody light chain includes a first monoclonal antibody light chain CDR1, a first monoclonal antibody light chain CDR2, and a first monoclonal antibody light chain CDR3; The heavy chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 3; The heavy chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 5; The heavy chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 7; The light chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 9; The light chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 11; The light chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 13; The second monoclonal antibody maintains specific binding activity to the African swine fever virus P72 protein; The second monoclonal antibody comprises a second monoclonal antibody heavy chain and a second monoclonal antibody light chain; The second monoclonal antibody heavy chain comprises a second monoclonal antibody heavy chain CDR1, a second monoclonal antibody heavy chain CDR2, and a second monoclonal antibody heavy chain CDR3; The second monoclonal antibody light chain comprises a second monoclonal antibody light chain CDR1, a second monoclonal antibody light chain CDR2, and a second monoclonal antibody light chain CDR3; The heavy chain CDR1 protein sequence of the second monoclonal antibody is shown in SEQ ID NO. 15; The second monoclonal antibody heavy chain CDR2 protein sequence is shown in SEQ ID NO. 17; The second monoclonal antibody heavy chain CDR3 protein sequence is shown in SEQ ID NO. 19; The second monoclonal antibody light chain CDR1 protein sequence is shown in SEQ ID NO. 21; The second monoclonal antibody light chain CDR2 protein sequence is shown in SEQ ID NO. 23; The light chain CDR3 protein sequence of the second monoclonal antibody is shown in SEQ ID NO.
25.
3. A combination of a monoclonal antibody heavy chain and a monoclonal antibody light chain, wherein the combination of a monoclonal antibody heavy chain and a monoclonal antibody light chain comprises a combination of a monoclonal antibody heavy chain and a monoclonal antibody light chain 1, a combination of a monoclonal antibody heavy chain and a monoclonal antibody light chain 2, or a combination of a monoclonal antibody heavy chain and a monoclonal antibody light chain 1 and a monoclonal antibody heavy chain and a monoclonal antibody light chain 2; The monoclonal antibody heavy chain and monoclonal antibody light chain combination 1 maintains specific binding activity to the African swine fever virus P72 protein; The monoclonal antibody heavy chain and monoclonal antibody light chain combination 1 comprises a first monoclonal antibody heavy chain and a first monoclonal antibody light chain; The first monoclonal antibody heavy chain includes a first monoclonal antibody heavy chain CDR1, a first monoclonal antibody heavy chain CDR2, a first monoclonal antibody heavy chain CDR3 and a tag peptide and / or a signal peptide for separating and purifying the protein; The first monoclonal antibody light chain includes a first monoclonal antibody light chain CDR1, a first monoclonal antibody light chain CDR2, a first monoclonal antibody light chain CDR3 and a tag peptide and / or a signal peptide for separating and purifying the protein; The heavy chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 3; The heavy chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 5; The heavy chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 7; The light chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 9; The light chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 11; The light chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 13; The monoclonal antibody heavy chain and monoclonal antibody light chain combination 2 maintains specific binding activity to the African swine fever virus P72 protein; The monoclonal antibody heavy chain and monoclonal antibody light chain combination 2 comprises a second monoclonal antibody heavy chain and a second monoclonal antibody light chain; The second monoclonal antibody heavy chain includes a second monoclonal antibody heavy chain CDR1, a second monoclonal antibody heavy chain CDR2, a second monoclonal antibody heavy chain CDR3 and a tag peptide and / or a signal peptide for separating and purifying the protein; The second monoclonal antibody light chain includes a second monoclonal antibody light chain CDR1, a second monoclonal antibody light chain CDR2, a second monoclonal antibody light chain CDR3 and a tag peptide and / or a signal peptide for separating and purifying the protein; The heavy chain CDR1 protein sequence of the second monoclonal antibody is shown in SEQ ID NO. 15; The second monoclonal antibody heavy chain CDR2 protein sequence is shown in SEQ ID NO. 17; The second monoclonal antibody heavy chain CDR3 protein sequence is shown in SEQ ID NO. 19; The second monoclonal antibody light chain CDR1 protein sequence is shown in SEQ ID NO. 21; The second monoclonal antibody light chain CDR2 protein sequence is shown in SEQ ID NO. 23; The light chain CDR3 protein sequence of the second monoclonal antibody is shown in SEQ ID NO.
25.
4. An antibody derivative, wherein the form of the antibody derivative is selected from: enzyme-labeled antibody, fluorescent-labeled antibody, colloidal gold-labeled antibody, antibody Fab fragment, porcine antibody; The antibody derivative is a first antibody derivative, a second antibody derivative, or a combination of the first antibody derivative and the second antibody derivative; The first antibody derivative retains specific binding activity to African swine fever virus P72 protein; The heavy chain protein sequence portion of the first antibody derivative contains the first monoclonal antibody heavy chain CDR1, the first monoclonal antibody heavy chain CDR2 and the first monoclonal antibody heavy chain CDR3; the light chain protein sequence portion of the first antibody derivative contains the first monoclonal antibody light chain CDR1, the first monoclonal antibody light chain CDR2 and the first monoclonal antibody light chain CDR3; The heavy chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 3; The heavy chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 5; The heavy chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 7; The light chain CDR1 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 9; The light chain CDR2 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 11; The light chain CDR3 protein sequence of the first monoclonal antibody is shown in SEQ ID NO. 13; The second antibody derivative retains specific binding activity to African swine fever virus P72 protein; The heavy chain protein sequence portion of the second antibody derivative contains the second monoclonal antibody heavy chain CDR1, the second monoclonal antibody heavy chain CDR2 and the second monoclonal antibody heavy chain CDR3; the light chain protein sequence portion of the second antibody derivative contains the second monoclonal antibody light chain CDR1, the second monoclonal antibody light chain CDR2 and the second monoclonal antibody light chain CDR3; The heavy chain CDR1 protein sequence of the second monoclonal antibody is shown in SEQ ID NO. 15; The second monoclonal antibody heavy chain CDR2 protein sequence is shown in SEQ ID NO. 17; The second monoclonal antibody heavy chain CDR3 protein sequence is shown in SEQ ID NO. 19; The second monoclonal antibody light chain CDR1 protein sequence is shown in SEQ ID NO. 21; The second monoclonal antibody light chain CDR2 protein sequence is shown in SEQ ID NO. 23; The light chain CDR3 protein sequence of the second monoclonal antibody is shown in SEQ ID NO.
25.
5. An RNA combination, the RNA combination comprising a first RNA combination, a second RNA combination, or a combination of the first RNA combination and the second RNA combination; The first RNA combination includes a first monoclonal antibody heavy chain RNA and a first monoclonal antibody light chain RNA; The first monoclonal antibody heavy chain RNA can be translated to obtain the first monoclonal antibody heavy chain according to claim 2 or 3; The first monoclonal antibody light chain RNA can be translated to obtain the first monoclonal antibody light chain according to claim 2 or 3; The second RNA combination includes a second monoclonal antibody heavy chain RNA and a second monoclonal antibody light chain RNA; The second monoclonal antibody heavy chain RNA can be translated to obtain the second monoclonal antibody heavy chain according to claim 2 or 3; The second monoclonal antibody light chain RNA can be translated to obtain the second monoclonal antibody light chain according to claim 2 or 3.
6. A gene combination, the gene combination comprising a first gene combination, a second gene combination, or a combination of the first gene combination and the second gene combination; The coding sequence of the first gene combination can encode the first monoclonal antibody heavy chain described in claim 2 or 3 and the first monoclonal antibody light chain described in claim 2 or 3; The coding sequence of the second gene combination can encode the second monoclonal antibody heavy chain as claimed in claim 2 or 3 and the second monoclonal antibody light chain as claimed in claim 2 or 3.
7. A gene expression cassette combination, the gene expression cassette combination comprising a first gene expression cassette combination, a second gene expression cassette combination, or a combination of the first gene expression cassette combination and the second gene expression cassette combination; The gene expression product in the first gene expression cassette combination is the first RNA combination described in claim 5; The gene expression product in the second gene expression cassette combination is the second RNA combination described in claim 5.
8. A genetic engineering vector, comprising a first genetic engineering vector, a second genetic engineering vector, or a combination of the first genetic engineering vector and the second genetic engineering vector; The first genetic engineering vector contains the first gene expression cassette described in claim 7; The first monoclonal antibody heavy chain RNA and the first monoclonal antibody light chain RNA are encoded in one or two vectors; The second genetic engineering vector contains the second gene expression cassette described in claim 7; The second monoclonal antibody heavy chain RNA and the second monoclonal antibody light chain RNA are encoded in one or two vectors.
9. A cell, comprising a first cell, a second cell, or a combination of the first cell and the second cell; The first cell contains the first genetic engineering vector described in claim 8; The coding gene in the gene expression cassette of the first genetic engineering vector is constitutively expressed or artificially induced; When the first monoclonal antibody heavy chain RNA and the first monoclonal antibody light chain RNA are encoded in two vectors, the two vectors are in the same cell or in different cells; The second cell contains the second genetic engineering vector described in claim 8; The coding gene in the gene expression cassette of the second genetic engineering vector is constitutively expressed or artificially induced; When the second monoclonal antibody heavy chain RNA and the second monoclonal antibody light chain RNA are encoded in two vectors, the two vectors are in the same cell or in different cells.
10. A composition, which is the first composition or the second composition; The first composition contains the first monoclonal antibody described in claim 2, the monoclonal antibody heavy chain and monoclonal antibody light chain combination 1 described in claim 3, or the first antibody derivative described in claim 4; The second composition contains the second monoclonal antibody described in claim 2, the monoclonal antibody heavy chain and monoclonal antibody light chain combination 2 described in claim 3, or the second antibody derivative described in claim 4.
11. A kit, wherein the kit is a first kit, a second kit, or a combination of the first kit and the second kit; The first kit contains the first monoclonal antibody described in claim 2, the monoclonal antibody heavy chain and monoclonal antibody light chain combination 1 described in claim 3, or the first antibody derivative described in claim 4; The second kit contains the second monoclonal antibody described in claim 2, the monoclonal antibody heavy chain and monoclonal antibody light chain combination 2 described in claim 3, or the second antibody derivative described in claim 4.
12. The monoclonal antibody according to claim 2, characterized in that The first monoclonal antibody is the monoclonal antibody secreted by the first hybridoma cell according to claim 1, and / or The second monoclonal antibody is a monoclonal antibody secreted by the second hybridoma cell according to claim 1.
13. The monoclonal antibody according to claim 2, characterized in that The amino acid sequence of the African swine fever virus P72 protein is shown in SEQ ID NO.
1.
14. Use of the monoclonal antibody of claim 2, 12 or 13, or the monoclonal antibody heavy chain and monoclonal antibody light chain combination of claim 3, in the preparation of a preparation for detecting African swine fever virus P72 protein, African swine fever virus subviral particles containing African swine fever virus P72 protein, or African swine fever virus particles.
15. The use according to claim 14, characterized in that The amino acid sequence of the African swine fever virus P72 protein is shown in SEQ ID NO.
1.
16. A test card for detecting biological substances, the test card comprising a colloidal gold pad and a test line; The test card is a first test card or a second test card; In the first test card, the colloidal gold pad contains monoclonal antibody a labeled with colloidal gold, and the test line contains monoclonal antibody b; The monoclonal antibody a is any one of the first monoclonal antibody and the second monoclonal antibody in claim 2, 12 or 13; the monoclonal antibody b is the other one of the first monoclonal antibody and the second monoclonal antibody in claim 2, 12 or 13; In the second test card, the colloidal gold pad contains colloidal gold-labeled monoclonal antibody c, and the test line contains monoclonal antibody d; or the colloidal gold pad contains colloidal gold-labeled monoclonal antibody d, and the test line contains monoclonal antibody c; The monoclonal antibody c is the first monoclonal antibody or the second monoclonal antibody in claim 2, 12 or 13; the monoclonal antibody d is a mouse-derived anti-African swine fever virus P72 protein monoclonal antibody IgG, and the anti-African swine fever virus P72 protein epitopes recognized by the monoclonal antibody d and the first monoclonal antibody and the second monoclonal antibody in claim 2, 12 or 13 are different; the biological substance is selected from: A mixture containing African swine fever virus P72 protein; A mixture containing African swine fever virus particles; A mixture comprising African swine fever virus subviral particles containing African swine fever virus P72 protein.
17. The test card according to claim 16, characterized in that: The detection card also contains a bottom plate, a sample pad, a water-permeable membrane, a water-absorbing pad and a quality control line.
18. The test card according to claim 17, characterized in that: The sample pad, the colloidal gold pad, the water-permeable membrane and the water-absorbing pad are arranged in sequence from one end to the other end on one side of the bottom plate, and the quality control line and the detection line are arranged on the water-permeable membrane.
19. The test card according to claim 17 or 18, characterized in that: A blood filter membrane is also arranged between the sample pad and the colloidal gold pad.
20. The test card according to claim 17 or 18, characterized in that: The amino acid sequence of the African swine fever virus P72 protein is shown in SEQ ID NO.
1.
21. The test card according to claim 17 or 18, characterized in that: The quality control line is provided with anti-mouse IgG antibody.
22. The test card according to claim 17 or 18, characterized in that: The water permeable membrane is a nitrocellulose membrane.
23. The test card according to claim 17 or 18, characterized in that: The bottom plate is a PVC plate.
24. The test card according to claim 17 or 18, characterized in that: The GenBank number of the African swine fever virus is MZ945537.1 or MW656282.1, or The microbial preservation number of the African swine fever virus is: CCTCC NO: V201924.
Citation Information
Patent Citations
Gene-deleted attenuated African swine fever virus and its application as a vaccine
CN110093324B
Immunofluorescence Detection Method for African Swine Fever Virus Antibodies Based on Wild Boar Kidney Cells
CN115896004B
Colloidal gold detection card for detecting African swine fever virus P72 protein
CN118909962A
Colloidal gold detection system for detecting African swine fever virus P72 protein
CN118909963A