A thioether monooxygenase mutant and its application in esomeprazole synthesis

Abstract

The present application relates to a kind of sulfide monooxygenase mutant and its application in esomeprazole synthesis.The sulfide monooxygenase mutant, its encoding gene, the preparation method of the recombinant expression vector containing the gene sequence, co-expression recombinant vector and recombinant expression transformant, and the application of the recombinant sulfide monooxygenase mutant catalyst in esomeprazole synthesis are specifically disclosed.Compared with other sulfide monooxygenases, the sulfide monooxygenase mutant obtained by the present application can efficiently utilize the coenzyme NADH with lower cost and higher stability to catalyze the asymmetric oxidation reaction of omeprazole sulfide, prepare esomeprazole, has the advantages of high substrate concentration, mild reaction condition, environment-friendly, simple operation, high yield, low production cost and good industrial application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and specifically relates to a thioether monooxygenase mutant, a gene encoding the thioether monooxygenase mutant, a recombinant expression vector containing the gene sequence, a co-expression recombinant vector and a recombinant expression transformant, a recombinant thioether monooxygenase mutant catalyst and a preparation method thereof, and use of the thioether monooxygenase mutant or the recombinant thioether monooxygenase mutant catalyst in the synthesis of esomeprazole. Background Art

[0002] Proton Pump Inhibitors (PPIs) are a class of special sulfoxide compounds containing benzimidazole, sulfinyl, and pyridine rings, and are considered the best treatment for gastroesophageal reflux disease (GERD). PPIs reduce gastric acid secretion by inhibiting the hydrogen-potassium ATPase pump, and have superior efficacy, durability, and safety compared to traditional histamine-H2 receptor antagonists (H2RAs). Since the first PPI, omeprazole, was launched in Sweden in 1987, a variety of PPIs have been introduced, and they have now become the most widely used drugs for the treatment of gastroesophageal diseases. Notably, chiral PPIs exhibit stronger acid suppression, longer duration of action, and higher bioavailability than racemic PPIs, and are gradually becoming the preferred drugs for the treatment of gastric acid digestive diseases.

[0003] Esomeprazole, also known as (S)-omeprazole, is the S-configured optical isomer of omeprazole and the first marketed chiral proton pump inhibitor (PPI). Developed by AstraZeneca and approved for marketing in 2001, esomeprazole's chemical name is S-5-methoxy-2-[[(4-methoxy-3,5-dimethyl-2-pyridyl)methyl]sulfinyl]-1H-benzimidazole. Currently, the primary commercially available form is (S)-omeprazole magnesium trihydrate. Compared to racemic omeprazole, esomeprazole exhibits superior clinical properties, including improved safety and efficacy, better control of gastric acid secretion and symptom relief, a longer duration of action, and reduced dosing frequency. These advantages have made esomeprazole one of the world's best-selling drugs, securing a prominent position in the treatment of digestive diseases.

[0004] Currently, the industrial production of PPIs primarily relies on chemical synthesis. However, this method suffers from numerous drawbacks: the extensive use of organic solvents, cumbersome product purification steps, and the generation of wastewater and exhaust gases, which not only impact the health of operators but also negatively impact the environment. Furthermore, the use of expensive transition metal catalysts and the low stereoselectivity of the reaction further increase production costs. Current industrial production of esomeprazole suffers from the following major challenges: expensive chiral catalysts and poor stereoselectivity; the extensive use of peracids, H₂O₂, organic catalysts, and solvents, which harm the environment and human health; and harsh reaction conditions, which place high demands on production equipment and increase costs. Therefore, to meet the demand for green production, the development of biosynthetic methods with high catalytic selectivity, mild reaction conditions, and green and efficient processes has become an important complement to chemical synthesis.

[0005] Currently, the biosynthesis of esomeprazole mainly uses prochiral thioethers as substrates and utilizes whole-cell or free enzyme-catalyzed asymmetric oxidation. Reported biocatalysts include: (1) Cunninghamella echinulata MK40: can catalyze 7.5mM omeprazole sulfide, but the conversion rate is only 45% (Nagasawa T. Microbial synthesis of aprotonpump inhibitor by enantioselective oxidation of a sulfide into its corresponding sulfoxide by Cunninghamella echinulate MK40); 2) Lysinibacillus sp. B71 cells can catalyze 0.1g / L substrate with a conversion rate of 70% (Pavel Kyslík. Whole-cell oxidation of omeprazole sulfide to enantiopure esomeprazole with Lysinibacillus sp. B71); (3) PAMO from Limnobacter sp.: can catalyze 50mM substrate through whole cells (Juan Lin. “Nonpolarity paving” in substrate tunnel of a Limnobacter sp. Phenylacetone monooxygenase for efficient single whole-cell synthesis of esomeprazole); (4) Acinetobacter calcoaceticus NCIMB 9871 cyclohexanone monooxygenase mutant: can catalyze 100 g / L substrate, but requires batch addition of freeze-dried enzyme powder (Codexis patent WO2011071982); (5) The mutant in patent CN108118035A: can catalyze 165 g / L substrate, but has problems such as large enzyme dosage and poor tolerance.

[0006] Most monooxygenases (BVMOs) are NADPH-dependent. NADPH is more expensive and less stable than NADH, making it unsuitable for large-scale production. Therefore, more and more studies have been conducted on coenzymes. Reported studies on coenzyme modification include: (1) modification of 4-hydroxyacetophenone monooxygenase (HAPMO) by sequence alignment analysis, which improved its catalytic performance towards NADH by about 6.7 times (Albert JRHeck. Coenzyme Binding during Catalysis Is Beneficialfor the Stability of 4-Hydroxyacetophenone Monooxygenase); (2) sequence alignment and structural analysis of phenylacetone monooxygenase (PAMO), which improved its catalytic performance towards NADH by about 3.3 times (Marco W. Fraaije. Investigating the coenzyme specificity of phenylacetonemonooxygenase from Thermobifida fusca). (3) modification of cyclohexanone monooxygenase (CHMO) by sequence alignment and structural analysis. NCIMB9871 ) improved its catalytic performance towards NADH by approximately eightfold through structural analysis, sequence alignment, and literature review (Uwe T. Bornscheuer. Switch in Cofactor Specificity of a Baeyer-Villiger Monooxygenase). Currently, most of the above studies address the issue of coenzyme preference. While these improvements have been made towards NADH, the overall catalytic efficiency remains too low, limiting its large-scale application.

[0007] These studies demonstrate that while a variety of biocatalysts (such as BVMOs) have been developed for the synthesis of esomeprazole, they generally suffer from low catalytic efficiency, poor stability, and low substrate tolerance. Furthermore, the high cost and poor stability of utilizing the coenzyme NADPH make it difficult to meet the demands of industrial production. Therefore, the development of biocatalysts that efficiently utilize NADH remains an important research direction in this field. Summary of the Invention

[0008] The purpose of the present invention is to solve the problem in the prior art of the lack of a biocatalyst, thioether monooxygenase, that can efficiently utilize NADH and is used for the synthesis of esomeprazole. The present application further provides a thioether monooxygenase mutant, a gene encoding the thioether monooxygenase, a recombinant expression vector containing the gene sequence, a co-expression recombinant vector 0 and a recombinant expression transformant, a recombinant thioether monooxygenase mutant catalyst and a preparation method thereof, as well as the use of the thioether monooxygenase mutant or the recombinant thioether monooxygenase mutant catalyst in the synthesis of esomeprazole.

[0009] The present invention utilizes directed evolution strategies such as error-prone PCR, site-directed mutagenesis, and combinatorial mutagenesis to provide a thioether monooxygenase mutant with significantly improved performance in catalyzing the synthesis of esomeprazole and the ability to efficiently utilize the coenzyme NADH. This thioether monooxygenase mutant catalyzes the asymmetric oxidation of the substrate omeprazole thioether to synthesize esomeprazole, exhibiting significant advantages such as low coenzyme cost, high stability, high substrate concentration, mild reaction conditions, environmental friendliness, high product yield, and high optical purity.

[0010] The purpose of the present invention can be achieved by the following technical solutions:

[0011] One of the technical solutions of the present invention is to provide a thioether monooxygenase mutant, that is, to provide an isolated protein that can be used as a thioether monooxygenase, wherein the parent of the mutant is AcPSMO, which is derived from Acinetobacter calcoaceticus; the encoding gene of AcPSMO is shown in SEQ ID No. 1, and the amino acid sequence of AcPSMO is shown in SEQ ID No. 2.

[0012] The thioether monooxygenase mutant replaces one or more amino acid residues at position 56 Ser, position 70 Glu, position 123 Asn, position 128 Asn, position 133 Thr, position 143 Leu, position 145 Ala, position 146 Ala, position 148 Asn, position 149 Leu, position 151 Lys, position 207 Arg, position 208 Ser, position 209 Ala, position 210 Gln, position 349 Lys, position 376 Cys, and position 526 Lys of the amino acid sequence shown in SEQ ID No. 2 with other amino acid residues to form a protein corresponding to the new amino acid sequence.

[0013] Preferably, the thioether monooxygenase mutant has one of the following sequences:

[0014] (1) replacing Ser at position 56 of the amino acid sequence shown in SEQ ID No. 2 with Val;

[0015] (2) replacing Glu at position 70 of the amino acid sequence shown in SEQ ID No. 2 with Thr;

[0016] (3) replacing Asn at position 123 of the amino acid sequence shown in SEQ ID No. 2 with Arg;

[0017] (4) replacing Asn at position 128 of the amino acid sequence shown in SEQ ID No. 2 with His;

[0018] (5) replacing Thr at position 133 of the amino acid sequence shown in SEQ ID No. 2 with Leu;

[0019] (6) replacing Leu at position 143 of the amino acid sequence shown in SEQ ID No. 2 with Phe;

[0020] (7) replacing Ala at position 145 of the amino acid sequence shown in SEQ ID No. 2 with Gly;

[0021] (8) replacing Ala at position 146 of the amino acid sequence shown in SEQ ID No. 2 with Arg;

[0022] (9) replacing Asn at position 148 of the amino acid sequence shown in SEQ ID No. 2 with Trp;

[0023] (10) replacing Leu at position 149 of the amino acid sequence shown in SEQ ID No. 2 with Phe;

[0024] (11) Lys at position 151 of the amino acid sequence shown in SEQ ID No. 2 is replaced with Arg;

[0025] (12) the Arg at position 207 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Lys;

[0026] (13) replacing Ser at position 208 of the amino acid sequence shown in SEQ ID No. 2 with Asp;

[0027] (14) replacing Ala at position 209 of the amino acid sequence shown in SEQ ID No. 2 with Val;

[0028] (15) replacing Gln at position 210 of the amino acid sequence shown in SEQ ID No. 2 with Leu;

[0029] (16) Lys at position 349 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Arg;

[0030] (17) replacing Cys at position 376 of the amino acid sequence shown in SEQ ID No. 2 with Pro;

[0031] (18) Lys at position 526 of the amino acid sequence shown in SEQ ID No. 2 was replaced with His;

[0032] (19) The amino acid sequence shown in SEQ ID No. 2 is replaced by Val at position 56, and by Phe at position 143 by Leu;

[0033] (20) The Asn at position 123 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Arg, and the Ala at position 145 was replaced with Gly;

[0034] (21) The 128th position Asn of the amino acid sequence shown in SEQ ID No. 2 was replaced with His, and the 146th position Ala was replaced with Arg;

[0035] (22) The 149th Leu of the amino acid sequence shown in SEQ ID No. 2 was replaced by Phe, and the 208th Ser was replaced by Asp;

[0036] (23) The 151st Lys of the amino acid sequence shown in SEQ ID No. 2 was replaced by Arg, and the 210th Gln was replaced by Leu;

[0037] (24) The 349th Lys residue in the amino acid sequence of SEQ ID No. 2 was replaced with Arg, and the 526th Lys residue was replaced with His;

[0038] (25) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, and Lys at position 349 is replaced by Arg;

[0039] (26) In the amino acid sequence shown in SEQ ID No. 2, Glu at position 70 is replaced by Thr, Asn at position 148 is replaced by Trp, and Cys at position 376 is replaced by Pro;

[0040] (27) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, Lys at position 349 is replaced by Arg, and Cys at position 376 is replaced by Pro;

[0041] (28) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, and Ser at position 208 is replaced by Asp;

[0042] (29) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 128 is replaced with His, Ala at position 146 is replaced with Arg, Ala at position 209 is replaced with Val, and Gln at position 210 is replaced with Leu;

[0043] (30) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, Lys at position 349 is replaced by Arg, Cys at position 376 is replaced by Pro, and Lys at position 526 is replaced by His;

[0044] (31) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, and Lys at position 349 is replaced by Arg;

[0045] (32) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 128 is replaced with His, Ala at position 146 is replaced with Arg, Ala at position 209 is replaced with Val, Gln at position 210 is replaced with Leu, and Lys at position 151 is replaced with Arg;

[0046] (33) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, and Leu at position 143 is replaced by Phe;

[0047] (34) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, and Ser at position 56 is replaced by Val;

[0048] (35) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, Ser at position 56 is replaced by Val, and Lys at position 526 is replaced by His.

[0049] The protein preparation method of the present invention is conventional in the art. Preferably, the method comprises: cloning a nucleic acid molecule encoding the protein and carrying a point mutation into an expression vector; transforming the resulting recombinant vector into an expression host to obtain a recombinant expression transformant; culturing the resulting recombinant expression transformant; and isolating and purifying the protein. The method can also be achieved by artificially synthesizing the protein sequence.

[0050] A second technical solution of the present invention is to provide a nucleic acid encoding the aforementioned thioether monooxygenase mutant. The nucleic acid encodes and expresses the thioether monooxygenase mutant obtained through evolutionary modification as described in technical solution one. The nucleic acid may be obtained by cloning the gene sequence of the thioether monooxygenase mutant described in technical solution one through genetic engineering techniques, or by obtaining a nucleic acid molecule encoding the thioether monooxygenase mutant described in technical solution one through artificial full-sequence synthesis.

[0051] A third technical solution of the present invention is to provide a recombinant expression vector comprising the aforementioned thioether monooxygenase mutant nucleic acid. The recombinant expression vector can be constructed by conventional methods in the art by ligating the nucleic acid sequence encoding the thioether monooxygenase mutant of the present invention to various commercially available empty vectors.

[0052] Furthermore, the commercially available empty vector can be any of various plasmid vectors commonly used in the art, as long as the recombinant expression vector can replicate normally in the corresponding expression host and express the corresponding thioether monooxygenase. The preferred plasmid vector varies depending on the expression host. Those skilled in the art will readily appreciate how to select appropriate vectors, promoters, enhancers, and host cells.

[0053] Furthermore, for E. coli hosts, the plasmid vector is preferably a pET-28a(+) plasmid. The E. coli recombinant expression plasmid of the present invention can be prepared by the following method: the gene DNA fragment of the thioether monooxygenase mutant obtained by PCR amplification is double-digested with restriction endonucleases Nde I and Hind III, and the empty plasmid pET-28a(+) is also double-digested with restriction endonucleases Nde I and Hind III. The DNA fragment of the thioether monooxygenase mutant and the empty plasmid are recovered after the digestion, and the two are ligated using T4 DNA ligase to obtain a recombinant expression plasmid containing the nucleic acid encoding the thioether monooxygenase mutant for expression in E. coli.

[0054] The fourth technical solution of the present invention is to provide a co-expression recombinant vector comprising the thioether monooxygenase mutant gene and the dehydrogenase gene of the present invention.

[0055] Furthermore, for the E. coli host, the present invention chooses to use the homologous recombination method to construct two target genes in pETDuet-1 containing two multiple cloning sites. The E. coli recombinant expression plasmid of the present invention can be prepared by the following method: first, the target plasmid of dehydrogenase is used as a PCR amplification template, and the target fragment required by this application is amplified using PrimerSTAR Max high-fidelity polymerase, and then the pETDuet-1 plasmid is used as a template for reverse amplification of the linearized vector fragment, which is inserted into the MCS1 multiple cloning site of the pETDuet-1 plasmid using homologous recombination; then the target gene of AcPSMO is amplified, recovered according to the same method, and inserted into the MCS2 multiple cloning site of the pETDuet-1 plasmid using homologous recombination, and then verified to be successful by transformation sequencing.

[0056] The fifth technical solution of the present invention is to provide a recombinant expression transformant comprising the thioether monooxygenase mutant gene, its recombinant expression vector or its co-expression recombinant vector described in the above technical solution of the present invention.

[0057] Furthermore, a recombinant expression transformant can be prepared by transforming the recombinant expression vector constructed in Technical Solution 3 or the co-expression recombinant vector constructed in Technical Solution 4 into a host cell. The host cell can be any conventional host cell in the art, as long as the recombinant expression vector can stably replicate in the host cell and can effectively express the target protein after induction with an inducer. In the present invention, Escherichia coli is preferably used as the host cell, and E. coli BL21 (DE3) is more preferably used for efficiently expressing the thioether monooxygenase mutant described in the present invention.

[0058] The sixth technical solution of the present invention is to provide a recombinant thioether monooxygenase mutant catalyst, wherein the recombinant thioether monooxygenase mutant catalyst is any one of the following forms:

[0059] (1) culturing the recombinant expression transformant of the present invention and isolating transformant cells containing the thioether monooxygenase mutant;

[0060] (2) culturing the recombinant expression transformant of the present invention, isolating and crushing the crude enzyme solution containing the thioether monooxygenase mutant;

[0061] (3) Cultivating the recombinant expression transformant of the present invention, isolating and crushing the thioether monooxygenase mutant to obtain a crude enzyme solution, and freeze-drying the crude enzyme solution to obtain a crude enzyme powder.

[0062] Furthermore, the culture method and conditions of the recombinant expression transformant are conventional methods and conditions in the field, which include the following steps: culturing the recombinant expression transformant of the present invention to obtain recombinant thioether monooxygenase. For recombinant Escherichia coli, the preferred culture medium is LB culture medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 6.5-7.0. The preferred culture method is: inoculate the recombinant Escherichia coli described above into LB culture medium containing kanamycin, and culture overnight at 37°C and 180rpm. The seed liquid is inoculated into a 5L fermentation tank containing 3L LB culture medium (containing kanamycin), and the dissolved oxygen (DO) is controlled to be above 30% by adjusting the stirring speed, adding carbon source and nitrogen source. When the OD of the culture solution is 600 When the pH reaches 8-10, isopropyl-β-D-thiogalactopyranoside (IPTG) is added as an inducer at a final concentration of 0.1-0.5 mmol / L. After induction at 16-25°C for 8-24 hours, the culture medium is centrifuged, the cells are harvested, and then washed twice with physiological saline to obtain recombinant expressing transformant cells. The harvested recombinant cells are freeze-dried to obtain lyophilized cells containing the thioether monooxygenase mutant. The harvested recombinant cells are suspended in 5-10 volumes (v / w) of buffer, ultrasonically disrupted, and centrifuged to collect the supernatant to obtain a crude enzyme solution of the recombinant thioether monooxygenase mutant. The collected crude enzyme solution is frozen at -80°C and then low-temperature dried using a vacuum freeze dryer to obtain lyophilized enzyme powder of the recombinant thioether monooxygenase mutant. The obtained lyophilized cells or lyophilized enzyme powder can be stored in a refrigerator at 4°C for convenient use.

[0063] The seventh technical solution of the present invention is to provide an application of a thioether monooxygenase mutant or a recombinant thioether monooxygenase mutant catalyst. The application uses omeprazole thioether as a substrate and utilizes the thioether monooxygenase mutant or the recombinant thioether monooxygenase mutant catalyst to catalyze the synthesis of esomeprazole (such as omeprazole thioether) from omeprazole thioether.Figure 1 shown).

[0064] The application is carried out in phosphate buffer and requires the coenzyme NADH or NAD + The application also requires the presence of at least any one of glucose, sodium formate, isopropanol and its corresponding dehydrogenase.

[0065] Preferably, the concentration of the substrate omeprazole sulfide of the present invention is 1-30 g / L, the amount of the glucose, sodium formate or isopropanol is 1.5-45 g / L, and the coenzyme NADH or NAD + The dosage is 0.1-0.5 mM; the dosage of the thioether monooxygenase mutant or recombinant thioether monooxygenase mutant catalyst is 10-800 U / L, and the dosage of the dehydrogenase is 15-1200 U / L; the reaction progress can be monitored by conventional detection methods in the art, such as liquid chromatography HPLC or thin plate chromatography TLC, and the reaction time is based on the time when the substrate concentration no longer decreases or the product concentration no longer increases.

[0066] Compared with the prior art, the innovative advantages and improved effects of the present invention are at least:

[0067] 1. The present invention provides a thioether monooxygenase mutant that can efficiently utilize the coenzyme NADH and has better catalytic performance, which can efficiently catalyze the asymmetric oxidation reaction of esomeprazole to prepare optically pure esomeprazole.

[0068] 2. The thioether monooxygenase mutant can catalyze the asymmetric oxidation of 30 g / L esomeprazole, achieving a conversion rate of more than 99%, and the optical purity of the product is greater than 99%.

[0069] 3. Compared with other thioether monooxygenases, the thioether monooxygenase mutant obtained in the present invention has the advantages of high catalytic activity of coenzyme NADH, high endogenous content of coenzyme NADH in cells, strong stability, large substrate loading capacity, high yield, low production cost and environmental friendliness, and therefore has good industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 Schematic diagram of the synthesis of esomeprazole using omeprazole sulfide as substrate;

[0071] Figure 2 This is the chromatogram of the standard product measured using HPLC in Example 6;

[0072] Figure 3 The chromatogram of the substrate and product in the sample measured by HPLC in Example 6 is shown. DETAILED DESCRIPTION

[0073] The various reaction or detection conditions described in the present invention may be combined or modified according to common knowledge in the art and may be verified by experiments. The technical solutions and technical effects of the present invention will be clearly and completely described below in conjunction with specific embodiments. However, the scope of protection of the present invention is not limited to these embodiments, and any changes or equivalent substitutions that do not deviate from the concept of the present invention are included in the scope of protection of the present invention.

[0074] The sources of materials in the following examples are:

[0075] The recombinant plasmids pET28a-AcPSMO and pETDuet-1-(AGF)DH-AcPSMO contain the nucleic acid sequence shown in SEQ ID No. 1 in the sequence listing, which were constructed by the inventors and are also disclosed in patent CN 202310650468.

[0076] Empty plasmid vector pET-28a was purchased from Novagen; empty plasmid vector pETDuet-1 was purchased from Novagen; E. coli BL21 (DE3) competent cells, 2× Taq PCR MasterMix, and agarose gel DNA recovery kit were all purchased from Beijing Tiangen Biochemical Technology Co., Ltd.; restriction endonucleases Nde I, Hind III, and T4 DNA ligase were all commercially available products from New England Biolabs (NEB); fast PCR polymerase Max DNA Polymerase is a commercially available product from TaKaRa.

[0077] Unless otherwise stated, the specific experiments in the following examples were performed according to conventional methods and conditions in the art, or in accordance with the commercial instructions of the kits.

[0078] Example 1: Construction of a random mutation library of thioether monooxygenase (AcPSMO)

[0079] The error-prone PCR technique was used to randomly mutate the nucleotide sequence of the thioether monooxygenase encoded by SEQ ID No. 1 in the sequence listing.

[0080] Used Upstream primer The upstream and downstream primers are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively, wherein the CCATAT sequence in the upstream primer is the restriction enzyme cutting site of Nde I, and the AAGCTT sequence in the downstream primer is the restriction enzyme cutting site of Hind III.

[0081] Using pET28a-AcPSMO as template, error-prone PCR was performed with rTaq DNA polymerase to construct a random mutation library. PCR system (50 μL): rTaq DNA polymerase 0.5 μL, 10× PCR buffer (Mg 2+ The mixture was diluted with 5.0 μL of dNTP Plus (5.0 μL), 4.0 μL of dNTP Mixture (2.0 mM each), MnCl2 (final concentration of 80 μmol / L), 0.5 ng of pET28a-AcPSMO plasmid, 2 μL of upstream and downstream primers (10 μM), and sterile distilled water to make up to 50 μL. PCR reaction procedure: (1) pre-denaturation at 95°C for 5 min; (2) denaturation at 94°C for 30 s; (3) annealing at 58°C for 30 s; (4) extension at 72°C for 1 min; steps (2) to (4) were repeated 30 times; the final extension was at 72°C for 10 min, and the product was stored at 4°C. The PCR product was verified by agarose gel electrophoresis and then purified and recovered. The recovered target gene DNA fragment and the empty plasmid pET28a were double-digested with restriction endonucleases Nde I and Hind III at 37°C for 12 h. The double-digestion product was verified by agarose gel electrophoresis and then purified and recovered. The resulting linearized pET28a plasmid and the purified target gene DNA fragment were ligated with T4 DNA ligase overnight at 16°C. The ligation product was transformed into E. coli BL21(DE3) competent cells and evenly spread on LB agar plates containing 50 μg / mL kanamycin. The cells were then incubated in a 37°C incubator for approximately 12 hours.

[0082] Transformants from the transformation plates were picked into 96-well deep-well plates using a Qpix450 automated monoclonal picker from Molecular Devices (Shanghai) Co., Ltd. and cultured overnight at 20-30°C, 800 rpm on a shaker. Using a TECAN Freedom EVO automated liquid handling workstation, 50 μL of bacterial culture was aspirated from the primary plate wells and plated into the corresponding secondary plate wells. Cultures were incubated at 20-30°C, 800 rpm on a shaker for 5-10 hours, followed by induction at 20-30°C for 72 hours. The supernatant was then centrifuged at 3500 × g for 10 minutes at 4°C, and the expressed proteins were screened for high-throughput screening in 96-well plates. Mutants with high omeprazole thioether activity were purified and characterized, and the corresponding genes were sequenced.

[0083] The high-throughput activity screening assay method of the AcPSMO mutant is as follows: potassium phosphate buffer (100 mM, pH 9.0) containing 1 mM substrate omeprazole sulfide, 1 mM coenzyme NADH, 100 mM cosubstrate and a certain amount of dehydrogenase enzyme powder are divided into a 96-well plate, preheated to 30°C, and then an appropriate amount of AcPSMO mutant secretion supernatant is added respectively. The reaction is shaken at 30°C, and the absorbance change of NADH at 360 nm is detected on a microplate reader. The absorbance change value within 3 minutes is recorded, and the corresponding enzyme activity is calculated.

[0084] Example 2 Semi-rational design of AcPSMO mutants using NADH enhancement

[0085] Amino acids near the coenzyme binding site of AcPSMO were selected for mutation. Upstream primers and downstream primers were designed based on the sequence of AcPSMO, as shown in Table 1. The primer sequences were referenced to SEQ ID No. 5 to 24 in sequence.

[0086] Table 1. Primer sequences for thioether monooxygenase AcPSMO

[0087]

[0088]

[0089] Using pET28a-AcPSMO as a template, PrimeStar Max polymerase was used for PCR to construct a mutant library. The PCR system (25 μL) consisted of 12.5 μL PrimeStar Max polymerase, 0.5 μL pET28a-AcPSMO plasmid, 0.5 μL each of upstream and downstream primers (10 μM), 0.5 μL DMSO, and sterile distilled water to make up to 25 μL. The PCR reaction procedure was as follows: (1) pre-denaturation at 95°C for 5 min; (2) denaturation at 98°C for 10 s; (3) annealing at 60°C for 10 s; (4) extension at 72°C for 1 min 20 s; steps (2) to (4) were repeated 39 times; a final extension at 72°C for 5 min was performed, and the product was stored at 4°C. The resulting product was added to 1 μL of Dpn I and incubated at 37°C for 1 hour. The digested product was transformed into E. coli BL21 (DE3) competent cells and evenly spread on LB agar plates containing 50 μg / mL kanamycin. The cells were then incubated in a 37°C incubator for approximately 12 hours. The remaining procedures were as described in Example 1.

[0090] Example 3 Combination mutation of beneficial mutants of AcPSMO

[0091] On the basis of the mutations in Example 1 and Example 2, a plurality of mutants with advantages in NADH activity were obtained, and the relevant mutation sites involved in the obtained advantageous mutants were combined by site-directed mutagenesis.

[0092] PCR system (25 μL): PrimeStar Max polymerase 12.5 μL, pET28a-AcPSMO plasmid 0.5 μL, upstream and downstream primers (10 μM) 0.5 μL each, DMSO 0.5 μL, and sterile distilled water to make up to 25 μL. PCR reaction procedure: (1) 95°C pre-denaturation for 5 min; (2) 98°C denaturation for 10 s; (3) 60°C annealing for 10 s; (4) 72°C extension for 1 min 20 s; steps (2) to (4) were performed for a total of 39 cycles; a final extension at 72°C for 5 min was performed, and the product was stored at 4°C. The resulting product was added with 1 μL of Dpn I and then incubated at 37°C for 1 h. The digestion product was transformed into E. coli BL21 (DE3) competent cells and evenly spread on LB agar plates containing 50 μg / mL kanamycin. The plates were placed in a 37°C incubator and cultured for about 12 h.

[0093] Example 4 Construction of a co-expression system for recombinant thioether monooxygenase and dehydrogenase

[0094] In this example, the M25-M35 dominant mutant obtained in Example 3 was used to construct a co-expression system. Using pET28a-AcPSMO and pET28a-dehydrogenase as templates, PrimeStar Max polymerase was used for PCR to extract the target gene. PCR system (25 μL): 12.5 μL of PrimeStar Max polymerase, 0.5 μL of pET28a-AcPSMO plasmid, 0.5 μL of upstream and downstream primers (10 μM), 0.5 μL of DMSO and sterile distilled water to make up to 25 μL. PCR reaction procedure: (1) pre-denaturation at 95°C for 5 minutes; (2) denaturation at 98°C for 10 seconds; (3) annealing at 60°C for 10 seconds; (4) extension at 72°C for 20 seconds; steps (2) to (4) were performed for a total of 39 cycles; finally, extension was performed at 72°C for 5 minutes, and the product was stored at 4°C.

[0095] The pETDuet-1 plasmid was used as a template for reverse amplification of the linearized vector fragment. After the target fragment and the linearized vector were successfully amplified, the PCR product of the linearized vector was digested with Dpn I and the product was recovered by gel electrophoresis. Subsequently, the target fragment: linearized vector was mixed in a ratio of 2:1 and the homologous recombinase was added. After incubation at 50°C for 30 minutes, the recombinant product was obtained and transformation verification was performed. The two genes were respectively inserted into the pETDuet-1 plasmid.

[0096] Example 5 Purification of recombinant thioether monooxygenase mutants

[0097] 1.0 g of resting cells of the recombinant thioether monooxygenase mutant was resuspended in 10 mL of buffer (Solution A) and disrupted by sonication in an ice-water bath: 99 cycles of 400 W power, 4 s on, 6 s off. The supernatant was collected and purified using nickel affinity chromatography. The following buffer recipes are provided: Solution A: KPB buffer (20 mM, pH 7.5), containing 0.5 M NaCl and 10 mM imidazole; Solution B: KPB buffer (20 mM, pH 7.5), containing 0.5 M NaCl and 0.5 M imidazole; Solution C: KPB buffer (25 mM, pH 7.5), 150 mM NaCl, and 1 mM DTT. The crude thioether monooxygenase enzyme solution was loaded onto a nickel column. Contaminants were first eluted with Solution A, followed by the target protein with Solution B. The eluate was concentrated to a certain volume by ultrafiltration and then replaced with Solution C to reduce the imidazole concentration in the protein solution. The purified protein was collected based on the results of SDS-PAGE analysis, added with glycerol to a final concentration of 20% (w / v), and quickly frozen in liquid nitrogen before storage at -80°C.

[0098] Example 6 Activity determination of recombinant thioether monooxygenase mutants

[0099] The enzyme activity of AcPSMO towards omeprazole sulfide substrate was determined as follows: 0.2 mM omeprazole sulfide substrate and 0.2 mM NADH were added to 0.5 mL reaction system (0.1 M KPB buffer, pH 9.0), and an appropriate amount of pure enzyme solution was added, mixed rapidly, and reacted at 30°C, 1000 rpm for 10 min. The reaction was terminated and extracted with 0.5 mL of ethyl acetate. The supernatant was filtered through a 0.22 μm pore size filter membrane and then subjected to liquid chromatography analysis to determine the substrate conversion rate and product ee.

[0100] The specific analysis conditions for substrate conversion and ee are as follows:

[0101] Instrument: Shimadzu HPLC 2010A; Column model: Chiralpak IA; Mobile phase: n-heptane:ethanol = 70:30 (v / v); Flow rate: 0.5 mL min -1 ; Column temperature: 40℃; Injection volume: 10μL; Detector: UV detector; Detection wavelength: 300nm.

[0102] The enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the conversion of 1 μmol of omeprazole thioether substrate to (S)-omeprazole per minute under the above conditions.

[0103] In the table in Table 2, the sequence numbers refer to the corresponding sequences described above. In the activity column using NADH as a hydrogen donor, a single plus sign "+" indicates that the specific activity of the mutant protein is 1.0 to 2.0 times higher than that of the protein composed of the amino acid sequence of SEQ ID No. 2 in the sequence listing; two plus signs "++" indicate that the specific activity of the mutant protein is 2.1 to 4.0 times higher than that of the protein composed of the amino acid sequence of SEQ ID No. 2; and three plus signs "+++" indicate that the specific activity of the mutant protein is 4.1 to 8.0 times higher than that of the protein composed of the amino acid sequence of SEQ ID No. 2.

[0104] Table 2 Thioether monooxygenase mutant sequences and corresponding activity improvements

[0105]

[0106]

[0107] The amino acid sequences of the thioether monooxygenase mutants corresponding to the sequence numbers are as follows:

[0108] (1) replacing Ser at position 56 of the amino acid sequence shown in SEQ ID No. 2 with Val;

[0109] (2) replacing Glu at position 70 of the amino acid sequence shown in SEQ ID No. 2 with Thr;

[0110] (3) replacing Asn at position 123 of the amino acid sequence shown in SEQ ID No. 2 with Arg;

[0111] (4) replacing Asn at position 128 of the amino acid sequence shown in SEQ ID No. 2 with His;

[0112] (5) replacing Thr at position 133 of the amino acid sequence shown in SEQ ID No. 2 with Leu;

[0113] (6) replacing Leu at position 143 of the amino acid sequence shown in SEQ ID No. 2 with Phe;

[0114] (7) replacing Ala at position 145 of the amino acid sequence shown in SEQ ID No. 2 with Gly;

[0115] (8) replacing Ala at position 146 of the amino acid sequence shown in SEQ ID No. 2 with Arg;

[0116] (9) replacing Asn at position 148 of the amino acid sequence shown in SEQ ID No. 2 with Trp;

[0117] (10) replacing Leu at position 149 of the amino acid sequence shown in SEQ ID No. 2 with Phe;

[0118] (11) Lys at position 151 of the amino acid sequence shown in SEQ ID No. 2 is replaced with Arg;

[0119] (12) the Arg at position 207 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Lys;

[0120] (13) replacing Ser at position 208 of the amino acid sequence shown in SEQ ID No. 2 with Asp;

[0121] (14) replacing Ala at position 209 of the amino acid sequence shown in SEQ ID No. 2 with Val;

[0122] (15) replacing Gln at position 210 of the amino acid sequence shown in SEQ ID No. 2 with Leu;

[0123] (16) Lys at position 349 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Arg;

[0124] (17) replacing Cys at position 376 of the amino acid sequence shown in SEQ ID No. 2 with Pro;

[0125] (18) Lys at position 526 of the amino acid sequence shown in SEQ ID No. 2 was replaced with His;

[0126] (19) The amino acid sequence shown in SEQ ID No. 2 is replaced by Val at position 56, and by Phe at position 143 by Leu;

[0127] (20) The Asn at position 123 of the amino acid sequence shown in SEQ ID No. 2 was replaced with Arg, and the Ala at position 145 was replaced with Gly;

[0128] (21) The 128th position Asn of the amino acid sequence shown in SEQ ID No. 2 was replaced with His, and the 146th position Ala was replaced with Arg;

[0129] (22) The 149th Leu of the amino acid sequence shown in SEQ ID No. 2 was replaced by Phe, and the 208th Ser was replaced by Asp;

[0130] (23) The 151st Lys of the amino acid sequence shown in SEQ ID No. 2 was replaced by Arg, and the 210th Gln was replaced by Leu;

[0131] (24) The 349th Lys residue in the amino acid sequence of SEQ ID No. 2 was replaced with Arg, and the 526th Lys residue was replaced with His;

[0132] (25) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, and Lys at position 349 is replaced by Arg;

[0133] (26) In the amino acid sequence shown in SEQ ID No. 2, Glu at position 70 is replaced by Thr, Asn at position 148 is replaced by Trp, and Cys at position 376 is replaced by Pro;

[0134] (27) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, Lys at position 349 is replaced by Arg, and Cys at position 376 is replaced by Pro;

[0135] (28) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, and Ser at position 208 is replaced by Asp;

[0136] (29) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 128 is replaced with His, Ala at position 146 is replaced with Arg, Ala at position 209 is replaced with Val, and Gln at position 210 is replaced with Leu;

[0137] (30) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, Lys at position 349 is replaced by Arg, Cys at position 376 is replaced by Pro, and Lys at position 526 is replaced by His;

[0138] (31) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, and Lys at position 349 is replaced by Arg;

[0139] (32) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 128 is replaced with His, Ala at position 146 is replaced with Arg, Ala at position 209 is replaced with Val, Gln at position 210 is replaced with Leu, and Lys at position 151 is replaced with Arg;

[0140] (33) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, and Leu at position 143 is replaced by Phe;

[0141] (34) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, and Ser at position 56 is replaced by Val;

[0142] (35) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, Ser at position 56 is replaced by Val, and Lys at position 526 is replaced by His.

[0143] Example 7 Fermentation preparation of recombinant thioether monooxygenase mutants

[0144] The recombinant expression transformant containing the thioether monooxygenase mutant obtained in Example 1 was inoculated into LB medium containing 50 μg / mL kanamycin and cultured on a shaker at 37°C for 12 hours to serve as the seed solution. The fermentor temperature and agitation speed were set to 37°C and 400 rpm, respectively, and the ventilation was adjusted to 1 vvm (3 L / min). After the fermentor parameters stabilized, 200 mL of the seed solution was inoculated into a fermentor containing 3 L of culture medium (5 g / L glycerol, 5 g / L peptone, 5 g / L yeast extract, 3 g / L Na2HPO4, 0.7 g / L Na2SO4, 3.4 g / L KH2PO4, 0.25 g / L MgSO4, and 2.7 g / L NH4Cl) under flame protection, and fermentation began. As the cells grew, the dissolved oxygen (DO) decreased. When the DO dropped below 30%, the agitation speed was increased until it reached 500 rpm. During the fermentation process, ammonia was added to control the pH at around 7.0. After 2 hours of fermentation, samples were taken every 1 hour to detect the cell concentration (OD 600After 4 hours of cultivation, carbon and nitrogen sources (250 g / L glycerol, 60 g / L peptone, 60 g / L yeast extract) were added at a flow rate of 35 mL / h. After 5 hours of cultivation, the fermentation tank liquid temperature was adjusted to 25 ° C, and the feeding rate was reduced to 27 mL / h. After 5.5 hours of cultivation, IPTG aqueous solution (mother liquor concentration 1 M, final concentration 0.2 mM) was added to induce the expression of the target protein. After induced expression, samples were taken every 2 hours to measure the OD 600 10 h after induction, the fermentation was terminated and the fermentation broth was centrifuged to obtain 200 g of resting cells.

[0145] Example 8 Preparation of Recombinant Thioether Monooxygenase Mutant Cell Disintegration Fluid, Lyophilized Cells, and Lyophilized Enzyme Powder

[0146] 100 g of the recombinant cells harvested in Example 4 were freeze-dried to obtain 25 g of lyophilized cells containing the thioether monooxygenase mutant. 80 g of the harvested recombinant cells were suspended in 0.5 L of buffer, homogenized under high pressure, and the supernatant collected by centrifugation to obtain a crude enzyme solution of the recombinant thioether monooxygenase mutant. The collected crude enzyme solution was frozen at -80°C and then dried using a vacuum freeze dryer to obtain 10 g of lyophilized enzyme of the recombinant thioether monooxygenase mutant. The resulting lyophilized enzyme powder was stored in a refrigerator at 4°C for convenient use.

[0147] Example 9 Thioether Monooxygenase AcPSMO M25 Co-expression of 10 g / L omeprazole sulfide in cells catalyzed by isopropanol dehydrogenase

[0148] Reaction system (10 mL): omeprazole sulfide (10 g / L), isopropanol (10% v / v) and NAD + (0.1 mM), thioether monooxygenase AcPSMO constructed and prepared in Examples 4 and 7 M25 The reaction mixture was stirred under magnetic stirring and the reaction temperature was controlled at 30°C in a water bath. After 8 hours of reaction, 0.5 mL of the reaction solution was extracted with 0.5 mL of ethyl acetate. 0.3 mL of the extract was dried over anhydrous sodium sulfate, the ethyl acetate was evaporated, and then dissolved in 1 mL of ethanol. The substrate conversion and product ee were determined by HPLC analysis as described in Example 6. After 8 hours of reaction, the substrate conversion was greater than 99%, and the product ee value was greater than 99% (S).

[0149] Example 10 Thioether monooxygenase AcPSMO M31 Asymmetric oxidation of 20 g / L omeprazole sulfide catalyzed by cell lysate

[0150] Reaction system (10 mL): omeprazole sulfide (20 g / L), methanol (10% v / v), sodium formate (100 mM), NAD + (0.2 mM), thioether monooxygenase AcPSMO prepared in Examples 7 and 8 M31 Cell lysis buffer (3 U), formate dehydrogenase cell lysis buffer (6 U), and phosphate buffer (100 mM, pH 8.0) were added. The reaction temperature was maintained at 30°C in a water bath under magnetic stirring. After 12 hours of reaction, 0.5 mL of the reaction solution was sampled and extracted with 0.5 mL of ethyl acetate. 0.3 mL of the extract was dried over anhydrous sodium sulfate, the ethyl acetate was evaporated, and then dissolved in 1 mL of ethanol. The substrate conversion and product ee were determined using the HPLC analysis method described in Example 6. After 12 hours of reaction, the substrate conversion was greater than 99%, and the product ee value was greater than 99% (S).

[0151] Example 11 Thioether monooxygenase AcPSMO M35 Freeze-dried enzyme powder catalyzes the asymmetric oxidation of 30g / L omeprazole sulfide

[0152] Reaction system (10 mL): omeprazole sulfide (30 g / L), methanol (10% v / v), glucose (200 mM) and NAD + (0.2 mM). Thioether monooxygenase AcPSMO prepared in Examples 7 and 8 M35 Lyophilized enzyme powder (4U), lyophilized glucose dehydrogenase enzyme powder (10U), phosphate buffer (500mM, pH 8.0).

[0153] The reaction mixture was stirred magnetically and the temperature was controlled at 30°C in a water bath. After 24 hours of reaction, 0.5 mL of the reaction solution was sampled and extracted with 0.5 mL of ethyl acetate. 0.3 mL of the extract was dried over anhydrous sodium sulfate, and the ethyl acetate was evaporated. The product was then dissolved in 1 mL of ethanol. The substrate conversion and product ee were determined by HPLC analysis as described in Example 6. After 24 hours of reaction, the substrate conversion was greater than 99%, and the product ee was greater than 99% (S).

[0154] Example 12 Thioether monooxygenase AcPSMO in 1 L reaction system M35 Co-expression of omeprazole and formate dehydrogenase catalyzes the asymmetric oxidation of 30 g / L omeprazole sulfide

[0155] A 1 L reaction was carried out in a 3 L fermenter. The reaction system contained: omeprazole sulfide (30 g / L), methanol (10% v / v), sodium formate (100 mM) and NAD + (0.1 mM), thioether monooxygenase AcPSMO constructed and prepared in Examples 4 and 7 M35The reaction mixture was stirred at 300 rpm for 24 hours, and 0.5 mL of the reaction solution was extracted with 0.5 mL of ethyl acetate. 0.3 mL of the extract was dried over anhydrous sodium sulfate, and the ethyl acetate was evaporated. The extract was then dissolved in 1 mL of ethanol. The substrate conversion and product ee were determined using the HPLC method described in Example 6. After 24 hours of reaction, the substrate conversion was greater than 99%, and the product ee was greater than 99% (S).

[0156] The sequence information involved in the present invention is as follows:

[0157] SEQ ID No. 1:

[0158]

[0159] MTQKMDFDAIIIGAGFGGLYSLKKLRDDFNLKVRAFDRATEVGGTWFWNQYPGAYSDSETHLYCYSWDKELLQEMEIKRKYISQPDVLAYLKRVADKHDLRKDIQFETGIRSAYFDEENSFWNVTTENDEKFTARFLITALGPLAAPNLPKIKGIETFKGELHHTSRWPKDVTFSGKRVGVIGTGSTGVQVITAIASQVKHLTVFQRSAQYSVPIGNVVMSETDVAKIKENYDQIWENVWNSALGYGLNESTLPTMSVSAEERDKIFEKAWQEGGGLRFMFETFGDIAVDETANIEAQNFIKKKISEIVKDPFVAKKLTPTDLYACRPLCDSGYYEVFNRDNVSLEDVKANPIVEIKEDCVVTADGVEHKLDMLICATGFDAVDGSYKRIDIRGKDGISIKDYWKDGPNSYLGMMVSNFPNMFMVFGPNGPLANSPPIIETQVRWIADLIGYAEDHQINQIEATKDAVDNWTNTCSDIANKTLFAKAKCRIFGANVSGKKNTVYLYMGGLKEYRNQISEVSNNNYKGCLLKQSVKKTNLIES

[0160] SEQ ID No.3:

[0161] CAG CCATAT ATGACTCAAAAAATGGATTT

[0162] SEQ ID No.4:

[0163] CGC AAGCTT TTAAGATTCTATAAGGTTGG

[0164] SEQ ID No.5:

[0165] TCCTGATCACCGCGCTGGGTNNKCTGGCGGCGCCGAACCTGCC

[0166] SEQ ID No.6:

[0167] GGCAGGTTCGGCGCCGCCAGMNNACCCAGCGCGGTGATCAGGA

[0168] SEQ ID No.7:

[0169] TCACCGCGCTGGGTCTGCTGNNKGCGCCGAACCTGCCGAAAAT

[0170] SEQ ID No.8:

[0171] ATTTTCGGCAGGTTCGGCGCMNNCAGCAGACCCAGCGCGGTGA

[0172] SEQ ID No.9:

[0173] CCGCGCTGGGTCTGCTGGCGNNKCCGAACCTGCCGAAAATTAA

[0174] SEQ ID No.10:

[0175] TTAATTTTCGGCAGGTTCGGMNNCGCCAGCAGACCCAGCGCGG

[0176] SEQ ID No.11:

[0177] TGGGTCTGCTGGCGGCGCCGNNKCTGCCGAAAATTAAGGGCAT

[0178] SEQ ID No.12:

[0179] ATGCCCTTAATTTTCGGCAGMNNCGGCGCCGCCAGCAGACCCA

[0180] SEQ ID No.13:

[0181] GTCTGCTGGCGGCGCCGAACNNKCCGAAAATTAAGGGCATCGA

[0182] SEQ ID No.14:

[0183] TCGATGCCCTTAATTTTCGGGMNNTTCGGCGCCGCCAGCAGACSEQ ID No.15:

[0184] TGGCGGCGCCGAACCTGCCGNNKATTAAGGGCATCGAGACCTTSEQ ID No.16:

[0185] AAGGTCTCGATGCCCTTAATMNNCGGCAGGTTCGGCGCCGCCASEQ ID No.17:

[0186] AACATTTAACAGTATTTCAANNKTCTGCTCAATACAGTGTGCCSEQ ID No.18:

[0187] GGCACACTGTATTGAGCAGAMNNTTGAAATACTGTTAAATGTTSEQ ID No.19:

[0188] ATTTAACAGTATTTCAACGTNNKGCTCAATACAGTGTGCCTATSEQ ID No.20:

[0189] ATAGGCACACTGTATTGAGCMNNACGTTGAAATACTGTTAAATSEQ ID No.21:

[0190] TAACAGTATTTCAACGTTCTNNKCAATACAGTGTGCCTATTGGSEQ ID No.22:

[0191] CCAATAGGCACACTGTATTGMNNAGAACGTTGAAATACTGTTASEQ ID No.23:

[0192] CAGTATTTCAACGTTCTGCTNNKTACAGTGTGCCTATTGGTAASEQ ID No.24:

[0193] TTACCAATAGGCACACTGTAMNNAGCAGAACGTTGAAATACTG。

Claims

1. A thioether monooxygenase mutant, characterized in that The amino acid sequence of the mutant is selected from any one of the following: (1) replacing Ser at position 56 of the amino acid sequence shown in SEQ ID No. 2 with Val; (2) replacing Ser at position 56 with Val and Leu at position 143 with Phe in the amino acid sequence shown in SEQ ID No. 2; (3) The amino acid sequence shown in SEQ ID No. 2 is replaced by Val at position 56, Leu at position 143 by Phe, and Lys at position 349 by Arg; (4) The amino acid sequence shown in SEQ ID No. 2 is replaced by Val at position 56, Leu at position 143 by Phe, Lys at position 349 by Arg, and Cys at position 376 by Pro; (5) In the amino acid sequence shown in SEQ ID No. 2, Ser at position 56 is replaced by Val, Leu at position 143 is replaced by Phe, Lys at position 349 is replaced by Arg, Cys at position 376 is replaced by Pro, and Lys at position 526 is replaced by His; (6) in the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, and Ser at position 56 is replaced by Val; (7) In the amino acid sequence shown in SEQ ID No. 2, Asn at position 123 is replaced by Arg, Ala at position 145 is replaced by Gly, Arg at position 207 is replaced by Lys, Ser at position 208 is replaced by Asp, Lys at position 349 is replaced by Arg, Leu at position 143 is replaced by Phe, Ser at position 56 is replaced by Val, and Lys at position 526 is replaced by His.

2. An isolated nucleic acid, characterized in that Encodes the thioether monooxygenase mutant according to claim 1.

3. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid according to claim 2.

4. A co-expression recombinant vector, characterized in that: The co-expression recombinant vector comprises the nucleic acid according to claim 2 and a dehydrogenase gene.

5. A co-expression recombinant vector according to claim 4, characterized in that, The dehydrogenase is any one of formate dehydrogenase, glucose dehydrogenase and isopropanol dehydrogenase.

6. A recombinant expression transformant, characterized in that: Comprising the recombinant expression vector according to claim 3 or the co-expression recombinant vector according to claim 4.

7. A recombinant thioether monooxygenase mutant catalyst, characterized in that: Is any of the following: (1) culturing the recombinant expression transformant according to claim 6, and isolating transformant cells containing the thioether monooxygenase mutant according to claim 1; (2) culturing the recombinant expression transformant according to claim 6, isolating and crushing the crude enzyme solution containing the thioether monooxygenase mutant according to claim 1; (3) Cultivating the recombinant expression transformant according to claim 6, isolating and crushing the thioether monooxygenase mutant according to claim 1 to obtain a crude enzyme solution, and freeze-drying the crude enzyme solution to obtain a crude enzyme powder.

8. Use of the thioether monooxygenase mutant according to claim 1 or the recombinant thioether monooxygenase mutant according to claim 7 as a catalyst, characterized in that: Application in catalyzing the asymmetric oxidation of substrate omeprazole sulfide to prepare esomeprazole.

9. The use according to claim 8, characterized in that NADH or NAD needs to be added during the reaction + In any one of the applications, NADH is oxidized to NAD + , while using dehydrogenase to catalyze NAD + Reduced to NADH to realize the coenzyme cycle; the application also requires the presence of at least one of glucose, sodium formate, and isopropanol and its corresponding dehydrogenase; the glucose corresponds to glucose dehydrogenase, sodium formate corresponds to sodium formate dehydrogenase, and isopropanol corresponds to isopropanol dehydrogenase.

10. The use according to claim 8, characterized in that The concentration of the substrate omeprazole sulfide is 1-30 g / L, the amount of glucose, sodium formate or isopropanol is 1-45 g / L, and the coenzyme NADH or NAD + The dosage is 0.1-0.5 mM; the dosage of the thioether monooxygenase mutant or recombinant thioether monooxygenase mutant catalyst is 10-800 U / L, and the dosage of the dehydrogenase is 15-1200 U / L.

Images