A plasmid vector and construction method and application of the plasmid vector, construction of an exogenous gene expression system in iPSC in response to IFN-gamma and a method thereof
By designing plasmid vectors in iPSCs and using CRISPR/Cas9 technology to target the B2M gene and insert HLA-G, CD47, and EGFP genes, we achieved efficient and uniform expression of exogenous genes induced by IFN-γ, solving the problem of unstable expression in iPSCs and enhancing the precision of gene expression regulation.
Patent Information
- Application Number
- CN202411108270.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-13
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2044-08-13
AI Technical Summary
In induced pluripotent stem cells (iPSCs), existing mammalian gene engineering expression systems are unable to express exogenous genes effectively and uniformly, and conventional expression systems are susceptible to epigenetic modifications, leading to unstable expression.
A plasmid vector containing a gene cutting vector and a template repair vector was designed. Using CRISPR/Cas9 technology, the B2M gene stop codon was targeted in iPSCs, and HLA-G, CD47 and EGFP gene coding sequences were inserted. The exogenous gene was expressed efficiently by IFN-γ induction, avoiding the intervention of exogenous regulatory elements.
This method achieves efficient and uniform expression of exogenous genes in iPSCs. By controlling the expression of genes to be low in the absence of treatment and high in the presence of treatment using IFN-γ, it avoids heterogeneity in expression and enhances the precision of gene expression regulation.
Smart Images

Figure CN118910164B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, and in particular to a plasmid vector and construction method, and a method for constructing an exogenous gene expression system in iPSC in response to IFN-γ induction. BACKGROUND
[0002] Cell and gene therapy (CGT) is a new generation of therapy in which cells or gene vectors are modified and produced in vitro, and then cells or gene engineering vectors are used as drugs for disease treatment. However, CGT in a broad sense is not only cell or gene vector therapy, but also through precise genetic modification of target cells to make them carry new functions of genetic modification and be used for disease treatment. This gene engineering cell therapy, as a "living cell drug" with genetic background modification, may become a hot development direction in the future CGT drug research field, among which the CAR-T immune cell drug is listed as a representative, marking the success of the cell treatment method through genetic modification by gene engineering technology.
[0003] Induced pluripotent stem cells (iPSC) are a type of cells similar to embryonic stem cells obtained by reprogramming somatic cells, which have unlimited proliferation capacity and potential to differentiate into various adult cell types. Therefore, iPSC can be used as a cell source for various functional cells, and large-scale culture and various cell drug development can be carried out without ethical restrictions.
[0004] In recent years, with the increasing maturity of iPSC technology, the technical strategy of genetic modification based on iPSC to achieve new functions of cell therapy has been widely used in cell drug research and development. However, in iPSC, various mammalian expression systems are difficult to work effectively or are not uniform, which greatly limits the expression of exogenous genes in iPSC. Conventional mammalian genetic engineering expression systems, the most typical of which are plasmid expression systems and recombinant lentivirus vector expression systems with constitutive promoters, have various exogenous gene expression regulatory elements, especially various exogenous promoters and transcription termination sequences, which are easily modified by epigenetic modification under the background of iPSC genome and epigenetics, thus reducing the function. Therefore, it is necessary to design a plasmid vector and construction method, and a method for constructing an exogenous gene expression system in iPSC in response to IFN-γ induction. SUMMARY
[0005] In order to overcome the defects in the prior art, a plasmid vector and construction method, and a method for constructing an exogenous gene expression system in iPSC in response to IFN-γ induction are provided.
[0006] The present application is realized by the following scheme:
[0007] A plasmid vector, comprising a gene cutting vector and a template repair vector.
[0008] The gene cutting vector is an sgRNA and Cas9 protein expression vector targeting the stop codon of the B2M gene; the template repair vector is a plasmid vector with 600bp DNA sequences on both sides of the cutting site near the stop codon of the B2M gene as wings, wherein the coding sequence of the HLA-G, CD47 and EGFP genes is inserted.
[0009] The gene cutting vector takes px459 vector as the skeleton to construct the gRNA / Cas9 expression vector, and the gene expression structure of the gRNA / Cas9 expression vector is: U6 promoter sequence+B2M-TAG-sgRNA transcription sequence+EF1a promoter+Cas9 coding sequence, which is the gene cutting vector, and the gene cutting vector is named as px459-B2M-TAG-sgRNA.
[0010] The template repair vector takes pUC57 cloning vector as the skeleton, and comprises a homologous sequence (LA) upstream of the cutting site, a protein fusion linker sequence, an HLA-G coding sequence, a P2A sequence, a CD47 gene coding sequence, a T2A sequence, an EGFP coding sequence and a homologous sequence (RA) downstream of the cutting site, which is the template repair vector, and the nucleic acid sequence of the template repair vector is shown as SEQ ID NO2, and the template repair vector is named as pUC57-HLA-G-CD47-EGFP.
[0011] A construction method of a plasmid vector, comprising the following steps:
[0012] Gene cutting vector construction: the DNA sequence near the stop codon site of the B2M gene is selected as the candidate target sequence, input into the online CRISPOR program design and optimized sgRNA, named as B2M-TAG-sgRNA, and the nucleic acid sequence is shown as SEQ ID NO1.
[0013] The complementary single-stranded DNA sequence of B2M-TAG-sgRNA is synthesized by primers and mixed in an equal proportion in a 20ul reaction system, denatured at 95℃ for 5 minutes, and annealed at room temperature for 2 hours to synthesize double-stranded DNA.
[0014] The double-stranded DNA sequence is connected with the BbSI linearized pSpCas9(BB)-2A-Puro(PX459) vector, and the positive clone is picked and sequenced to verify, so as to construct the gene cutting vector, and the gene cutting vector is named as px459-B2M-TAG-sgRNA.
[0015] Gene template repair vector construction: the coding sequences of HLA-G, CD47 and EGFP genes are connected by P2A and T2A sequences, and are designed to be placed in the open reading frame of the B2M gene; the sequence design of the gene template repair vector is: LA (without stop codon) + linker sequence + HLA-G coding sequence + P2A sequence + CD47 coding sequence + T2A sequence + EGFP sequence (including stop codon) + RA (homologous arm sequence downstream of B2M gene cleavage site), which is cloned into pUC57-mini vector after whole gene synthesis, and the constructed vector is named as pUC57-HLA-G-CD47-EGFP.
[0016] A plasmid vector is used to construct an exogenous gene expression system in iPSCs in response to IFN-γ induction, wherein the exogenous gene expression system refers to an iPS cell strain that can regulate and highly express exogenous genes under the stimulation of IFN-γ by CRISPR / Cas9 technology.
[0017] The gene cutting vector px459-B2M-TAG-sgRNA and the template repair vector pUC57-HLA-G-CD47-EGFP are co-electrotransferred into iPS cells, so that the HLA-G-CD47-EGFP gene fragment is integrated downstream of the B2M gene, so that HLA-G is expressed in fusion with the B2M gene, and CD47 and EGFP are independently expressed.
[0018] A method for constructing an exogenous gene expression system in iPSCs in response to IFN-γ induction using a plasmid vector, the method comprising the following steps:
[0019] IFN-γ induced exogenous gene expression iPS cell electrotransformation and screening: using a 4D nucleofector X electrotransformation system and a P3 primary cell kit, iPS cells and plasmids are mixed in 20 μl of electrotransformation buffer, and screening is performed 48 hours after electrotransformation; an empty vector electrotransformation group is set up for resistance screening at the same time; when the cells in the empty vector electrotransformation group all undergo apoptosis, the iPS cells in the electrotransformation experiment group are replaced with normal complete culture medium for continuous culture; when the cells are stable and in good condition, the IFN-γ induced expression iPS cell line is obtained;
[0020] IFN-γ induced expression iPS cell line construction: the IFN-γ induced expression iPS cell line obtained by Accutase digestion and dispersion was prepared into a single cell suspension, and after cell counting, 800-1000 iPS cells were inoculated in a Laminin-521 coated 6cm dish for continuous culture, with daily medium replacement, and cultured for 7 days. Monoclonal iPS cells were observed under a microscope and inoculated into a Laminin-521 coated 48-well plate for continuous expansion and culture. The monoclonal cell line was obtained by expansion, and was identified by PCR genotype and flow cytometry phenotype. The IFN-γ induced expression iPS cell line was correct.
[0021] In the construction of the IFN-γ induced expression iPS cell line, the iPS cells were electroporated using 10 6 μg of plasmid in 20 μl of electroporation buffer.
[0022] The molar ratio of the gene cutting vector px459-B2M-TAG-sgRNA to the template repair vector pUC57-HLA-G-CD47-EGFP in the plasmid was 1:3.
[0023] The IFN-γ induced expression iPS cell line was screened using 0.2 μg / ml of puromycin.
[0024] The specific steps of the electroporation are as follows: added to one hole of the electroporation strip, electroporated using the DS130 or CM198 program, the electroporated iPS cells were added to 900 μl of complete culture medium, incubated at 37°C in a 5% carbon dioxide incubator for 30 minutes, and then transferred to a 12-well plate for continuous culture for 48 hours.
[0025] The beneficial effects of the present application are:
[0026] The present application provides an IFN-γ induced expression system of exogenous genes in iPSCs. The expression system utilizes the endogenous expression regulatory elements of the B2M gene of iPS cells to control the expression level of multiple introduced exogenous genes by IFN-γ without introducing exogenous promoters and transcription termination sequences, i.e. without IFN-γ treatment, the exogenous genes are expressed at a low physiological level together with the B2M gene, and with IFN-γ treatment, the exogenous genes are expressed at a high level. This effectively avoids the intervention of exogenous gene expression regulatory elements and the non-uniformity of their regulation of exogenous gene expression. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 : Plasmid vector structure for constructing the IFN-γ-iPSC induced expression system;
[0028] Figure 2Schematic diagram of the IFN-γ-iPSC induced expression system;
[0029] Figure 3 Flow cytometry analysis of gene knock-in efficiency after electroporation of iPSCs with different doses of cleavage vectors and template repair vectors;
[0030] Figure 4 Flow cytometry identification of monoclonal cell lines of the IFN-γ-iPSC induced expression system;
[0031] Figure 5 IFN-γ-iPSC Inducible Expression System 18 # and 53 # Fluorescence imaging of clones after IFN-γ treatment;
[0032] Figure 6 IFN-γ-iPSC induced expression system monoclonal cell line 18 # and 53 # The expression levels of HLA-G, CD47, and GFP proteins were detected by flow cytometry under IFN-γ treatment and no treatment conditions.
[0033] Figure 7 qPCR validation of the IFN-γ-iPSC inducible expression system 18 # and 53 # Changes in the expression levels of HLA-G, CD47, and GFP proteins in clones under IFN-γ treatment and no treatment conditions. Detailed Implementation
[0034] The preferred embodiments of the present invention are further described below:
[0035] A plasmid vector comprising a gene cutting vector and a template repair vector.
[0036] The gene cutting vector is an sgRNA and Cas9 protein expression vector targeting the B2M gene stop codon; the template repair vector is a plasmid vector with 600bp DNA sequences flanking the cleavage site near the B2M gene stop codon as its two wings, in which HLA-G, CD47 and EGFP gene coding sequences are inserted.
[0037] The gene cutting vector uses the px459 vector as a backbone to construct a gRNA / Cas9 expression vector. The gene expression structure of the gRNA / Cas9 expression vector is: U6 promoter sequence + B2M-TAG-sgRNA transcription sequence + EF1a promoter + Cas9 coding sequence, which is the gene cutting vector. The gene cutting vector is named px459-B2M-TAG-sgRNA.
[0038] The template repair vector takes pUC57 cloning vector as a skeleton, and comprises a homologous sequence upstream of a cleavage site (LA), a protein fusion linker sequence, an HLA-G coding sequence, a P2A sequence, a CD47 gene coding sequence, a T2A sequence, an EGFP coding sequence, and a homologous sequence downstream of the cleavage site (RA), namely a template repair vector, and a nucleic acid sequence thereof is shown as SEQ ID NO 2. The template repair vector is named as pUC57-HLA-G-CD47-EGFP.
[0039] SEQ ID NO 2:
[0040]
[0041] A method for constructing a plasmid vector, comprising the following steps:
[0042] Construction of gene cutting vector: the DNA sequence near the B2M gene termination codon site is selected as the candidate target sequence, input into the online CRISPOR program design and optimize sgRNA, named B2M-TAG-sgRNA, the nucleic acid sequence is shown as SEQ ID NO1;
[0043] SEQ ID NO1: gacatgtaagcagcatg.
[0044] The complementary single-stranded DNA sequence of B2M-TAG-sgRNA is synthesized by primer and mixed in a 20ul reaction system, denatured at 95℃ for 5min, and annealed at room temperature for 2h to synthesize double-stranded DNA;
[0045] The double-stranded DNA sequence is connected with the linearized pSpCas9(BB)-2A-Puro(PX459) vector of BbsI, and the positive clone is picked and sequenced to verify the construction of the gene cutting vector, and the gene cutting vector is named px459-B2M-TAG-sgRNA;
[0046] Construction of gene template repair vector: the coding sequences of HLA-G, CD47 and EGFP genes are connected by P2A and T2A sequences, and are designed to be placed in the open reading frame of B2M gene; the sequence design of gene template repair vector is: LA (not containing termination codon) + linker sequence + HLA-G coding sequence + P2A sequence + CD47 coding sequence + T2A sequence + EGFP sequence (containing termination codon) + RA (homologous arm sequence downstream of B2M gene cutting site), which is cloned into pUC57-mini vector after whole gene synthesis, and the constructed vector is named pUC57-HLA-G-CD47-EGFP.
[0047] A plasmid vector is constructed for an exogenous gene expression system in iPSC in response to IFN-γ induction, which refers to an iPS cell strain that can regulate and highly express exogenous genes under the stimulation of IFN-γ by CRISPR / Cas9 technology;
[0048] The gene cutting vector px459-B2M-TAG-sgRNA and the template repair vector pUC57-HLA-G-CD47-EGFP are co-electrotransferred into iPS cells, so that the HLA-G-CD47-EGFP gene fragment is integrated downstream of the B2M gene, so that HLA-G is expressed in fusion with the B2M gene, and CD47 and EGFP are independently expressed.
[0049] A method for constructing an exogenous gene expression system in iPSCs in response to IFN-γ induction using a plasmid vector, the method comprising the following steps:
[0050] IFN-γ-induced expression of exogenous genes iPS cells are electrotransferred and screened: using a 4D nucleofector X electrotransfer system and a P3 Primary cell kit, iPS cells and plasmids are mixed with 20 μl of electrotransfer buffer, and screening is performed 48 hours after electrotransfer. The empty vector electrotransfer group is also subjected to resistance screening. After all the cells in the empty vector electrotransfer group have undergone apoptosis, the iPS cells in the electrotransfer experiment group are replaced with normal complete culture medium for continuous culture. When the cells are stable and in good condition, the IFN-γ-induced expression iPS cell line is obtained.
[0051] Construction of IFN-γ-induced expression of exogenous genes iPS cell lines: the IFN-γ-induced expression iPS cell line obtained by Accutase digestion and dispersion is prepared into a single cell suspension, and 800-1000 iPS cells are inoculated in a Laminin-521 coated 6 cm dish for continuous culture after cell counting. The medium is changed every day during the culture, and the monoclonal iPS cells are observed under a microscope after 7 days of culture and are inoculated into a Laminin-521 coated 48-well plate for continuous expansion and culture. The monoclonal cell line is obtained by expansion, and the correct genotype and flow cytometry phenotype are identified, which is the IFN-γ-induced expression of exogenous genes iPS cell line.
[0052] In the construction of the IFN-γ-induced expression iPS cell line, the electrotransfer of iPS cells is carried out using 10 6 μg of plasmid mixed with 20 μl of electrotransfer buffer.
[0053] The molar ratio of the gene cutting vector px459-B2M-TAG-sgRNA to the template repair vector pUC57-HLA-G-CD47-EGFP in the plasmid is 1:3.
[0054] The IFN-γ-induced expression of exogenous genes iPS cells are screened using 0.2 μg / ml of puromycin.
[0055] The specific steps of the electrotransformation are as follows: adding to a well of an electrotransformation strip, electrotransformation using the DS130 or CM198 program, adding 900 μl of complete medium to the electrotransformed iPS cells, incubating at 37°C in a 5% carbon dioxide incubator for 30 minutes, and transferring to a 12-well plate for continued culture for 48 hours.
[0056] The application scenarios of the iPSC-IFN-γ inducible expression system of the present application are as follows:
[0057] (1) Overexpression and production of iPSC medicinal exosomes. The iPSC carrying the exogenous gene knock-in expression does not need exogenous gene expression and exosome production containing medicinal proteins in the large-scale expansion culture process, and thus does not need IFN-γ treatment. When the iPSC is expanded to a certain number, IFN-γ is added to produce medicinal exosomes, and a large amount of medicinal proteins are expressed and exosomes are produced.
[0058] (2) iPSC-derived cell or MSC drug development. The iPSC carrying the exogenous gene or the MSC carrying the expression system can be combined with IFN-γ treatment for transplantation in the human body for treatment, for regulating the secretion of cell drugs containing medicinal proteins or other proteins in the body, and for enhancing the cell treatment effect.
[0059] In the present application, "iPSC" and "iPS cell" have the same meaning.
[0060] The present application will be further described below in combination with specific examples:
[0061] Example 1: Construction of a gene modification vector
[0062] Construction of a B2M gene cleavage vector: the DNA sequence near the B2M gene stop codon site was selected as the candidate target sequence, and sgRNA was designed and optimized by inputting the online CRISPOR program (http: / / crispor.tefor.net / ), and was named B2M-TAG-sgRNA, and the nucleic acid sequence thereof was
[0063] GACATGTAAGCAGCATCATGG (SEQ ID NO 1).
[0064] The complementary single-stranded DNA sequence of B2M-TAG-sgRNA was synthesized by primers and mixed in a 20 μl reaction system at an equal ratio, denatured at 95°C for 5 minutes, and annealed at room temperature for 2 hours to synthesize double-stranded DNA. The B2M-TAG-sgRNA double-stranded DNA sequence was connected with the BbsI linearized pSpCas9(BB)-2A-Puro(PX459) (Addgene, 62988) vector, positive clones were picked and sequenced to verify the construction of the px459-B2M-TAG-sgRNA vector Figure 1).
[0065] Gene template repair vector construction: To verify the iPSC-IFN-γ expression system can simultaneously regulate the expression of multiple genes, we linked the HLA-G, CD47 and EGFP gene coding sequences through P2A and T2A sequences, and designed them to be placed in the open reading frame of the B2M gene. The repair template vector sequence was designed as: LA (without stop codon) + linker sequence + HLA-G coding sequence + P2A sequence + CD47 coding sequence + T2A sequence + EGFP sequence (including stop codon) + RA, which is the homologous arm sequence downstream of the B2M gene cleavage site. After the above sequence was synthesized by whole gene synthesis, it was cloned into the pUC57-mini vector (Jinsu Biological), and the vector was named pUC57-HLA-G-CD47-EGFP (see Figure 1 ) for details).
[0066] Example 2: Design and construction of IFN-γ induced expression iPS cell strain
[0067] According to our design of the iPSC-IFN-γ induced expression system, we will
[0068] px459-B2M-TAG-sgRNA and pUC57-HLA-G-CD47-EGFP were co-electroporated into iPS cells, so that the HLA-G-CD47-EGFP gene fragment was integrated downstream of the B2M gene, so that HLA-G was expressed in fusion with the B2M gene, and CD47 and EGFP were independently expressed (see Figure 2 ) for details). The specific construction process is as follows:
[0069] iPSC electroporation and resistance screening: 10 6iPS cells and 3 μg or 4 μg plasmid (px459-B2M-TAG-sgRNA and pUC57-HLA-G-CD47-EGFP molar ratio of 1:3) were mixed with 20 μl of electroporation buffer in a well of the electroporation strip, and then electroporated using the DS130 program. The electroporated iPS cells were added to 900 μl of complete medium, incubated at 37°C in a 5% carbon dioxide incubator for 30 minutes, and then transferred to a 12-well plate for culture. After 48 hours of electroporation, 0.2 μg / ml of puromycin was used for screening. An empty vector electroporation group was also set up for resistance screening. When the cells in the empty vector electroporation group were all apoptotic, the iPS cells in the electroporation experiment group were replaced with normal complete culture medium for continuous culture. When the cells were stably expanded and in good condition, the IFN-γ inducible expression iPS cell line was obtained. Flow cytometry was used to detect the two transduction groups and the untransfected group. The results showed that the right side of the 3 μg and 4 μg plasmid electroporation groups appeared a GFP positive cell population, and B2M staining flow cytometry showed that a part of the B2M low expression cell population appeared (see Figure 3 ), wherein the GFP positive and B2M low expression cell population is the IFN-γ inducible expression iPS cell.
[0070] IFN-γ inducible expression iPS cell line picking: Accutase (StemCell) was used to digest and disperse the IFN-γ inducible expression iPS cell line to prepare a single cell suspension. After cell counting, 800-1000 iPSCs were inoculated in a 6 cm dish coated with Laminin-521 (StemCell) for continuous culture. The medium was changed every day during the culture. After 7 days of culture, single clones were observed under an inverted microscope and picked for inoculation in a 48-well plate coated with Laminin-521 for continuous expansion and culture. Flow cytometry was used to detect the GFP expression of each clone. The results showed that among the 7 cells detected, 4 were single clones and expressed GFP, and the other 3 were polyclonal cells (see Figure 4 ). # and 53 # were picked for functional verification.
[0071] Example 3: Functional verification of the IFN-γ inducible expression iPS cell line
[0072] The candidate IFN-γ inducible expression iPS cell lines 18 # , 53 # obtained in Example 2 and the iPS mother cell line were inoculated at a density of 3 × 10 4 / cm 2Inoculate to 24-well plates and set up duplicate wells, change the medium every day, change the medium of one well with 25 ng / ml IFN-γ after inoculating for 2 days, and change the medium of the other well without IFN-γ. After 2 days of treatment in the above-mentioned manner, observe the GFP-expressing cells under an inverted fluorescence microscope, and the results show that the GFP expression of the IFN-γ-treated 18 # , 53 # The cell strains express GFP, and the IFN-γ-untreated group does not express GFP (see Figure 5 ), and the cells in each group are digested with Accutase and collected, and each group of cells is divided into 3 parts, which are stained with B2M-PE, HLA-G-PE and CD47-APC antibodies, respectively, and the results of flow cytometry detection show that, compared with the IFN-γ-untreated group, the B2M protein of the IFN-γ-treated 3 cell strains is highly expressed, among which the genetically modified iPS cell strains 18 # and 53 # highly express HLA-G, CD47 and GFP under the stimulation of IFN-γ (see Figure 6 ). In order to fully verify the IFN-γ-induced expression function of the genetically modified iPS cell strains 18 # and 53 # , we treated the 18 # and 53 # clone strains with the same dose of IFN-γ, and detected the expression of HLA-G and CD47 genes by qPCR method, and the results show that, compared with the IFN-γ-untreated cells, the expression of HLA-G and CD47 of the genetically modified iPSC-18 # clone increased by about 20 times under the stimulation of IFN-γ, and the expression of HLA-G and CD47 of the iPSC-53 # clone increased by about 40 times Figure 7 ).
[0073] Although the technical solutions of the present application have been described and listed in detail, it should be understood that modifications to the above-mentioned embodiments or the adoption of equivalent alternatives will be apparent to those skilled in the art, and these modifications or improvements made without departing from the spirit of the present application are within the scope of the present application.
Claims
1. A plasmid vector, characterized in that: This plasmid vector contains a gene cutting vector and a template repair vector; The gene cutting vector is an sgRNA and Cas9 protein expression vector targeting the B2M gene stop codon; the template repair vector is a plasmid vector with 600bp DNA sequences flanking the cleavage site near the B2M gene stop codon as its two wings, in which HLA-G, CD47 and EGFP gene coding sequences are inserted. The gene cutting vector uses the px459 vector as a backbone to construct a gRNA / Cas9 expression vector. The gene expression structure of the gRNA / Cas9 expression vector is: U6 promoter sequence + B2M-TAG-sgRNA transcription sequence + EF1a promoter + Cas9 coding sequence, which is the gene cutting vector. The gene cutting vector is named px459-B2M-TAG-sgRNA. The template repair vector uses the pUC57 cloning vector as its backbone and includes an upstream homologous sequence (LA) of the cleavage site, a protein fusion linker sequence, an HLA-G coding sequence, a P2A sequence, a CD47 gene coding sequence, a T2A sequence, an EGFP coding sequence, and a downstream homologous sequence (RA) of the cleavage site. This is the template repair vector, and its nucleic acid sequence is shown in SEQ ID NO2. The template repair vector is named pUC57-HLA-G-CD47-EGFP.
2. A method for constructing a plasmid vector as described in claim 1, characterized in that, The method includes the following steps: Gene cutting vector construction: DNA sequences near the B2M gene stop codon site were selected as candidate target sequences. The sgRNA was designed and selected by the online CRISPOR program and named B2M-TAG-sgRNA. Its nucleic acid sequence is shown in SEQ ID NO1. The complementary single-stranded DNA sequence of B2M-TAG-sgRNA was synthesized by primers and mixed in an equal proportion in a 20µl reaction system. The mixture was denatured at 95°C for 5 minutes and annealed at room temperature for 2 hours to synthesize double-stranded DNA. The double-stranded DNA sequence was ligated with the BbSI linearized pSpCas9(BB)-2A-Puro(PX459) vector, positive clones were selected and sequenced for verification, and the gene cutting vector was constructed and named px459-B2M-TAG-sgRNA. Construction of the gene template repair vector: The coding sequences of HLA-G, CD47, and EGFP genes were linked by P2A and T2A sequences and designed to be placed within the open reading frame of the B2M gene. The gene template repair vector sequence was designed as follows: upstream homologous arm sequence LA (without stop codon) of the B2M gene cleavage site + linker sequence + HLA-G coding sequence + P2A sequence + CD47 coding sequence + T2A sequence + EGFP sequence (containing stop codon) + downstream homologous arm sequence RA of the B2M gene cleavage site. After the above sequences were synthesized into whole genome, they were cloned into the pUC57-mini vector. The constructed vector was named pUC57-HLA-G-CD47-EGFP.
3. A system for expressing exogenous genes in iPSCs in response to IFN-γ induction, constructed using the plasmid vector as described in claim 1, characterized in that: The exogenous gene expression system refers to an iPS cell line constructed using CRISPR / Cas9 technology that can regulate and highly express exogenous genes under IFN-γ stimulation; The gene cutting vector px459-B2M-TAG-sgRNA and the template repair vector pUC57-HLA-G-CD47-EGFP were co-electrolyzed into iPS cells, which integrated the HLA-G-CD47-EGFP gene fragment downstream of the B2M gene, resulting in the fusion expression of HLA-G and B2M genes, while CD47 and EGFP were expressed independently.
4. A method for constructing an IFN-γ-induced exogenous gene expression system in iPSCs using the plasmid vector as described in claim 1, characterized in that, The method includes the following steps: Electroporation and screening of IFN-γ-induced exogenous gene-expressing iPS cells: Using the 4D nucleofector X electroporation system and P3 Primary cell kit, iPS cells and plasmids were mixed with 20µl of electroporation buffer. Screening was performed 48 hours after electroporation. An empty vector electroporation group was set up for simultaneous selection of resistance. After all cells in the empty vector electroporation group had apoptosis, the iPS cells in the electroporation experimental group were replaced with normal complete culture medium and cultured for a longer period. When the cells expanded stably and were in good condition, the IFN-γ-induced iPS cell line was obtained. Construction of IFN-γ-induced exogenous gene-expressing iPS cell lines: IFN-γ-induced expression iPS cell lines were obtained by digestion and dispersion with Accutase. Single-cell suspensions were prepared, and after cell counting, 800-1000 iPS cells were seeded into 6cm plates coated with Laminin-521 for continuous culture. The medium was changed daily. After 7 days of culture, monoclonal iPS cells were observed under a microscope and picked and seeded into 48-well plates coated with Laminin-521 for further amplification. Monoclonal cell lines were obtained and identified by PCR genotyping and flow cytometry phenotype, which confirmed that the cells were IFN-γ-induced exogenous gene-expressing iPS cell lines.
5. The method for constructing an IFN-γ-induced exogenous gene expression system in iPSCs according to claim 4, characterized in that: In the construction of IFN-γ-induced iPS cell lines, the electroporation of iPS cells was performed, with 10 6 Mix one iPS cell and 3 µg or 4 µg of plasmid in 20 µl of electroporation buffer.
6. The method for constructing an IFN-γ-induced exogenous gene expression system in iPSCs according to claim 5, characterized in that: The molar ratio of the gene cutting vector px459-B2M-TAG-sgRNA to the template repair vector pUC57-HLA-G-CD47-EGFP in the plasmid is 1:
3.
7. The method for constructing an IFN-γ-induced exogenous gene expression system in iPSCs according to claim 4, characterized in that: The iPS cell screening for IFN-γ-induced expression of exogenous genes used 0.2 µg / ml of puromycin.
8. The method for constructing an IFN-γ-induced exogenous gene expression system in iPSCs according to claim 4, characterized in that: The specific steps of the electroporation are as follows: add the cells to one well of the electroporation strip, electroporate using the DS130 or CM198 program, add 900µl of complete culture medium to the electroporated iPS cells, incubate in a 5% CO2 incubator at 37°C for 30 minutes, and then transfer to a 12-well plate for further culture for 48 hours.
Citation Information
Patent Citations
Application of super enhancer gene sequence in promoting expression of human B2M gene
CN113801881A
Low-immunogenicity iPSC cell strain
CN116515740A