Molecular marker primer, kit and application for rapidly identifying high-temperature-resistant individuals of largemouth bass

Abstract

The present application relates to the technical field of biomolecular marker detection, and particularly relates to a molecular marker primer, a kit and an application for rapidly identifying high-temperature-resistant individuals of Micropterus salmoides. The molecular marker primer for rapidly identifying high-temperature-resistant individuals of Micropterus salmoides is composed of a forward primer and a reverse primer, the sequence of the forward primer P1-F is CTACACACCAGTAAAGAGGCAGG, and the sequence of the reverse primer P1-R is CTTCTGTATCCATTGGCTTCTGC. The present application can accurately distinguish high-temperature-resistant individuals of Micropterus salmoides from non-high-temperature-resistant individuals by using molecular marker primer PCR amplification, the method is faster, more accurate and lower in cost, can rapidly identify and screen high-temperature-resistant individuals of Micropterus salmoides at an early stage, improves the breeding efficiency, and accelerates the breeding process of high-temperature-resistant Micropterus salmoides.

Description

Technical Field

[0001] This invention relates to the field of biomolecular marker detection technology, and in particular to a molecular marker primer, kit, and application for rapid identification of heat-resistant individuals of largemouth bass. Background Technology

[0002] Largemouth bass ( Micropterus salmoides ), commonly known as California bass or black bass, belongs to the order Perciformes ( Perciformes ), Perciformes ( Porcoidei ), Sunfish family ( Cehtrachidae ), Black perch ( Micropterus Largemouth bass, native to North America, is a globally popular recreational fishing species. After years of aquaculture development, it has become one of the important freshwater aquaculture species in China. In 2023, my country's annual production of largemouth bass was 888,000 tons, with Guangdong Province being the main aquaculture area, accounting for more than 40% of the domestic total production. Currently, only the superior varieties "Youlu No. 1" and "Youlu No. 3" are available on the market, and the existing varieties cannot fully meet market demand, thus urgently requiring germplasm innovation.

[0003] With global climate change and the increasing frequency of extreme heat events, breeding new heat-resistant varieties of largemouth bass has become particularly important. The optimal growth temperature for largemouth bass is 25-28℃. However, during aquaculture, it has been found that largemouth bass exhibits a high degree of stress from high temperatures. Sustained high temperatures in summer negatively impact their physiological and biochemical indicators, leading to poor feeding, slow growth, frequent disease outbreaks, and high mortality rates, resulting in significant economic losses. Therefore, breeding superior heat-resistant varieties of largemouth bass is imperative.

[0004] Traditional methods for breeding heat-tolerant largemouth bass, such as the Chinese invention patent application (publication number: CN115553233A, publication date: 2023-01-03), disclose a method for breeding heat-tolerant largemouth bass, including large-scale population selection, gene sequencing, generational breeding and grouping with gene homozygosity determination, establishing generations and conducting population selection, breeding generations and verifying heat tolerance; using a combination of population selection and gene selection to cultivate three generations, selecting largemouth bass with fast growth and heat tolerance, expanding the suitable temperature range for largemouth bass growth, and increasing largemouth bass yield. Traditional breeding methods require multiple generations of breeding and screening, which is time-consuming, typically requiring several years to obtain a stable heat-tolerant breed. This is a high time cost for the aquaculture industry, which needs to quickly respond to climate change and market demands. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a molecular marker primer for rapidly identifying heat-resistant largemouth bass individuals. PCR amplification using molecular marker primers can accurately distinguish between heat-resistant and heat-intolerant largemouth bass individuals. This method is faster, more accurate, and lower in cost, enabling rapid identification and screening of heat-resistant largemouth bass individuals at an early stage, thereby improving breeding efficiency and accelerating the breeding process of heat-resistant largemouth bass.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A molecular marker primer for rapid identification of heat-resistant individuals of largemouth bass. The molecular marker consists of a forward primer and a reverse primer. The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC.

[0008] Furthermore, this invention also discloses the application of the aforementioned molecular markers in the rapid identification of heat-resistant individuals of largemouth bass. After the largemouth bass DNA is amplified by PCR using molecular marker primers, it is detected by agarose gel electrophoresis. Individuals with a 244bp amplification product are heat-resistant, while those with a 288bp amplification product are heat-intolerant.

[0009] Furthermore, the present invention also discloses a kit comprising the aforementioned molecular marker primers.

[0010] Furthermore, this invention also discloses the application of the kit in the rapid identification of heat-resistant individuals of largemouth bass. After the DNA of largemouth bass is amplified by molecular marker primer PCR, it is detected by agarose gel electrophoresis. Individuals with a 244bp amplification product are heat-resistant, while those with a 288bp amplification product are heat-intolerant.

[0011] Furthermore, this invention also discloses a method for rapidly identifying heat-resistant individuals of largemouth bass, the method comprising the following steps:

[0012] 1) Extract DNA from largemouth bass;

[0013] 2) The DNA of largemouth bass was amplified by PCR using the molecular marker primers described above. After the PCR amplification was completed, the results were detected by agarose gel electrophoresis. Individuals with a 244bp amplification product were heat-resistant, while those with a 288bp amplification product were heat-intolerant.

[0014] Preferably, the PCR reaction system for the PCR amplification is as follows: 10 μL of 2×Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; and 0.5 μL each of forward and reverse primers.

[0015] Preferably, the PCR amplification reaction program is as follows: 94℃ for 5 min; 94℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 35 cycles; extension at 72℃ for 10 min.

[0016] This invention, by employing the aforementioned technical solution, enables rapid and accurate identification of the heat resistance of largemouth bass using molecular marker primers and their applications. This significantly improves breeding efficiency, reduces costs, and provides strong technical support for the breeding of heat-resistant largemouth bass. Specifically, the effects are as follows:

[0017] 1. Rapid Identification: Using the molecular marker primers of this invention, the heat tolerance of largemouth bass can be accurately identified in a short time. Compared with traditional breeding methods that require multiple generations of breeding and screening, this method can significantly shorten the identification time and achieve rapid judgment of the heat tolerance of individuals.

[0018] 2. High Precision: This molecular marker primer targets specific gene loci related to the heat tolerance of largemouth bass. Using PCR amplification and agarose gel electrophoresis, it achieves precise differentiation between heat-tolerant and heat-intolerant individuals. Individuals with a 244bp amplification product are heat-tolerant, while those with a 288bp amplification product are heat-intolerant. This high precision can significantly improve the success rate of breeding heat-tolerant varieties.

[0019] 3. Improved Breeding Efficiency: The method of this invention allows for rapid screening of individuals with high-temperature resistance at an early stage, significantly improving breeding efficiency and reducing the time and resource investment required during the breeding process. Compared with traditional multi-generational population breeding, this method significantly improves breeding efficiency and provides an effective means for large-scale breeding of high-temperature resistant largemouth bass.

[0020] 4. Reduced Costs: Using molecular marker technology for high-temperature resistance identification eliminates the need for large-scale gene sequencing and multi-generation breeding, reducing the human, material, and financial costs in the breeding process. The simplified experimental procedure and low-cost reagent consumption make this method highly economical and feasible.

[0021] 5. Facilitates the development of heat-resistant varieties: Through the rapid identification of heat-resistant largemouth bass individuals, this invention helps to establish heat-resistant populations, providing a foundation for the subsequent breeding of new largemouth bass varieties with stronger heat resistance. Attached Figure Description

[0022] Figure 1 It is a time-density graph of high-temperature stress for Micropterus salmoides.

[0023] Figure 2 It is a correlation graph of growth traits and CTMax of high-temperature tolerance for Micropterus salmoides.

[0024] Figure 3 It is a graph of PCR amplification and agarose gel electrophoresis of the DNA of Micropterus salmoides. Specific implementation manners

[0025] Combined with the embodiments of the present invention below, the technical solutions in the embodiments will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the protection scope of the present invention.

[0026] Embodiment 1: Design of specific primer P1

[0027] To truly reflect the high-temperature tolerance performance CTMax (the temperature at which the fish body loses balance for more than 30 s is regarded as the CTMax of each individual) of the fry of Micropterus salmoides bred in the current year in high-temperature pond culture in summer, the applicant collected 200 fry of Micropterus salmoides bred in the current year respectively during the high-temperature culture stage in summer (early August). After being temporarily cultured in the laboratory for one week, a high-temperature stress experiment was carried out, and feeding was stopped 2 days before the experiment. The initial water temperature of the experiment was 25 °C, and the heating method of increasing 1 °C / h per hour was adopted until the experimental fish began to die. Statistical analysis found that the CTMax of Micropterus salmoides was 34.5 °C - 37.8 °C. According to the high-temperature tolerance time, it was divided into "high-temperature intolerant type" (t ≤ 200 min), "intermediate type" (200 min < t < 360 min) and "high-temperature tolerant type" (t ≥ 360 min) ( Figure 1 ). Through the analysis of extreme phenotype results, it was found that there was no significant correlation between growth traits (body weight, total length, body length, body width and body height) and CTMax, and CTMax was only significantly correlated with the high-temperature tolerance time ( Figure 2 ).

[0028] To further determine the key genes related to the high-temperature traits of Micropterus salmoides, the applicant carried out genome re-sequencing analysis on the high-temperature tolerant group (t ≥ 360 min) and the high-temperature intolerant group (t ≤ 200 min), and developed a specific primer P1. The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC. This primer can accurately distinguish between high-temperature tolerant and high-temperature intolerant individuals of Micropterus salmoides ( Figure 3This will be beneficial for the establishment of a population of heat-resistant largemouth bass.

[0029] Example 2: Application and application method of specific primer P1

[0030] 1. Genomic DNA extraction

[0031] Genomic DNA was extracted from the fin rays of largemouth bass. A suitable amount of tissue was taken and extracted using the Marine Animals DNA Kit (DNATIANamp Marine Animals DNAKit, Cat No. DP324-03, Lot #Q5202). Quality control methods included 1.2% agarose gel electrophoresis (110V constant voltage electrophoresis for 1 h; DL2000 Marker) and NanoDrop 2000 to determine the quality and concentration of the genomic DNA. Results showed that the extracted DNA master band was clear, with no obvious degradation, OD260 / 280 values ​​of 1.8–1.9, and OD260 / 230 values ​​of 1.9–2.3, meeting the purity requirements. Finally, the extracted DNA was diluted to 50 ng / μL and stored for later use.

[0032] 2. PCR amplification and gel electrophoresis detection

[0033] The specific primer P1 developed in this invention was used. The sequence of the forward primer P1-F is CTACACACCAGTAAAGAGGCAGG, and the sequence of the reverse primer P1-R is CTTCTGTATCCATTGGCTTCTGC. DNA samples from largemouth bass were used as templates for PCR amplification. The PCR reaction system was as follows: 10 μL of 2×Taq PCR mix; 8 μL of Decc H2O; 1 μL of DNA template; 0.5 μL / 0.5 μL of PB1-F / -R. The reaction program was: 94℃ for 5 min; 94℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 35 cycles; extension at 72℃ for 10 min, followed by storage at 4℃. After PCR amplification, the results were detected by 1.2% agarose gel electrophoresis (V=120V, A=400mA, T=1h).

[0034] 3. Results Analysis

[0035] DNA from largemouth bass was amplified by PCR and subjected to agarose gel electrophoresis, such as... Figure 3 As shown, the results were observed using a UV gel imaging system to detect the amplification results:

[0036] Individuals with an amplification product size of 244 bp are heat-resistant.

[0037] Individuals with an amplification product size of 288 bp are heat-intolerant.

[0038] Example 3: Determination of the high-temperature resistance of largemouth bass

[0039] I. Phenotypic Determination of High-Temperature Tolerance of Largemouth Bass

[0040] 1. Sample selection: 650 individuals were randomly selected from the largemouth bass population.

[0041] 2. High-temperature stress experiment:

[0042] Largemouth bass were placed individually in water at 25°C. The water temperature was gradually increased by 1°C per hour until it reached 37.8°C. The time it took for each fish to lose its balance (CTMax) was recorded during this period. Based on the time tolerating the high temperature, the individuals were divided into two groups: heat-tolerant (t ≥ 360 min) and heat-intolerant (t ≤ 200 min).

[0043] 3. Record data: Record the CTMax value of each individual and its corresponding high temperature tolerance type.

[0044] II. Molecular Marker Detection

[0045] The method described in Example 2 was used.

[0046] III. Data Analysis

[0047] 1. Result comparison: The molecular marker detection results were compared with the phenotypic data from the high temperature stress experiment to calculate the accuracy of molecular marker primers in identifying heat-resistant and heat-intolerant individuals.

[0048] 2. Results

[0049] Actual high temperature resistant individuals Molecular marker detection for heat-resistant individuals Individuals that are actually intolerant to high temperatures Molecular marker detection indicates individuals intolerant to high temperatures intermediate type Experimental results 34 34 337 337 279

[0050] PCR amplification and agarose gel electrophoresis were performed. Heat-resistant individuals should show a 244 bp amplification product, while heat-intolerant individuals should show a 288 bp amplification product. The results of the molecular marker primer detection should be highly consistent with the phenotypic data from the high-temperature stress experiment, with an accuracy of 100%, indicating that the molecular marker primers of this invention can accurately identify the heat resistance of largemouth bass. The sensitivity and specificity of the molecular marker detection should both be high, demonstrating its reliability and practicality in real-world applications.

[0051] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.

Claims

1. The application of molecular marker primers in the rapid identification of heat-resistant individuals of largemouth bass, characterized in that, The molecular marker primers consist of a forward primer and a reverse primer. The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC. After the DNA of the largemouth bass was amplified by PCR using the molecular marker primers, it was detected by agarose gel electrophoresis. Individuals with an amplification product size of 244 bp were heat-resistant, while individuals with an amplification product size of 288 bp were heat-intolerant.

2. Application of the kit in the rapid identification of heat-resistant individuals of largemouth bass. The kit contains molecular marker primers, which consist of forward and reverse primers. Its characteristic is that... The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC. Largemouth bass DNA was amplified by molecular marker primer PCR and then detected by agarose gel electrophoresis. Individuals with an amplification product size of 244 bp were heat-resistant, while those with an amplification product size of 288 bp were heat-intolerant.

3. A method for rapidly identifying heat-resistant individuals of largemouth bass, characterized in that, The method includes the following steps: 1) Extract DNA from largemouth bass; 2) PCR amplification of largemouth bass DNA was performed using molecular marker primers. After PCR amplification, the results were detected by agarose gel electrophoresis. The molecular marker primers consisted of a forward primer and a reverse primer. The forward primer P1-F sequence was CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence was CTTCTGTATCCATTGGCTTCTGC. Individuals with an amplification product size of 244 bp were heat-resistant, while individuals with an amplification product size of 288 bp were heat-intolerant.

4. The method as described in claim 3, characterized in that, The PCR reaction system for the PCR amplification was as follows: 10 μL of 2×Taq PCRmix; 8 μL of Depc H2O; 1 μL of DNA template; and 0.5 μL each of forward and reverse primers.

5. The method as described in claim 4, characterized in that, The PCR amplification reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s; 58℃ for 30 s; 72℃ for 30 s; 35 cycles; extension at 72℃ for 10 min.

Images