A multifunctional DNA nanosphere, its preparation method and application

Abstract

The present invention relates to the field of biomedicine, and particularly to a multifunctional DNA nanosphere and its preparation method and application. In the present invention, an acid-responsive i-motif sequence, an EGFRvⅢ aptamer A32 sequence, and an MRI contrast agent Gd-DOTA-N3 are combined to design a DNA nanosphere, so as to achieve integrated dual imaging of MRI enhancement / fluorescence for glioma, with the expectation of obtaining glioma tumor imaging signals that can meet clinical requirements. At the same time, in the present invention, an acid-responsive i-motif sequence, an EGFRvⅢ aptamer A32 sequence, an MRI contrast agent Gd-DOTA-N3, and a chemotherapeutic drug doxorubicin (DOX) are combined, and Gd-DOTA-N3 and Cy5-BHQ fluorescence pairs are modified on specific bases. Using the principle of DNA base complementary pairing, a novel multifunctional DNA nanosphere for fluorescence / MRI imaging and treatment of glioma is prepared.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a multifunctional DNA nanosphere and its preparation method and application. Background Art

[0002] Currently, magnetic resonance imaging (MRI) is the most effective examination method for visualizing the scope of gliomas and judging the adjacent relationship of tumors. Through MRI scans of different sequences and enhanced scans with gadolinium contrast agents, it can assist in visualizing gliomas and guiding the surgical resection of gliomas. However, MRI examinations, including enhanced scans, still have the following deficiencies in visualizing gliomas:

[0003] (1) What MRI shows is the preoperative tumor image scope and does not represent the actual tumor boundary observed during the operation; currently, the MRI intraoperative navigation technology for guiding the scope of gliomas using MRI also has the problem of "deformation and displacement of brain tissue"; while the navigation combined with intraoperative MRI (iMRI) technology is greatly limited in its widespread clinical promotion due to deficiencies such as high operating costs and objectively prolonged surgical anesthesia time;

[0004] (2) The current principle of MRI enhanced imaging mainly utilizes the incomplete integrity of the walls of newly formed tumor blood vessels in gliomas. The contrast agent gadolinium can penetrate the tumor blood-brain barrier (tBBB), and thus accumulate in the enlarged extracellular space of the tumor to achieve enhanced imaging of gliomas. It does not truly target and enter glioma tumor cells. Therefore, in cases such as low-grade gliomas with relatively intact tBBB, the enhanced MRI imaging of the scope of gliomas is not ideal; in addition, since the retention time of gadolinium in glioma tumor tissue is relatively short, in order to ensure the enhanced effect, the actual dose of gadolinium used will remain in organs such as the kidneys and liver, thereby increasing the risk of secondary damage to organs such as the kidneys and liver;

[0005] (3) It is sometimes also difficult to effectively distinguish between tumor pseudo-progression, local radiation necrosis, and glioma recurrence that occur during the resection of gliomas and adjuvant radiotherapy through MRI enhanced scans.

[0006] Therefore, it is necessary to solve the above problems to fully utilize the advantages of MRI in visualizing gliomas. For the tumor fluorescence imaging of gliomas, although fluorescence-guided surgery (FGS) based on fluorescent agents such as 5-aminolevulinic acid (5-ALA) and fluorescein sodium (FLS-Na) has been used to define the scope of gliomas during the operation, there are still many deficiencies:

[0007] (1) Clinical application has found that the fluorescence range derived from 5-ALA during surgery does not match the enhanced MRI imaging range: it usually exceeds the enhanced area of glioma tumors shown by MRI; at the same time, the fluorescence duration of 5-ALA is still not sufficient, and the imaging range and intensity are constantly attenuating. Coupled with the interference of ambient light, the accuracy of intraoperative 5-ALA tumor fluorescence imaging is affected to varying degrees;

[0008] (2) The imaging of glioma by FLS-Na is achieved by entering the tumor through the disrupted tBBB. Therefore, the fluorescence intensity of FLS-Na is not high in low-grade gliomas with relatively intact tBBB, and the imaging of tumors is not ideal; in addition, the fluorescence duration of FLS-Na is also limited. FLS-Na will experience intraoperative fluorescence diffusion and intensity attenuation, making the fluorescence coloring of structures such as meninges in the surgical area more obvious, which brings difficulties to the long-term imaging and identification of the glioma range during surgery;

[0009] (3) More importantly, both 5-ALA and FLS-Na belong to non-specific glioma imaging and lack the ability to target and identify glioma tumor cells. Inevitably, there will be non-specific fluorescence coloring outside glioma tumor cells to a certain extent, thus affecting the accurate judgment of the glioma range.

[0010] As can be seen from the above, both glioma magnetic resonance imaging and intraoperative glioma fluorescence imaging are independent single tumor imaging modes. How to achieve integrated multimodal imaging of gliomas, effectively fuse intraoperative tumor fluorescence imaging with preoperative MRI imaging, especially MRI enhanced imaging, confirm each other, and assist each other, overcome the respective deficiencies of current MRI and fluorescence imaging in glioma tumor imaging, and achieve precise resection of gliomas under multimodal imaging is an urgent problem that needs to be solved in current clinical glioma imaging-assisted surgery.

[0011] Chemotherapy is an important supplement to the treatment of gliomas. However, even with the combined treatment of surgical resection and chemotherapy drugs within the maximum safe range, the postoperative survival period of most patients is still less than 2 years. The reasons include: (1) Conventional chemotherapy blocks the growth and division of cancer cells by interfering with DNA replication and cell mitosis. However, most chemotherapy drugs are non-specific and will inevitably cause side effects, and the severe adverse reactions caused are closely related to the high mortality rate of patients; (2) The existence of the blood-brain barrier and blood-tumor barrier prevents the delivery of macromolecular drugs and small-molecule non-lipid-soluble drugs. At the same time, there are various adverse factors such as damage to blood vessels in the tumor area, acidic microenvironment of tumor tissues, and highly invasive growth of gliomas, which make the delivery of chemotherapy drugs for gliomas a difficult problem; (3) To achieve an effective drug concentration, high doses of chemotherapy drugs are often required, which can easily induce chemotherapy resistance in tumors and lead to poor efficacy and prognosis. Therefore, in recent years, a large number of nanoparticle-based drug delivery systems have emerged in an endless stream. Using a nanodelivery system to carry anticancer drugs can cross the blood-brain barrier and reach the lesion site. Nanotechnology provides more diverse options and strategies for drug research and development, and there is an urgent need to develop a drug delivery system with glioma cell specificity, mild side effects, and good efficacy.

[0012] Glioblastoma is the most common primary intracranial tumor and the vast majority are malignant. Although there are currently various treatment methods including surgical resection, radiotherapy, and chemotherapy, unfortunately, the comprehensive treatment efficacy of glioblastoma has stagnated in recent years, and gene therapy and immunotherapy have not been successful. The reasons include the following three points: (1) Glioblastoma cells are highly invasive, which makes it very difficult to completely remove gliomas surgically, and this is also an important reason for the recurrence of gliomas after surgery; (2) Due to the existence of the blood-brain barrier and blood-tumor barrier, chemotherapy drugs often have difficulty reaching the intracranial tumor area and have relatively large toxic and side effects on normal tissues; (3) Chemoresistance is also one of the main reasons for the recurrence and low survival rate of patients, and 40-50% of patients are resistant to temozolomide.

[0013] Therefore, the present invention focuses on the above problems and realizes the integrated dual imaging of MRI enhancement / fluorescence of gliomas by designing a multifunctional DNA nanosphere, in order to obtain a glioma tumor imaging signal that can meet clinical needs. At the same time, by loading chemotherapy drugs, it can precisely kill glioma cells, and thus obtain a significant synergistic chemotherapy effect on tumors. Summary of the Invention

[0014] The purpose of the present invention is to provide a multifunctional DNA nanosphere and its preparation method and application to solve the problems existing in the above-mentioned prior art. Using the preparation method provided by the present invention, a multifunctional DNA nanosphere with dual imaging and the ability to treat gliomas can be obtained.

[0015] To achieve the above object, the present invention provides the following solutions:

[0016] The present invention provides a method for preparing DNA nanospheres for dual imaging of gliomas, comprising the following steps:

[0017] Covalently link Gd-DOTA-N 3 and Y1-1 through click chemistry reaction to obtain Gd-DOTA-N 3 modified Y1-1; the nucleotide sequence of the Y1-1 is shown in SEQ ID NO.7;

[0018] Mix Y-DNA, L-DNA and A32 to obtain a mixed system; the Y-DNA includes Gd-DOTA-N 3 modified Y1-1 with nucleotides as described in SEQ ID NO.7, Y2 with nucleotides as described in SEQ ID NO.2, and Y3 with nucleotides as described in SEQ ID NO.3; the L-DNA includes Linker 1 with a nucleotide sequence shown in SEQ ID NO.4 and Linker 2 with a nucleotide sequence shown in SEQ ID NO.5; the nucleotide sequence of the A32 is shown in SEQ ID NO.6;

[0019] After heating and treating the mixed system, cool it to obtain a solution containing the DNA nanospheres.

[0020] Preferably, the molar ratio of Gd-DOTA-N 3 modified Y1-1, Y2 and Y3 in the Y-DNA is 1:1:1;

[0021] The molar ratio of Linker 1 and Linker 2 in the L-DNA is 1:1;

[0022] The molar ratio of Y-DNA and L-DNA in the mixed system is 3:5, the molar ratio of A32 and L-DNA is 1:5, and the final concentration of Gd-DOTA-N 3 is 9 μM.

[0023] Preferably, the temperature of the heating treatment is 95 °C and the time is 5 min.

[0024] The present invention provides an application of the DNA nanospheres prepared by the above preparation method in the preparation of products for diagnosing gliomas.

[0025] The present invention provides a method for preparing multifunctional DNA nanospheres for dual imaging and treatment of gliomas, comprising the following steps:

[0026] Covalently link Gd-DOTA-N3 Covalently linked to Y1-1 to obtain Gd-DOTA-N 3 Modified Y1-1; the nucleotide sequence of the Y1-1 is shown in SEQ ID NO.7;

[0027] Mix Y-DNA, L-DNA and A32 to obtain a mixed system; the Y-DNA includes Gd-DOTA-N with nucleotides as described in SEQ ID NO.7 3 Modified Y1-1, Y2 with nucleotides as shown in SEQ ID NO.2, and Y3 with nucleotides as shown in SEQ ID NO.3; the L-DNA includes Linker 1 with a nucleotide sequence as shown in SEQ ID NO.4 and Linker 2 with a nucleotide sequence as shown in SEQ ID NO.5; the nucleotide sequence of the A32 is shown in SEQ ID NO.6;

[0028] After heat-treating the mixed system, cool it to obtain a solution of multifunctional DNA nanospheres without loaded DOX;

[0029] Mix and incubate the solution of multifunctional DNA nanospheres without loaded DOX with doxorubicin to obtain the multifunctional DNA nanospheres.

[0030] Preferably, in the Y-DNA, the molar ratio of Gd-DOTA-N 3 Modified Y1-1, Y2 and Y3 is 1:1:1;

[0031] In the L-DNA, the molar ratio of Linker 1 and Linker 2 is 1:1;

[0032] In the mixed system, the molar ratio of Y-DNA and L-DNA is 3:5, the molar ratio of A32 and L-DNA is 1:5, and the final concentration of Gd-DOTA-N 3 is 9 μM.

[0033] Preferably, the temperature of the heat treatment is 95 °C and the time is 5 min.

[0034] Preferably, the concentration of DNA nanospheres in the solution of multifunctional DNA nanospheres without loaded DOX is 3 μM; the concentration of doxorubicin is 50 μM.

[0035] The present invention provides a multifunctional DNA nanosphere prepared by using the above preparation method.

[0036] The present invention provides the application of the above multifunctional DNA nanospheres in the preparation of products for diagnosing and / or treating glioma.

[0037] The present invention discloses the following technical effects:

[0038] The present invention focuses on the above problems, combines the acid-responsive i-motif sequence, the EGFRvⅢ aptamer A32 sequence and the MRI contrast agent Gd-DOTA-N 3 to design a DNA nanosphere, realizing integrated dual imaging of MRI enhancement / fluorescence for glioma, with the expectation of obtaining glioma tumor imaging signals that can meet clinical requirements.

[0039] At the same time, the present invention combines the acid-responsive i-motif sequence, the EGFRvⅢ aptamer A32 sequence, the MRI contrast agent Gd-DOTA-N 3 and the chemotherapeutic drug doxorubicin (DOX), modifies Gd-DOTA-N 3 and the Cy5-BHQ fluorescence pair on specific bases, and uses the principle of DNA base complementary pairing to prepare a novel multifunctional DNA nanosphere for fluorescence / MRI imaging and treatment of glioma. The present invention designs three modules based on the principle of DNA base complementary pairing, namely Y-shaped DNA (Y-DNA), linker DNA (L-DNA) and aptamer DNA for preparing the nanosphere. Y-DNA consists of three single-stranded DNAs (Y1, Y2, Y3), and each single-stranded DNA contains sticky ends. To achieve MRI-enhanced imaging, a sequence containing an alkyne group, namely Y1-1, is designed at the end of Y1, and it can react with Gd-DOTA-N through click chemistry 3Covalently connect to introduce the MRI contrast agent into the DNA nanospheres. The aptamer DNA consists of aptamer A32 that can specifically bind to EGFRvⅢ and a sticky end. Therefore, the aptamer DNA (A32) can inhibit the extension of the nanospheres and target glioma cells positive for EGFRvⅢ. L-DNA is a linear double-strand assembled from Linker 1 and Linker 2 and contains two sticky ends complementary to the sticky ends of Y-DNA and A32. To achieve fluorescence imaging of gliomas, Cy5 is used to modify Linker 1. Considering that the continuous fluorescence signal of Cy5 will cause strong background interference, the quenching group BHQ-3 is modified on the paired base of Cy5 to inhibit its fluorescence emission. When in an acidic environment, Linker 1 containing the i-motif sequence folds itself to form an i-motif structure, thus separating from Linker 2, causing the DNA nanospheres to disintegrate and restoring the fluorescence of Cy5. It can be seen that the present invention realizes the precise killing of glioma cells by loading chemotherapeutic drugs, and then obtains a significant synergistic chemotherapy effect on tumors. The nanospheres have a rapid pH-responsive ability, can control the fluorescence recovery of Cy5 and the release of DOX, and the fluorescence signal-to-noise ratio can reach 1:6 at pH = 5. The targeting ability of aptamer A32 can increase the enrichment of the nanospheres in the glioma region, thus improving the dual imaging effect of the DNA nanospheres. The slow-release effect of the DNA nanospheres on DOX and the targeting ability of A32 can improve the tumor-killing efficacy of DOX. Through experimental verification, the DNA nanospheres have the ability of good dual imaging and targeted therapy integration for gliomas, and have the characteristics of strong specificity, high sensitivity, long duration, good stability, better chemotherapy effect, and lower side effects, and are expected to achieve precise guidance for glioma surgical resection and synchronous postoperative chemotherapy.

[0040] Thus, the present invention prepares a multifunctional DNA nanosphere, which can target glioma cells to achieve fluorescence / MRI dual imaging of glioma tumors, improve the efficacy of doxorubicin (DOX) against gliomas, and achieve precise guidance for glioma surgical resection and synchronous postoperative chemotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0042] Figure 1Schematic diagram of the construction of multifunctional DNA nanospheres and their dual imaging and therapeutic functions for glioma; among them, Cy5 is the Cy5 fluorescent group, BHQ3 is the BHQ-3 fluorescent group, GD is Gd-DOTA-N 3 , DOX is doxorubicin, and EGFRvⅢ is the EGFRvⅢ protein on the glioma cell membrane;

[0043] Figure 2 Characterization results of multifunctional DNA nanospheres; among them, A is the PAGE verification of DNA assembly, and the bands 1-7 are Y1, Y1+Y2, Y1+Y2+Y3, Linker 1, Linker2, Linker 1+Linker2, and multifunctional DNA nanoparticles respectively; B is the particle size analysis of DNA nanospheres with different molar ratios of Y-DNA to A32, a is the molar ratio of Y-DNA to A32 of 4:1, b is the molar ratio of Y-DNA to A32 of 3:1, and c is the molar ratio of Y-DNA to A32 of 2:1; C is the TEM image of Y-DNA; D is the multifunctional DNA nanosphere with a molar ratio of Y-DNA to A32 of 3:1; E is the observation result of scanning electron microscopy; F is the observation result of atomic force microscopy; the scale bars of C-F are 100 nm;

[0044] Figure 3 TEM images of multifunctional DNA nanospheres with different molar ratios of Y-DNA to A32; among them, A is the molar ratio of Y-DNA to A32 of 4:1; B is the molar ratio of Y-DNA to A32 of 2:1; the scale bars of A and B are 100 nm;

[0045] Figure 4 Research results on the performance of DOX-loaded DNA nanospheres; among them, A is the fluorescence spectrum of multifunctional DNA nanospheres varying with pH; B is the comparison of the pH response ability of DNA nanospheres prepared from L-DNA containing i-motif sequences and L'-DNA composed of random sequences; C is the fluorescence spectrum after incubation of multifunctional DNA nanospheres at different concentrations with 50 μM DOX; D is the fluorescence spectrum of 3 μM multifunctional DNA nanospheres after incubation with 50 μM DOX at pH 7.25 and 5.5; L-DNA includes Linker 1 with a nucleotide sequence as shown in SEQ ID NO.4 and Linker 2 with a nucleotide sequence as shown in SEQ ID NO.5, and L'-DNA includes Linker 1-1 with a nucleotide sequence as shown in SEQ ID NO.8 and Linker 2-1 with a nucleotide sequence as shown in SEQ ID NO.9; i-motif is the multifunctional nanosphere of L-DNA containing i-motif sequences, and control is the DNA nanosphere prepared from L'-DNA composed of random sequences;

[0046] Figure 5 Reversibility study of multifunctional DNA nanospheres varying between neutral pH (7.25) and acidic pH (5.00);

[0047] Figure 6 For DNA nanospheres modified with different concentrations of Gd-DOTA-N 3 T1-weighted imaging maps of DNA nanospheres; where DNA-Gd is the DNA nanosphere modified with Gd-DOTA-N 3 and DNA(control) is the DNA nanosphere without Gd-DOTA-N 3 modification;

[0048] Figure 7 Results of the cytological behavior study of DOX-loaded DNA nanospheres; A shows the fluorescence intensity of Cy5 to quantify the uptake of multifunctional DNA nanospheres after U87 cells were incubated with 3 μM multifunctional DNA nanospheres for 1 h, 3 h, and 5 h; B shows the uptake of multifunctional DNA nanospheres in U87 or U87-E cells quantified after incubation with 1 μM multifunctional DNA nanospheres for 1 h; C shows the uptake of DNA nanospheres in U87 and U87-E cells detected by flow cytometry after incubation with 1 μM multifunctional DNA nanospheres for 1 h; D shows the pH-responsive multifunctional DNA nanospheres imaging lysosomes in living cells within 1 - 6 hours, with yellow fluorescence indicating the co-localization of DNA nanospheres (red) and lysosomes (green) (bar = 30 μm); D shows, (bar = 30 μm), Hoechst is the nuclear stain, Cy5 is the Cy5 fluorophore, Lysotrack is the lysosome tracer, and Merge is the merged image; E shows representative fluorescence images of U87-E cells treated with DOX and A32-DNA-DOX (2.5 μg / mL) for 1 h, 2 h, 4 h, and 6 h, DNA-DOX is the multifunctional DNA nanosphere loaded with DOX, and Free DOX is free DOX;

[0049] Figure 8 Results of the cytotoxicity study of DNA nanospheres; where A shows the toxicity of DNA nanospheres to U87-E, U87, Hela, HA, and 293T cells detected by CCK8, PBS is PBS, and DNAnanospheres are multifunctional DNA nanospheres; B shows the IC 50 value of free DOX and A32-DNA-DOX on the viability of U87-E cells;

[0050] Figure 9Anti-tumor efficacy evaluation results in mice; among them, A is the T2-weighted MRI images after treatment with A32-DNA-DOX, DNA-DOX, free DOX, DNA nanospheres, and PBS; B is the fluorescence imaging of glioma mouse brain sections 2 hours after tail vein injection of DNA nanospheres; C is the fluorescence images of glioma tissues and various organs collected 2 hours after tail vein injection of nanospheres.

[0051] Figure 10 Anti-tumor efficacy evaluation results in mice; among them, A is the T2-weighted MRI images after treatment with A32-DNA-DOX, DNA-DOX, free DOX, DNA nanospheres, and PBS; B is the survival cycle of intracranial glioma-bearing mice in the A32-DNA-DOX, DNA-DOX, free DOX, DNA nanospheres, and PBS groups; C is the weight change curve of glioma-bearing mice in the A32-DNA-DOX, DNA-DOX, free DOX, DNA nanospheres, and PBS groups.

[0052] Figure 11 In vivo magnetic resonance imaging: T1-enhanced magnetic resonance imaging of glioma mice at different time points after intravenous injection of DNA nanospheres. Among them, A is T1-weighted imaging; B is T2-weighted imaging; C is the T1 scan result of glioma mice 0.5 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres; D is the T1 scan result of glioma mice 1 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres; E is the T1 scan result of glioma mice 2 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres; F is the T1 scan result of glioma mice 4 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres; G is the T1 scan result of glioma mice 6 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres; H is the T1 scan result of glioma mice 12 h after tail vein injection of Gd-DOTA-N 3 modified DNA nanospheres. Detailed implementation manners

[0053] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0054] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0055] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0056] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0057] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0058] Example 1

[0059] A method for preparing DNA nanospheres for dual imaging and treatment of gliomas, the schematic diagram of which is shown in FIG. Figure 1 As shown, the steps are as follows:

[0060] Step 1: Gd-DOTA-N 3 (Manufacturer: Xi'an Qiyue Biotechnology Co., Ltd., product link: https: / / www.afzhan.com / chanpin / 12679228.html) was covalently linked to Y1-1 through click chemistry reaction (the nucleotide sequence of Y1-1 is shown in Table 1, and the reaction system is shown in Table 2), and then the reaction product was purified with a 3kDa centrifugal filter to remove the reaction substrate and catalyst. The relative molecular mass of the product was detected by mass spectrometry. The relative molecular mass of the product was 15180.4, recorded as Gd-DOTA-N 3 Modified Y1-1.

[0061] Step 2: Y-DNA (Gd-DOTA-N 3The modified Y1-1, Y2, and Y3), L-DNA (Linker 1 and Linker 2), and A32 were added to 1×PBS buffer (10 mM Mg 2+ ) to obtain a mixed system. Among them, Gd-DOTA-N 3 The nucleotide sequences of the modified Y1-1, Y2, Y3, Linker 1, Linker 2, and A32 are shown in Table 1; in Y-DNA, the molar ratio of Gd-DOTA-N 3 The molar ratio of the modified Y1-1, Y2, and Y3 is 1:1:1, and the molar ratio of Linker 1 and Linker 2 in L-DNA is 1:1; the molar ratio of Y-DNA to L-DNA is 3:5, and the molar ratio of A32 to L-DNA is 1:5; in this mixed system, the final concentration of L-DNA is 5 μM, and the final concentration of Gd-DOTA-N 3 is 9 μM, and the final concentration of DNA nanospheres is 3 μM. In this step, the size of DNA nanospheres can be controlled by adjusting the molar ratio of Y-DNA to A32. The average size of DNA nanospheres in this step is about 150 nm.

[0062] Step 3: Heat the mixed system obtained in Step 2 to 95 °C and start to slowly cool to room temperature after 5 min (for DNA single-strand hybridization reaction) to obtain a DNA nanosphere mixture. The concentration of DNA nanospheres in this mixed solution is 3 μM, that is, multifunctional DNA nanospheres without loading DOX. Heating to 95 °C in this step denatures DNA and then anneals, which is beneficial for DNA hybridization.

[0063] Step 4: Incubate 50 μM of DOX with the DNA nanosphere mixture obtained in Step 3 at room temperature for 1 h. The product is purified and concentrated using a 10 kDa centrifugal filter, resuspended in PBS buffer, and stored at 4 °C to obtain multifunctional DNA nanospheres loaded with DOX. The concentration of DNA nanospheres in the DNA nanosphere mixture used in this step is 3 μM, and the concentration of DOX used is 50 μM, which can saturate the DNA nanospheres with DOX loading.

[0064] Table 1 Single-stranded DNA sequences used in this example

[0065]

[0066] Note: If there is no need to modify with a contrast agent, the sequence of Y1 can be used.

[0067] Table 2 Click chemical reaction system

[0068] Reagent Name (Concentration) Dosage 1×PBS 60 μL sodium ascorbate (10 mM) 120 μL Cu(II) sulfate (10 mM) 6 μL tris-hydroxypropyltriazolylamine (10 mM) 36 μL <![CDATA[Gd-DOTA-N 3 > 2 mg (excess) Y1-1 (100 μM) 30 μL

[0069] Example 2 Characterization of multifunctional DNA nanospheres

[0070] Polyacrylamide gel electrophoresis (PAGE) was used to verify the successful self-assembly of the multifunctional DNA nanospheres without loaded DOX prepared in Example 1. The results are shown in Figure 2 A in, and band 7 represents the successful assembly of DNA nanospheres. Compared with other components, it has the largest molecular weight and the slowest migration, indicating that the DNA self-assembly successfully formed nanospheres.

[0071] Next, dynamic light scattering (DLS) and transmission electron microscopy (TEM) were used to study the effect of the addition ratio of Y-DNA and A32 on the size of DNA nanospheres. Y-DNA and A32 were mixed at different molar ratios of 4:1, 3:1, and 2:1, while the concentration of L-DNA was 5 μM. Multifunctional DNA nanospheres without loaded DOX were prepared according to the preparation method of Example 1. The ratio of the sticky ends of Y-DNA and A32 to the sticky ends of L-DNA was 1:1, ensuring the complete reaction of ssDNA. The DLS results ( Figure 2 B in) showed that different ratios of Y-DNA and A32 could result in different nanosphere sizes; a higher ratio of A32 led to smaller nanosphere diameters. TEM showed that the DNA nanospheres had a 3D spherical shape, and the diameter was also consistent with the DLS results ( Figure 2 C-D in and Figure 3 ). When the ratio of Y-DNA to A32 was 3:1, the average particle size of the DNA nanospheres was about 134 nm.

[0072] This size was further confirmed by scanning electron microscopy (SEM) and atomic force microscopy (AFM) ( Figure 2 E and F in). The size of the nanoparticles has important clinical significance because a size <200 nm can prolong the blood circulation time. Therefore, the 134-nm multifunctional nanospheres were used in subsequent experiments.

[0073] Linker 1 tends to form an i-motif structure in an acidic environment, thus dissociating from its complementary strand, increasing the distance between the Cy5 and BHQ-3 fluorescence pairs, resulting in the restoration of the Cy5 fluorescence signal and thus generating a fluorescence signal. Therefore, the fluorescence emission spectrum was used to detect the pH response ability of the multifunctional DNA nanospheres without loaded DOX prepared in Example 1, while the DNA nanospheres prepared with L’-DNA without the i-motif structure were used as a control. The multifunctional DNA nanospheres with the i-motif structure and the DNA nanospheres without the i-motif structure were placed in buffers with different pH values, and the fluorescence intensity was measured. The results showed that the fluorescence intensity of Cy5 gradually increased with the decrease of pH, and the signal-to-noise ratio reached 1:6 ( Figure 4in A). In contrast, Linker 1-1 and Linker 2-1 that do not contain the i-motif structure did not induce the dissociation of DNA nanospheres ( Figure 4 in B). In addition, the fluorescence intensity of the multifunctional DNA nanospheres without loaded DOX prepared in Example 1 showed good reproducibility between pH-neutral solution (pH = 7.25) and acidic solution (pH = 5.0) ( Figure 5 ). This study showed that fluorescence was only generated after the multifunctional DNA nanospheres entered the lysosomes of glioma cells.

[0074] DOX can be excited to emit green or red fluorescence, and this fluorescence can be quenched when DOX is embedded in the DNA double strand. Therefore, the ability of DNA nanospheres to carry DOX was evaluated by fluorescence spectroscopy analysis. Solutions of multifunctional DNA nanospheres loaded with different concentrations of DOX were co-incubated with 50 μM DOX for 1 h and subjected to fluorescence analysis. The spectra showed that when the concentration of the multifunctional DNA nanospheres reached 2 μM, the DOX loading was almost saturated ( Figure 4 in C). Therefore, 3 μM DNA nanospheres were used to supersaturate load 50 μM DOX in subsequent experiments. Since Linker 1 can dissociate from its complementary strand in an acidic environment, part of the DOX embedded in the DNA double strand can be rapidly released in an acidic environment ( Figure 4 in D).

[0075] For enhanced MRI imaging, Gd-DOTA-N 3 was covalently linked to alkyne-modified Y1 through click chemistry reaction, thereby introducing the MRI enhancer into the multifunctional DNA nanospheres. T1-weighted scans showed that the solution of multifunctional DNA nanospheres modified with Gd-DOTA-N 3 had good T1-enhanced imaging effect and was positively correlated with the concentration of Gd-DOTA-N 3 in the solution ( Figure 6 ).

[0076] Example 3 Cell uptake and targeting ability of multifunctional DNA nanospheres

[0077] To verify whether cells can actively uptake multifunctional DNA nanospheres, DNA nanospheres were assembled using the Linker 2 sequence without modified BHQ-3, and the preparation method was the same as that in Example 1, so that the uptake of DNA nanospheres could be quantified by measuring the fluorescence intensity of Cy5. After U87 cells were incubated with multifunctional DNA nanospheres (3 μM) for 1 h, 3 h, and 5 h respectively and photographed, the results showed that Cy5 fluorescence was significantly localized outside the cell nucleus, and its red fluorescence intensity increased with the prolongation of the culture time, indicating that cells could actively uptake the nanospheres and the uptake amount was positively correlated with time ( Figure 7in A). U87-E cells (U87-EGFRv III cells, purchased from ATCC cell bank) can increase the uptake of DNA nanospheres by U87-E cells due to the high expression of EGFRv III. After incubating the multifunctional DNA nanospheres with U87 and U87-E cells for 1 h, the statistical histogram and flow cytometry showed that U87-E cells had a higher uptake of multifunctional DNA nanospheres than U87 cells ( Figure 7 in B and C).

[0078] Example 4 Co-localization analysis of multifunctional nanospheres and lysosomes

[0079] Lysosomes are acidic organelles in cells with an internal pH of about 5.0. When the multifunctional DNA nanospheres without loaded DOX are phagocytosed into cells, they will dissociate and release Cy5 fluorescence. To verify this hypothesis, the multifunctional DNA nanospheres without loaded DOX (3 μM) were incubated with U87-E cells for 1 h, 3 h, and 6 h, and the lysosomes were labeled with a green fluorescent probe. The fluorescence images showed the co-localization (yellow part) of the red fluorescence of Cy5 and the green fluorescence of lysosomes ( Figure 7 in D). A considerable part of the red fluorescence and green fluorescence were separated, which may be due to the escape of some DNA structures from lysosomes.

[0080] Example 5 Release and toxicity of multifunctional nanospheres in U87-E cells

[0081] To study the DOX release of the multifunctional DNA nanospheres loaded with DOX (A32-DNA-DOX) prepared in Example 1 in cells, U87-E cells were co-cultured with A32-DNA-DOX or free DOX for 1, 2, 4, and 6 h. The fluorescence images showed that after incubating for 1 h, free DOX could enter the interior of the nucleus, while most of the A32-DNA-DOX remained in the cytoplasm. After further incubation, A32-DNA-DOX also gradually showed nuclear localization ( Figure 7 in E).

[0082] The CCK8 assay was used to study the toxicity of the multifunctional DNA nanospheres loaded with DOX to different cells (U87-E cells, U87 cells, Hela cells, HA cells, and 293T cells), with PBS as a control. The results showed that the multifunctional DNA nanospheres with a concentration lower than 10 μM had no cytotoxicity to various cells, showing good biocompatibility ( Figure 8 in A). On the contrary, the results of the CCK8 assay showed that the cytotoxicities of free DOX and A32-DNA-DOX were both concentration-dependent, and A32-DNA-DOX showed higher cytotoxicity than free DOX ( Figure 8in B). This may be attributed to the controlled release of DOX in the cytoplasm. In an acidic environment, the acid-responsive moiety in the multifunctional DNA nanospheres loaded with DOX rapidly releases the loaded DOX, which is equivalent to the first dose of clinical administration, while the remaining DOX can be gradually released from the double strands under acidic conditions, providing a maintenance dose, which results in a higher retention rate of DOX in cells, thereby increasing cytotoxicity.

[0083] Example 6 Targeted Fluorescent Imaging of Multifunctional DNA Nanospheres in Mice

[0084] To confirm whether the multifunctional DNA nanospheres without loaded DOX prepared in Example 1 can enter the tumor region through blood circulation, 0.1 mL of the multifunctional nanosphere solution (3 μM) was injected into glioma mice via the tail vein, and detected using an in vivo imaging system (schematic diagram of the dual imaging and therapeutic functions of the multifunctional DNA nanospheres against glioma). The results showed that obvious fluorescent signals could be observed in the tumor region ( Figure 9 in A). In addition, the brain tissues of the mice were collected for cryosectioning 2 h after injection, and Cy5 fluorescence was detected. Compared with normal brain tissues, significant fluorescence was observed in the tumor region, indicating that the DNA nanospheres could effectively accumulate in the tumor region ( Figure 9 in B). Similarly, the imaging ability of the DNA nanospheres was explored in mice with subcutaneous gliomas. Ex vivo organ imaging was performed 2 h after tail vein injection, and Cy5 fluorescent signals were observed in the subcutaneous glioma tissues ( Figure 9 in C). In summary, the multifunctional DNA nanospheres have good glioma-targeted imaging ability.

[0085] Example 7 Anti-Glioma Effect of Multifunctional DNA Nanospheres Loaded with DOX in Vivo

[0086] To study the in vivo anti-glioma efficacy of the multifunctional DNA nanospheres without loaded DOX and the multifunctional DNA nanospheres loaded with DOX prepared in Example 1, MRI scans were performed on the mice in each experimental group (A32-DNA-DOX group: injecting the multifunctional DNA nanospheres loaded with DOX prepared in Example 1; DNA-DOX group: injecting DNA nanospheres without A32, the preparation method is the same as that in Example 1, the difference is only that the aptamer A32 is not used; Free DOX injecting DOX; DNA nanospheres group: injecting the multifunctional DNA nanospheres without loaded DOX; PBS group: injecting PBS; the injection dose of DOX for each treatment is 4 mg / kg, injecting once every two days for a total of 14 days) at 2, 3, and 4 weeks after U87-E cells were implanted into the mouse intracranium. The results showed that the glioma tumors in A32-DNA-DOX and DNA-DOX grew more slowly compared with those in the multifunctional DNA nanospheres, free DOX, and PBS groups ( Figure 10 A in).

[0087] In addition, the survival time and body weight changes of 7 tumor-bearing mice in each group were recorded. The results showed that the survival time of the A32-DNA-DOX or DNA-DOX group was significantly longer than that of other groups ( Figure 10 B in), indicating that the multifunctional DNA nanospheres loaded with DOX have better efficacy in inhibiting tumor growth. The body weight of the intracranial glioma-bearing mice in the A32-DNA-DOX group and the DNA-DOX group decreased more slowly than that of other groups, which also indicated the effectiveness of the treatment ( Figure 10 C in).

[0088] Example 8 Magnetic resonance enhancement ability of multifunctional DNA nanospheres in vivo

[0089] Using the method prepared in Example 1, multifunctional DNA nanospheres modified with Gd-DOTA-N 3 with a concentration of 30 μM were prepared. After injecting 0.1 mL of the multifunctional DNA nanospheres into the tail vein at different times (0.5, 1, 2, 4, 6, and 12 h), T1 scans were performed on the glioma mice. The results showed that uneven enhanced imaging appeared in the glioma region, indicating that the multifunctional DNA nanospheres have certain enhanced imaging ability ( Figure 11 ).

[0090] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing DNA nanospheres for dual imaging of glioma, characterized in that: The following steps are involved: Gd-DOTA-N3 and Y1-1 are covalently linked by a click chemistry reaction to obtain Gd-DOTA-N3-modified Y1-1; the nucleotide sequence of Y1-1 is shown in SEQ ID NO.7; Y-DNA, L-DNA and A32 are mixed to obtain a mixed system; the Y-DNA is composed of Y1-1 modified by Gd-DOTA-N3 as described in SEQ ID NO.7, Y2 as described in SEQ ID NO.2 and Y3 as described in SEQ ID NO.3; the L-DNA is composed of Linker 1 as described in SEQ ID NO.4 and Linker 2 as described in SEQ ID NO.5; the nucleotide sequence of A32 is described in SEQ ID NO.6; the nucleotide sequence of Linker 1 is TTTCCCCTAACCCCTAACCCCTAACCCC, wherein the 15th base T is dT-Cy5, i.e., base " T " is modified with Cy5; the nucleotide sequence of Linker 2 is TTTCCCCTAATTAGGGGTTA-BHQ-3; The mixed system is heated and then cooled to obtain a solution containing the DNA nanospheres.

2. The preparation method according to claim 1, characterized in that: The molar ratio of Y1-1, Y2 and Y3 after Gd-DOTA-N3 modification in the Y-DNA is 1:1:1; The molar ratio of Linker 1 to Linker 2 in the L-DNA is 1:1; In the mixed system, the molar ratio of Y-DNA to L-DNA is 3:5, the molar ratio of A32 to L-DNA is 1:5, and the final concentration of Gd-DOTA-N3 is 9 μM.

3. The preparation method according to claim 1, characterized in that: The temperature of the heating treatment is 95° C. and the time is 5 minutes.

4. Use of DNA nanospheres prepared by the preparation method according to any one of claims 1 to 3 in the preparation of products for diagnosing gliomas.

5. A method for preparing multifunctional DNA nanospheres for dual imaging and treatment of glioma, characterized in that: The following steps are involved: Gd-DOTA-N3 and Y1-1 are covalently linked by a click chemistry reaction to obtain Gd-DOTA-N3-modified Y1-1; the nucleotide sequence of Y1-1 is shown in SEQ ID NO.7; Y-DNA, L-DNA and A32 are mixed to obtain a mixed system; the Y-DNA is composed of Y1-1 modified with Gd-DOTA-N3 as described in SEQ ID NO.7, Y2 as described in SEQ ID NO.2 and Y3 as described in SEQ ID NO.3; the L-DNA is composed of Linker 1 as described in SEQ ID NO.4 and Linker 2 as described in SEQ ID NO.5; the nucleotide sequence of A32 is described in SEQ ID NO.6; the nucleotide sequence of Linker 1 is TTTCCCCTAACCCCTAACCCCTAACCCC, wherein the 15th base T is dT-Cy5, i.e., the base "T" is modified with Cy5; the nucleotide sequence of Linker 2 is TTTCCCCTAATTAGGGGTTA-BHQ-3; The mixed system is heated and then cooled to obtain a solution of multifunctional DNA nanospheres not loaded with DOX; The multifunctional DNA nanosphere solution not loaded with DOX and DOX are mixed and incubated to obtain the multifunctional DNA nanosphere.

6. The preparation method according to claim 5, characterized in that: The molar ratio of Y1-1, Y2 and Y3 after Gd-DOTA-N3 modification in the Y-DNA is 1:1:1; The molar ratio of Linker 1 to Linker 2 in the L-DNA is 1:1; In the mixed system, the molar ratio of Y-DNA to L-DNA is 3:5, the molar ratio of A32 to L-DNA is 1:5, and the final concentration of Gd-DOTA-N3 is 9 μM.

7. The preparation method according to claim 5, characterized in that: The temperature of the heating treatment is 95° C. and the time is 5 minutes.

8. The preparation method according to claim 5, characterized in that: The concentration of the DNA nanospheres in the multifunctional DNA nanosphere solution not loaded with DOX is 3 μM; the concentration of the DOX is 50 μM.

9. A multifunctional DNA nanosphere prepared by the preparation method according to any one of claims 5 to 8.

10. Use of the multifunctional DNA nanosphere according to claim 9 in preparing products for diagnosing and / or treating glioma.

Images