Application of products that downregulate OPN expression or / and block OPN downstream receptors in the preparation of products for treating or delaying sarcopenia

Abstract

The present invention belongs to the field of biomedicine technology, and discloses the use of products that downregulate OPN expression or / and block OPN downstream receptors in the preparation of products for treating or delaying sarcopenia. The present invention first discovered that knocking out / silencing OPN protein through gene editing can significantly improve skeletal muscle atrophy, reduced muscle strength, and motor dysfunction, and has a therapeutic effect on a variety of sarcopenia animal models; it can also significantly reduce the level of skeletal muscle fibrosis and fat infiltration at the same time, indicating that the application method of the present invention has important therapeutic significance in sarcopenia. It was also found that blocking the OPN downstream receptor CD44 with a neutralizing antibody can also improve the sarcopenia phenotype of mice, indicating that OPN can exert its effect by acting on downstream receptors.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of products that downregulate OPN protein expression or / and block OPN downstream receptors in the preparation of products for treating or delaying sarcopenia. Background Art

[0002] Sarcopenia is a degenerative disease characterized by decreased muscle mass and strength. Aging is the main factor causing sarcopenia. It has been proven to be closely related to adverse prognoses such as falls, fractures, and reduced quality of life. Among them, the risk of all-cause mortality in patients with sarcopenia is more than twice that of the general population. This disease has brought heavy medical and economic burdens to society, and safe and effective therapeutic drugs are urgently needed.

[0003] At present, the pathogenesis of sarcopenia is not very clear, and the existing treatments are mainly nutritional supplements and resistance exercise. However, the efficacy of nutritional supplements is still controversial. There have been few studies on nutritional supplements in people with sarcopenia in the past, and the results suggest that the efficacy is poor; excessive protein intake can also cause intermuscular fat deposition, which in turn promotes the occurrence and development of sarcopenia. Resistance exercise can increase muscle mass, improve muscle strength, and improve function. It is currently the main method for treating sarcopenia. However, due to the high intensity of resistance exercise, it is not suitable for weak sarcopenic patients. It will also significantly increase the risk of falls in elderly patients, increase their cardiopulmonary pressure and joint load. Therefore, resistance exercise has limited applicability in sarcopenic patients. Up to now, there are no clinical drugs for the treatment of sarcopenia approved by relevant departments at home and abroad. Therefore, it is urgent to clarify the pathogenesis of sarcopenia and explore potential intervention targets to provide ideas for the development of safe and effective new methods for the treatment of sarcopenia.

[0004] Osteopontin (OPN) is an extracellular matrix protein that can be synthesized and secreted by a variety of cells. It can mediate the migration and adhesion of immune cells, fibroblasts, etc. in tissues, and has complex biological effects of regulating immune inflammation levels and promoting cell proliferation and differentiation. Previous studies have found that skeletal muscle fibers generally do not express OPN protein. In young and normal skeletal muscle tissue, the protein content of OPN is very low, and it is usually secreted by other cell types in the skeletal muscle microenvironment. For example, after skeletal muscle injury, macrophages infiltrate and secrete OPN in large numbers at the site of injury, thereby promoting the adhesion, proliferation and differentiation of immune cells and mesenchymal stem cells at the site of injury, and ultimately promoting muscle injury repair. In addition, OPN has been found to mediate the proliferation and differentiation of fibroblasts in the liver and kidneys, and aggravate liver and kidney fibrosis. Sarcopenia also has skeletal muscle fibrosis, and intermuscular fat infiltration is also one of the important pathological phenotypes of sarcopenia; however, whether risk factors for sarcopenia such as aging will cause changes in the protein content of OPN in skeletal muscle, and whether OPN will cause skeletal muscle atrophy, fibrosis and other degeneration, there has been no relevant research before the present invention. In addition, whether knocking out or inhibiting OPN protein levels can have a beneficial effect on the skeletal muscle function and state of patients with sarcopenia is also unclear before the present invention. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide an application of a related product developed with OPN protein as a target in the preparation of a drug for the treatment of sarcopenia.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0007] A product for downregulating OPN expression is used in the preparation of a product for treating or delaying sarcopenia, wherein sarcopenia refers to muscle atrophy, decreased muscle strength and motor dysfunction caused by any one or more of aging, disuse, metabolism and tumors, and the product for downregulating OPN expression is a product for knocking out / silencing the OPN protein encoding gene.

[0008] In the above application, further, the product for knocking out the OPN protein encoding gene includes a PX330-sgRNA plasmid, which is composed of two sgRNAs and a PX330 vector, and the sequences of the two sgRNAs are as follows:

[0009] Guide 1:ACTAACTACGACCATGAGATTGG;

[0010] OPN-sgRNA1-TOP:CACCGACTAACTACGACCATGAGAT;

[0011] OPN-sgRNA1-BOTTOM:AAACATCTCATGGTCGTAGTTAGTC;

[0012] Guide 2:GCAGAATCTCCTTGCGCCACAGG;

[0013] OPN-sgRNA2-TOP:CACCGCAGAATCTCCTTGCGCCAC;

[0014] OPN-sgRNA2-BOTTOM:AAACGTGGCGCAAGGAGATTCTGC.

[0015] Based on a general inventive concept, the present invention also provides an application of a product for blocking OPN downstream receptors in the preparation of a product for treating or delaying sarcopenia, wherein sarcopenia refers to muscle atrophy, decreased muscle strength and motor dysfunction caused by any one or more of aging, disuse, metabolism and tumors, and the product for blocking OPN downstream receptors is a product for blocking OPN protein and its downstream receptor CD44.

[0016] In the above application, further, the product for blocking OPN protein and its downstream receptor CD44 is a CD44 neutralizing antibody purchased from Thermo Fisher Scientific, order number: MA1-10225.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The present invention discovers for the first time that knocking out / silencing OPN protein through gene editing can significantly improve skeletal muscle atrophy, decreased muscle strength and motor dysfunction, and has a therapeutic effect on various sarcopenia animal models; it can also significantly reduce the level of skeletal muscle fibrosis and fat infiltration at the same time, indicating that the application method of the present invention has important therapeutic significance in sarcopenia.

[0019] 2. The present invention also found that blocking OPN downstream receptors (such as CD44) with neutralizing antibodies can also improve the sarcopenia phenotype (decreased muscle mass and strength) of mice, indicating that OPN can exert its effect by acting on downstream receptors. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1Comparison of OPN protein levels in skeletal muscle of aged and young mice, with GAPDH as the endogenous protein level reference.

[0022] Figure 2 These are the various indices of skeletal muscle of young mice after intramuscular injection of OPN recombinant protein. The small figures are grip strength / body weight (A), net hanging time (B), farthest movement distance (C), tibialis anterior wet weight / body weight (D), gastrocnemius wet weight / body weight (E), and quadriceps femoris wet weight / body weight (F).

[0023] Figure 3 It is WT, OPN + / - 、OPN - / - Young mouse genotype identification diagram, where lane AF is the amplification band of OPN full-length primer, lane af is the amplification band of OPN middle primer, samples 1 and 3 are OPN - / - Samples, samples 2 and 4 are OPN + / - samples, samples 5 and 6 are WT samples.

[0024] Figure 4 The figures are the skeletal muscle indicators of aged mice after OPN gene knockout, where the subfigures are grip strength / body weight (A), net hanging time (B), farthest movement distance (C), tibialis anterior muscle wet weight / body weight (D), gastrocnemius muscle wet weight / body weight (E), quadriceps femoris muscle wet weight / body weight (F), skeletal muscle appearance (G). The aged littermate control is the aged littermate wild-type mouse control group, and the aged OPN knockout is the aged mouse OPN gene full-length knockout homozygous (OPN - / - ) experimental group.

[0025] Figure 5 Figure 2 is the change of skeletal muscle fibrosis and fat infiltration level after OPN gene knockout in aged mice. The subfigures are Masson staining (A), Oil Red O staining (B), semi-quantitative statistical graph of Masson staining positive area (C), semi-quantitative statistical graph of Oil Red O staining positive area (D), and comparison of protein levels in mouse skeletal muscle (E). The aged littermate control is the aged littermate wild-type mouse control group, and the aged OPN knockout is the aged mouse OPN gene full-length knockout homozygous (OPN - / - ) experimental group.

[0026] Figure 6 These are the skeletal muscle indicators of glycerol intramuscular injection-modeled sarcopenia mice intervened by CD44 neutralizing antibody, where the small figures are grip strength / body weight (A), net hanging time (B), farthest movement distance (C), tibialis anterior muscle wet weight / body weight (D), gastrocnemius muscle wet weight / body weight (E), quadriceps femoris muscle wet weight / body weight (F); blank control: young mice + 50% glycerol + PBS, CD44 neutralizing antibody: young mice + 50% glycerol + CD44 antibody. DETAILED DESCRIPTION

[0027] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0028] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0029] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0030] In the present invention, the young mice used are 3-month-old male C57 / BL6 mice; the aged mice used are 24-month-old male C57 / BL6 mice.

[0031] Example:

[0032] A product that downregulates OPN protein and / or blocks its downstream receptor CD44 is used in the preparation of a product for treating or delaying sarcopenia. Products that downregulate OPN protein expression or / and block OPN downstream receptors include products that knock out / silence OPN protein encoding genes or products that block OPN protein and its downstream receptors. In order to demonstrate the technical effect, the present invention provides the following embodiments.

[0033] 1. Recombinant OPN protein in the muscles of young healthy mice.

[0034] Mouse recombinant OPN protein was purchased from Biotechne R&D (order number: 441-OP-050); 4 μg of recombinant OPN protein was dissolved in 25 μL PBS and injected intramuscularly into the quadriceps femoris, gastrocnemius and tibialis anterior muscles of the mouse lower limbs using an insulin needle. Each skeletal muscle was injected with 8 μL each time, once a week for a total of 4 weeks. The control group mice were injected with 8 μL PBS each time into each lower limb skeletal muscle.

[0035] 2. Construction of OPN gene knockout mice.

[0036] 2.1 Preparation of OPN knockout mice using CRISPR / Cas9.

[0037] 1) OPN gene search: The mouse OPN gene (gene name is spp1) was searched through the UCSC gene database; the mouse OPN gene sequence is located at chr5:104435111-104441053, numbered NM_001204203. The cDNA sequence is shown in SEQ ID No.1:

[0038]

[0039] 2) Design of sgRNA sequence: Design two OPN sgRNA sequences for the mouse OPN gene (shown in SEQ ID No. 2 to 7 respectively):

[0040] Guide 1:ACTAACTACGACCATGAGATTGG;

[0041] OPN-sgRNA1-TOP:CACCGACTAACTACGACCATGAGAT;

[0042] OPN-sgRNA1-BOTTOM:AAACATCTCATGGTCGTAGTTAGTC;

[0043] Guide 2:GCAGAATCTCCTTGCGCCACAGG;

[0044] OPN-sgRNA2-TOP:CACCGCAGAATCTCCTTGCGCCAC;

[0045] OPN-sgRNA2-BOTTOM:AAACGTGGCGCAAGGAGATTCTGC.

[0046] 3) Vector construction: After synthesizing the OPN sgRNA sequence, anneal and digest it with the px330 empty vector to construct the Cas9 / OPN sgRNA / PX330 expression vector;

[0047] 4) Transformation: Take the DH5α competent cells out of the -80℃ refrigerator, thaw them on ice, add the Cas9 / OPNsgRNA / PX330 expression vector, place them on ice for 30 minutes, heat them at 42℃ for 90 seconds, quickly transfer them to ice for 5 minutes, add 900μLLB medium, incubate them at 37℃ and 180rpm for 30 minutes, discard part of the supernatant, plate them on a kanamycin-resistant agar plate, and culture them at 37℃ overnight;

[0048] 5) Plasmid extraction: After the culture plate produces enough OPN sgRNA clones, select clones and culture them in LB medium with shaking. After culturing to an appropriate concentration, centrifuge and remove the supernatant. Add P1 (pre-added with RNaseA) and resuspend by pipetting. After thorough resuspending, add P2 lysis solution for 3 minutes. When the liquid becomes transparent, add P3 to neutralize it. Gently invert several times, centrifuge at room temperature and 13000×g for 10 minutes, aspirate the supernatant and pass it through the column. Wash it twice with washing buffer containing 75% ethanol, dissolve it with sterile water, centrifuge it, and transfer it to an EP tube to obtain PX330-sgRNA plasmid; P1, P2, and P3 are QIAfilter Plasmid The reagents in the kit product (Qiagen, catalog number 12243) are as follows: P1 reagent contains glucose and EDTA, and its main function is to suspend bacteria and disperse the bacteria. RNaseA is usually added to P1 to digest RNA; P2 reagent contains NaOH and SDS, which is a strong alkaline solution, and its main function is to lyse bacteria; P3 reagent contains potassium acetate and alcohol, and its main function is to precipitate proteins and neutralize reactions;

[0049] 6) Micromanipulation: Egg retrieval: C57BL / 6 female mice were treated with superovulation, and pregnant mare serum gonadotropin was injected on the first day, and human chorionic gonadotropin was injected on the third day. They were caged with C57BL / 6 male mice, and female mice with plugs were selected for egg retrieval on the fourth day; Microinjection: PX330-sgRNA plasmid was diluted to 50 μL system according to the specified concentration using EmbryoMax injection buffer, and then injected into the mouse single-cell fertilized egg; Transplantation: The surviving single-cell fertilized egg injected with the plasmid was transplanted into the oviduct of the female mouse;

[0050] 7) Identification: The female mice that underwent fertilized egg transplantation were raised, and the pups were numbered and tail-clipped when they were 3 weeks old. The OPN gene knockout status of the mice was analyzed through PCR, TA cloning and sequencing. After obtaining the F0 generation OPN gene knockout chimeric mice, they were caged with wild-type mice of the same strain and identified and screened to obtain the F1 generation OPN gene knockout heterozygous mice.

[0051] 2.2 Required instruments and consumables (see Table 1).

[0052] Table 1: Required instruments and consumables

[0053]

[0054] 2.3 Required reagents (see Table 2).

[0055] Table 2: Required Reagents

[0056]

[0057] 2.4 Preparation of main solutions.

[0058] 1) SNET solution: weigh 0.315 g Tris-HCl, 2.34 g NaCl, 1 g SDS, and 1.44 g EDTA, add ultrapure water and make up to 100 ml, mix well, and store at room temperature for later use.

[0059] 2) Proteinase K solution: Centrifuge proteinase K powder at room temperature and 3000 rpm for 5 minutes, add 1 mL of ultrapure water to prepare 100 mg / mL proteinase K solution, divide into 5 portions, and store at -20°C for later use. Dilute 5 times with ultrapure water when using, and the working solution concentration is 20 mg / mL.

[0060] 3) 1.5% agarose gel: weigh 2.25 g of agarose, add 150 mL of 1×TAE buffer, boil in a microwave oven for 1-3 min, wait until it cools down slightly and the bubbles disappear, add 7.5 μL of GelRed dye, stir evenly with a glass rod, and before the gel solidifies, pour it into the electrophoresis tank, insert the hole comb, and set aside.

[0061] 4) DMEM / F12 complete medium: Take 450 mL of DMEM / F12 simple medium, add 50 mL of FBS and 5 mL of double antibiotic solution to prepare DMEM / F12 complete medium containing 10% FBS and 1% double antibiotic.

[0062] 2.5 Breeding of OPN gene knockout mice.

[0063] OPN knockout mice and wild-type (WT) mice were housed in the Animal Experiment Center of the New Campus of Xiangya School of Medicine, Central South University. The breeding level was SPF level, the environmental temperature was maintained at 24 ± 0.5℃, the relative humidity was maintained at 50%-60%, and the diet and water were free. The day and night light rhythm (12h:12h) was maintained. The litter was changed twice a week, and the feed and drinking water were supplemented daily. The feed was standard rat feed, and the drinking water was sterilized water. The cages and drinking bottles were sterilized after each cleaning and replacement.

[0064] Breeding method: OPN knockout heterozygotes (OPN + / - ) mice and WT mice were mated in a 1:1 sex ratio to produce multiple generations of offspring. After genotyping, OPN + / - and OPN + / - The OPN gene knockout homozygous strains were obtained by mating mice together in cages (OPN - / - ) mice and WT (OPN) mice of the same genetic background + / + ) mice; then, sexually mature male and female mice of different genotypes were bred together to continue to obtain OPN - / - 、OPN + / -The above OPN gene knockout refers to the knockout of the full-length OPN gene, and its sequence is shown in SEQ ID No.1.

[0065] 2.6 Mouse genotype identification.

[0066] 2.6.1 Extract mouse gDNA.

[0067] 1) Cut about 0.5 cm of the tail end tissue of a 4-week-old mouse, place it in a 1.5 ml enzyme-free EP tube, add 500 μl SNET solution and 5 μl proteinase K solution, mix well, and digest overnight in a 55°C water bath;

[0068] 2) Add 500 μl of phenol-chloroform-isopropanol mixed solution (25:24:1), mix well, and centrifuge at 4°C and 13200 rpm for 10 min;

[0069] 3) Pipette the supernatant into a 1.5 ml enzyme-free EP tube, add 500 μl chloroform, mix well, and centrifuge at 4°C and 13200 rpm for 10 min;

[0070] 4) Pipette the supernatant into a 1.5 ml enzyme-free EP tube, add 500 μl isopropanol, mix well, and centrifuge at 4°C and 13200 rpm for 15 min;

[0071] 5) Discard the supernatant, add pre-cooled 75% ethanol, gently invert several times to wash the precipitate, and centrifuge at 4°C and 13200 rpm for 5 minutes;

[0072] 6) Discard the supernatant, air-dry, add 50 μl of sterile distilled water, place in a 4°C refrigerator for 2 h to fully dissolve the precipitate, and store in a 4°C refrigerator for later use;

[0073] 7) Detect the purity and concentration of gDNA using an ELISA reader.

[0074] 2.6.2 PCR amplification.

[0075] 1) Primer sequences were synthesized by Wuhan Qingke Biotechnology Co., Ltd., dissolved in enzyme-free water, diluted, and mixed in equal volumes for later use. Two primers are required for amplification, one for the full-length OPN gene (i.e., the target gene) and the other for the intermediate OPN gene. The primer sequences for the full-length OPN gene are shown in SEQ ID No.8~9, forward primer: 5'-GTGACTTGGTGGTGATCTAGTG-3', reverse primer: 5'-AGATCAGAGGACTACAACAGAC-3', and the amplified fragment size is 230 bp. The primer sequences for the intermediate OPN gene are shown in SEQ ID No.10~11, forward primer: 5'-CCAGTCACTCAAGGTCCTGT-3', reverse primer: 5'-CTGAAGAATGTTCGCAGC-3', and the amplified fragment size is 200 bp. The PCR reaction system is shown in Table 3.

[0076] Table 3: PCR reaction system

[0077]

[0078] 2) PCR amplification program settings (see Table 4).

[0079] Table 4: CR amplification program settings

[0080]

[0081] 2.6.3 PCR product detection.

[0082] 1) Prepare 1.5% agarose gel (solvent is 1×TAE buffer, the ratio of GelRed dye to agarose gel is 1:20000);

[0083] 2) Assemble the horizontal electrophoresis tank, check the tightness of the device, place the agarose gel on the electrophoresis tank, add an appropriate amount of 1×TAE buffer, and make sure that the height distance between the liquid surface and the upper surface of the agarose gel is about 5 mm;

[0084] 3) According to the experimental design, spot samples in order: 6ul DNA Marker, 10μl PCR product. To prevent contamination, OPN and Neo should be separated as much as possible and should not be spotted outside the well;

[0085] 4) Cover the electrophoresis tank, plug in the power supply, and run the electrophoresis at a constant voltage of 120V for 20 minutes;

[0086] 5) After electrophoresis, take out the agarose gel, observe it in a UV imager, and record the image data.

[0087] 3. Experimental results.

[0088] The present invention compares the protein levels of OPN in the skeletal muscle of young mice and aged mice and finds that the OPN content in the skeletal muscle of aged mice is significantly higher than that in young mice ( Figure 1 In order to verify whether OPN protein can cause sarcopenia phenotypes such as skeletal muscle atrophy and decreased muscle strength, the present invention injected OPN recombinant protein into the lower limb skeletal muscles of young mice and found that their grip strength ( Figure 2 Middle A), online time ( Figure 2 Middle B) and the longest movement distance ( Figure 2 C) were significantly decreased, and the tibialis anterior muscle ( Figure 2 Middle D), gastrocnemius ( Figure 2 Middle E) and quadriceps ( Figure 2 (F) The wet weight of the mice decreased significantly, indicating that OPN recombinant protein caused skeletal muscle atrophy, decreased muscle strength and motor dysfunction in mice.

[0089] The present invention uses OPN full-length primers and intermediate primers to perform PCR amplification followed by agarose gel electrophoresis to identify the genotype of offspring mice. Figure 3 As shown: Samples 1 and 3 OPN full-length primers only amplified a 230bp fragment band without a 1400 full-length band, and OPN middle primers also did not amplify a band, which was identified as OPN - / - Samples; Samples 2 and 4 OPN full-length primers amplified both 230bp fragment bands and 1400bp full-length bands, and OPN middle primers also amplified 200bp bands, which were identified as OPN + / - Samples; Samples 5 and 6 OPN full-length primers only amplified a 1400bp band without a 230bp fragment band, and OPN middle primers also amplified a 200bp band, which were identified as OPN WT samples.

[0090] In order to verify the therapeutic effect of blocking or reducing OPN protein on sarcopenia, the present invention constructed an OPN gene knockout aging sarcopenia mouse. It was found that in the OPN gene knockout aging sarcopenia model mice, compared with the wild-type aging sarcopenia mice of the same litter, their grip strength ( Figure 4 Middle A), online time ( Figure 4 Middle B) and the longest movement distance ( Figure 4 C) were significantly improved, and the tibialis anterior muscle ( Figure 4 Middle D), gastrocnemius ( Figure 4 Middle E) and quadriceps ( Figure 4 The wet weight of the middle F) increased significantly, and the skeletal muscle was significantly enlarged ( Figure 4 In addition, OPN knockout also reduced skeletal muscle fibrosis in aged sarcopenia mice ( Figure 5 A, C) and the level of intermuscular fat infiltration ( Figure 5 In B and D, protein detection revealed that OPN knockout did significantly downregulate the expression of fibrotic protein COL1 and adipogenic differentiation-related protein PPARγ in skeletal muscle ( Figure 5 Middle E). This indicates that knocking out / silencing OPN protein through gene editing can significantly improve skeletal muscle atrophy, decreased muscle strength, and motor dysfunction, and has a therapeutic effect on a variety of sarcopenia animal models; it can also significantly reduce the level of skeletal muscle fibrosis and fat infiltration.

[0091] In addition, the present invention uses CD44 neutralizing antibody (purchased from Thermo Fisher Scientific, order number: MA1-10225) to block the downstream receptors and effects of OPN in sarcopenia mice modeled by intramuscular injection of glycerol, and finds that the grasping force of mice ( Figure 6 Middle A), online time ( Figure 6 Middle B) and the longest movement distance ( Figure 6 C) were significantly increased, and the tibialis anterior muscle ( Figure 6 Middle D), gastrocnemius ( Figure 6 Middle E) and quadriceps ( Figure 6 The wet weight of mice in F) was significantly increased, indicating that blocking the downstream receptor CD44 of OPN protein with CD44 neutralizing antibody can improve the sarcopenia phenotype (decreased muscle mass and strength) of mice.

[0092] The above results fully indicate that knocking out / silencing OPN protein can significantly improve skeletal muscle atrophy, decreased muscle strength and motor dysfunction, play a therapeutic role in various sarcopenia animal models, and can also significantly reduce the level of skeletal muscle fibrosis and fat infiltration; in addition, it is also found that OPN can play a role by acting on downstream receptors. This shows that the application method of the present invention has important therapeutic significance in primary and secondary sarcopenia by downregulating OPN protein expression and blocking OPN downstream receptors.

Claims

1. Use of a product for downregulating OPN expression in the preparation of a product for treating or delaying sarcopenia, characterized in that: Sarcopenia refers to muscle atrophy, decreased muscle strength and motor dysfunction caused by any one or more of aging, disuse, metabolism and tumors. The product for downregulating OPN expression is a product for knocking out the OPN protein encoding gene. The product for knocking out the OPN protein encoding gene comprises two sgRNAs, and the sequences thereof are as follows: Guide 1:ACTAACTACGACCATGAGATTGG; Guide 2:GCAGAATCTCCTTGCGCCACAGG.

2. The use according to claim 1, characterized in that: The product for knocking out the OPN protein encoding gene also includes a PX330 vector and the following sequence: OPN-sgRNA1-TOP:CACCGACTAACTACGACCATGAGAT; OPN-sgRNA1-BOTTOM:AAACATCTCATGGTCGTAGTTAGTC; OPN-sgRNA2-TOP:CACCGCAGAATCTCCTTGCGCCAC; OPN-sgRNA2-BOTTOM:AAACGTGGCGCAAGGAGATTCTGC.

3. Use of a product that blocks OPN downstream receptors in the preparation of a product for treating or delaying sarcopenia, characterized in that: The sarcopenia refers to muscle atrophy, decreased muscle strength and motor dysfunction caused by any one or more of aging, disuse, metabolism and tumors. The product that blocks the OPN downstream receptor is a CD44 neutralizing antibody.

Images