Application of carbon nanotubes in miRNAs detection and cell imaging

By inserting carbon nanotubes into liposome-based artificial cells as artificial transport channels, the problem of low fusion efficiency between target cells and liposome-based artificial cells was solved, achieving more efficient signal transduction and ion transport, enhancing cell imaging signals, and expanding applications in disease diagnosis and biomarker detection.

CN118931532BActive Publication Date: 2025-11-07JIANGSU UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410976485.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-20
Publication Date
2025-11-07
Estimated Expiration
2044-07-20

AI Technical Summary

Technical Problem

The fusion efficiency between target cells and liposome-based artificial cells is severely limited, affecting the transformation of artificial cells into target cells and target molecules into artificial cells.

Method used

By using carbon nanotubes as artificial transport channels, they can be inserted into liposome-based artificial cell membranes to promote signal and ion transmission and enhance intercellular signal transduction and ion transport.

Benefits of technology

It significantly improves the fusion efficiency between liposome-based artificial cells and target cells, enhances cell imaging signal intensity, provides a new tool for studying intracellular and extracellular material exchange and signal transduction, and broadens its application scope in disease diagnosis and biomarker detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118931532B_ABST
    Figure CN118931532B_ABST
Patent Text Reader

Abstract

The application of carbon nanotubes in miRNAs detection and cell imaging, the application uses carbon nanotube nanomaterial as an effective artificial transmission channel, promotes the signal and ion transmission of liposome artificial cell to cell membrane. The addition amount of carbon nanotubes will affect the efficiency of membrane fusion, the application studies the addition amount of carbon nanotubes and the ion channel function of carbon nanotubes in the whole system.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application discloses a strategy for enhancing cell imaging signal transmission based on embedding carbon nanotubes in artificial cells, and application of the strategy for enhancing fluorescence probes based on embedding carbon nanotubes in artificial cells in detecting MicroRNAs and imaging in living cells. BACKGROUND

[0002] MicroRNAs (abbreviated as miRNAs) are a class of small molecule non-coding RNAs with a length of about 21-25 nucleotides. They play an important role in post-transcriptional regulation of gene expression. Abnormal miRNAs expression is closely related to various diseases, including cancer, cardiovascular disease and nervous system disease, etc. Therefore, miRNAs are also studied as potential diagnostic markers and therapeutic targets. Let-7a is a very important member in the miRNAs family, Let-7a plays an important regulatory role in many biological processes. It is involved in cell proliferation, differentiation, apoptosis and stem cell development. Let-7a is also considered as a tumor suppressor miRNAs, down-regulated or inactivated in various cancers. It inhibits the growth and metastasis of cancer cells by inhibiting some key tumor promoters.

[0003] It is particularly important to detect miRNAs in living cells, by detecting miRNAs in living cells, the dynamic changes of gene expression can be monitored in real time, and the regulatory mechanisms under different physiological and pathological conditions can be understood. Detecting the level of miRNAs in living cells can be used as a potential biomarker for early diagnosis, prognosis evaluation and efficacy monitoring of diseases.

[0004] However, the detection of these disease biomarkers in live cells is greatly challenged by the extracellular and intracellular environment. The presence of free substances in body fluids and the complexity of biological matrices often lead to interference, inactivation and disturbance of signal molecules (such as probes). Therefore, there is an urgent need for new analytical methods that can detect biomarkers in complex physiological environments while effectively protecting signal probes from matrix-induced biosensing interference. Currently, many strategies have been developed to protect probes in complex matrices. These strategies include the use of functional nanomaterial-based carriers, micellar nanocarrier dendrimers and liposomes. Among these methods, artificial cells based on liposomes have become a powerful carrier for biosensing and drug delivery systems. Liposome artificial cells have controllable structural features, such as mimicking biological membranes, providing a universal platform for intercellular / intracellular encapsulation, protection and transport of signal probes. Therefore, artificial cells based on liposomes have attracted great interest and are considered a relatively independent and stable sensing platform. However, despite its near-perfect protection of signal probes, the fusion efficiency between target cells and liposome artificial cells is strongly limited, affecting the conversion of artificial cells to target cells, target molecules to artificial cells, etc.

[0005] To address this challenge, there is growing interest in promoting efficient cell-cell molecular transfer or membrane fusion, allowing signal probes to quickly enter cells. Many current studies employ some methods to facilitate the translocation of exogenous signal probes across the cell membrane, including ion channels, and cell surface modification. To improve intercellular fusion and material transfer, carbon nanotubes have been inserted into lipid membranes to achieve effective drug delivery. However, it is not yet clear whether artificial cells containing signal probes can effectively deliver signals to real cells for sensing analysis.

[0006] To address the above challenges, in this work, we developed an effective artificial cell sensing platform to enhance signal delivery, using carbon nanotube nanomaterials as an effective artificial transport channel to facilitate the delivery of liposome to cell membrane signals and ions for the detection of biomarkers. Initially, we used the thin film hydration method to synthesize liposome artificial cell probes to protect the signal probes and molecules required for miRNAs detection. To enhance the transport of these probes, ions and molecules, we inserted carbon nanotubes (CNTs) into the artificial cell membrane. Carbon nanotubes have unique properties such as large surface area and nanopore space, which can facilitate faster chemical reactions and stronger molecular interactions. By inserting carbon nanotubes into the liposome membrane, we achieved rapid delivery of intercellular signal molecules and probes. In addition, the insertion of carbon nanotubes can also be used as artificial ion channels to accelerate ion transport between cells. This enables signal probes and ions to cross the liposome membrane interface, fuse with adjacent cells containing target Let-7a, and bind the internal probe to the target, enhancing the fluorescent signal to sensitively detect target miRNAs. The artificial cell system based on carbon nanotube insertion into liposomes serves as a protective barrier for signal probes, and the inserted carbon nanotubes facilitate the delivery, exchange and fusion of intercellular signals. Such a system has great potential in enhancing signal delivery between cell-cell membranes and determining biological targets in real physiological environments. SUMMARY

[0007] The technical problem solved: Given that the fusion efficiency between target cells and liposome artificial cells is strongly limited, affecting the conversion of artificial cells to target cells and target molecules to artificial cells. Therefore, the present application provides an application of carbon nanotubes in miRNAs inspection and cell imaging, using carbon nanotube nanomaterials as an effective artificial transport channel to facilitate the delivery of liposome artificial cells to cell membranes. The amount of carbon nanotubes added will affect the efficiency of membrane fusion, and the present application studies the amount of carbon nanotubes added and the role of carbon nanotubes as ion channels in the entire system.

[0008] Technical solution: Application of carbon nanotubes in the preparation of fluorescent probes based on artificial cells.

[0009] The preparation method of the artificial cell in the application is as follows: first, synthesize liposome artificial cells (ArtifCell) using the thin film hydration method, weigh 2-oleoyl lecithin, dissolve it completely with chloroform, and remove the chloroform by vacuum rotary evaporation. After the organic phase forms a thin film at the bottom of the round-bottom flask, dissolve the nucleic acid chain, dye and salt ion in PBS solution; add the prepared PBS solution to the film-forming round-bottom flask, and elute the phospholipid film using an ultrasonic water bath to prepare liposome artificial cells.

[0010] The method for inserting carbon nanotubes into artificial cells is as follows: carbon nanotubes are subjected to cutting processing and purification, purified and uniformly distributed carbon nanotubes with a concentration of 0.1-0.4 mg / mL and prepared liposome artificial cells are added into a centrifuge tube and mixed uniformly, and cultured in a water bath for 30 min to enable effective interaction of the components; and the final solution is 0.1-0.4 mg / mL ArtifCell@CNTs.

[0011] The volume of the liposome artificial cell and carbon nanotube solution is 2:1.

[0012] The concentration of ArtifCell@CNTs is 0.4 mg / mL.

[0013] A fluorescent probe containing liposome artificial cells inserted into carbon nanotubes.

[0014] The application of the fluorescent probe containing liposome artificial cells inserted into carbon nanotubes in enhancing cell imaging signal transmission.

[0015] The application of the fluorescent probe in preparing a product for detecting the content of Let-7a in living colorectal cancer cell HCT116.

[0016] A method for enhancing cell imaging signal transmission based on embedding carbon nanotubes in artificial cells, the molar concentration ratio of W1, W2, SUB, magnesium ions and THT is 1:1:2:1000:4000, W1 is shown in SEQ ID NO. 1, W2 is shown in SEQ ID NO. 2, and SUB is shown in SEQ ID NO. 3.

[0017] Beneficial effects: 1. Improve fusion efficiency: the present application uses carbon nanotubes as artificial transmission channels, significantly improves the fusion efficiency between liposome artificial cells and target cells, and overcomes the problem of limited fusion efficiency in traditional methods, providing a new solution for the application of artificial cells in the field of biomedicine.

[0018] 2. Optimize signal transmission: the addition of carbon nanotubes effectively promotes the signal and ion transmission of liposome artificial cells to the cell membrane, enhances the signal intensity of cell imaging, and provides a new tool for the exchange of substances inside and outside cells and signal transduction research.

[0019] 3. Innovative preparation method: the present application describes in detail the process of preparing liposome artificial cells based on thin film hydration method, and combines the insertion technology of carbon nanotubes to form a new type of artificial cell fluorescent probe, which is simple in operation, good in repeatability, and easy for laboratory and industrial production.

[0020] 4. Broaden the application range: The prepared liposome artificial cell containing carbon nanotubes fluorescent probe not only performs well in enhancing cell imaging signal transmission, but also successfully applies to detecting Let-7a content in living colorectal cancer cell HCT116, showing its broad application prospect in disease diagnosis, biomarker detection and other fields.

[0021] 5. Provide a strategy innovation: The present application proposes a new strategy based on embedding carbon nanotubes in artificial cells to enhance cell imaging signal transmission, and realizes more efficient and sensitive cell imaging and molecular detection by optimizing the concentration ratio of each component, which makes an important contribution to the development of biomedical research and clinical diagnosis technology. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Characterization of artificial cells and carbon nanotubes inserted into artificial cells. (a) Transmission electron microscopy image of liposome artificial cells without inserting carbon nanotubes, (b-c) Transmission electron microscopy images of carbon nanotube inserted artificial cells, (d) Schematic diagram of carbon nanotube inserted artificial cells

[0023] Figure 2 (a) is an inverted microscope image before vesicle fusion, (b) is an inverted microscope image after vesicle fusion.

[0024] Figure 3 (a) is the observation of the fusion process of artificial cells inserted with carbon nanotubes under total internal reflection fluorescence microscopy, and the negative control of the observation of the fusion process of artificial cells without inserting carbon nanotubes. (b) Schematic diagram of the fusion process of artificial cells inserted with carbon nanotubes and probe 2.

[0025] Figure 4 Fusion of artificial cells with different concentrations of carbon nanotubes. (a) Schematic diagram of artificial cells inserted with carbon nanotubes stained with phospholipid-specific rhodamine B (red) and artificial cells 2 stained with calcein (green). (b) Artificial cells inserted with carbon nanotubes are stained with phospholipid-specific rhodamine b (red), and artificial cells 2 are stained with calcein (green). The fusion is observed under total internal reflection microscopy.

[0026] Figure 5 (a) is a schematic diagram of fluorescence quenching in the signal transmission and fusion process of artificial cells with and without inserting CNTs. (b) Real-time fluorescence monitoring of signal transmission in artificial cells without inserting CNTs and artificial cells inserted with different concentrations of CNTs.

[0027] Figure 6 (a) is a schematic diagram of embedded carbon nanotubes as artificial ion channels to accelerate ion transmission. (b) Ultraviolet-visible absorption spectrum of artificial cells with or without adding magnesium ions, with or without inserting CNTs, and chromium black T.

[0028] Figure 7 Monitoring and detecting miRNAs in living cells by using this carbon nanotube-inserted artificial cell strategy. (a) Fluorescence imaging of HCT 116 cells after incubation with artificial cells without carbon nanotube insertion and artificial cells with carbon nanotube insertion and PBS, 0.1 nM, 1 nM and 10 nM let-7a for 12 hours. (b) Schematic diagram of the fusion process of carbon nanotube-inserted artificial cells with colorectal cancer cells. (c) Standard curve of the average gray value for let-7a levels drawn using the proposed carbon nanotube-inserted artificial cell strategy. The x-axis is the content of let-7a in HCT 116 cells. DETAILED DESCRIPTION

[0029] Example 1: Preparation of carbon nanotube-inserted probes in artificial cell membranes

[0030] (1) First, synthesize liposome artificial cells by using the thin film hydration method. Weigh 10 mg of 2-oleoyl lecithin and completely dissolve it in 3 mL of chloroform. Evaporate the chloroform under reduced pressure using a vacuum rotary evaporator at 45°C. After the organic phase forms a thin film at the bottom of the round-bottom flask, dissolve 20 μL of 5 mM magnesium chloride, 20 μL of 5 μM W1, 20 μL of 5 μM W2, 20 μL of 10 μM SUB chain, and 20 μL of 20 mM THT (thioflavin T) in 2 mL of PBS solution, respectively, and place them in a centrifuge tube. Uniformly shake them on a vortex shaker for 10 minutes to ensure that the nucleic acid chain, dye, and salt ions are mixed uniformly. Add the above prepared PBS solution containing the nucleic acid chain, dye, and salt ions to the phospholipid film in the round-bottom flask, and elute the phospholipid film using an ultrasonic water bath to prepare artificial cell probes. Store the prepared liposome artificial cells in a refrigerator at 4°C overnight.

[0031] The sequence of W1 is: CTCCAGATTGTACCCACCTACTACCTCA

[0032] The sequence of W2 is: AACTATACAACTAGCGACTCGTCC

[0033] The sequence of SUB is:

[0034] CCGCCCAACCTGTACCCACATTGGGACGAG(rA)TCTGGAGAGGTTGGGCGGGATGG GTG

[0035] (2) Preparation of 0.1 mg / mL carbon nanotube inserted artificial cells (ArtifCell@CNTs), cutting and purifying the purchased carbon nanotubes to eliminate impurities, uniformly dispersing the carbon nanotubes in the solution, and reaching an appropriate length. 1 mL of purified and uniformly distributed carbon nanotubes with a concentration of 0.1 mg / mL and 2 mL of prepared liposome artificial cells were added to a 5 mL centrifuge tube, mechanically shaken for 10 min, and incubated in a 37°C water bath for 30 min to allow the components to interact effectively. The final solution was carbon nanotube inserted artificial cells, which were stored in a 4°C refrigerator overnight for subsequent use.

[0036] The ArtifCell@CNTs prepared in this example were characterized by transmission electron microscopy, and the results are shown in Figure 1 . Figure 1 Characterization of artificial cells and carbon nanotube inserted artificial cells. (a) Transmission electron microscopy image of liposome artificial cells without carbon nanotube insertion, (b-c) Transmission electron microscopy images of carbon nanotube inserted artificial cells, (d) Schematic diagram of carbon nanotube inserted artificial cells. It can be seen from Figure 1 that ArtifCell@CNTs were successfully prepared.

[0037] (3) Preparation of 0.2 mg / mL carbon nanotube inserted artificial cells (ArtifCell@CNTs), cutting and purifying the purchased carbon nanotubes to eliminate impurities, uniformly dispersing the carbon nanotubes in the solution, and reaching an appropriate length. 1 mL of purified and uniformly distributed carbon nanotubes with a concentration of 0.2 mg / mL and 2 mL of prepared liposome artificial cells were added to a 5 mL centrifuge tube, mechanically shaken for 10 min, and incubated in a 37°C water bath for 30 min to allow the components to interact effectively. The final solution was carbon nanotube inserted artificial cells, which were stored in a 4°C refrigerator overnight for subsequent use.

[0038] (4) Preparation of 0.4 mg / mL carbon nanotube inserted artificial cells (ArtifCell@CNTs), cutting and purifying the purchased carbon nanotubes to eliminate impurities, uniformly dispersing the carbon nanotubes in the solution, and reaching an appropriate length. 1 mL of purified and uniformly distributed carbon nanotubes with a concentration of 0.4 mg / mL and 2 mL of prepared liposome artificial cells were added to a 5 mL centrifuge tube, mechanically shaken for 10 min, and incubated in a 37°C water bath for 30 min to allow the components to interact effectively. The final solution was carbon nanotube inserted artificial cells, which were stored in a 4°C refrigerator overnight for subsequent use.

[0039] The ArtifCell and ArtifCell@CNTs prepared in this example were characterized by fluorescence inverted microscopy and fluorescence analysis, and the results are shown in Figure 2 ,Figure 3 and Figure 5 as shown. Figure 2 (a) is a pre-vesicle fusion inverted microscope image, (b) is a post-vesicle fusion inverted microscope image. Figure 3 (a) is the observation of artificial cell fusion process inserted with carbon nanotubes under total internal reflection fluorescence microscope, and the negative control of observing artificial cell fusion process without inserting carbon nanotubes. (b) is a schematic diagram of artificial cell fusion process inserted with carbon nanotubes and probe 2. Figure 5 (a) is a schematic diagram of fluorescence quenching of artificial cells inserted with and without CNTs in the process of signal transmission and fusion. (b) is real-time fluorescence monitoring of signal transmission of artificial cells without inserting CNTs and artificial cells inserted with different concentrations of CNTs. It can be seen from Figure 2 that carbon nanotubes can promote and accelerate the fusion of liposomes. It can be seen from Figure 3 that compared with the negative control of artificial cells without inserting carbon nanotubes, artificial cells inserted with carbon nanotubes can combine with liposomes faster and accelerate signal transmission. It can be seen from Figure 5 that after inserting carbon nanotubes, the exchange of substances inside artificial cells is effectively increased, and it can be guessed that carbon nanotubes can be used as a material transport channel.

[0040] Example 2: Carbon nanotube insertion into artificial cells accelerates fusion and signal transmission

[0041] (5) After the above materials are prepared, the signal transmission and fusion ability of liposome artificial cells inserted with different concentrations (0, 0.1, 0.2 and 0.4 mg / mL) of CNTs are evaluated. The artificial cells inserted with carbon nanotubes are dyed with phospholipid-specific rhodamine B (red), and the artificial cells containing targets are dyed with calcein (green). The fusion of the two artificial cells is observed under total internal reflection microscope (TIRFM, Olympus, IX73, Japan).

[0042] The ArtifCell@CNTs prepared in this example are characterized by fluorescence inverted microscope, and the results are shown in Figure 4 , Figure 4 artificial cells and artificial cells 2 dyed with calcein (green). The fusion is observed under total internal reflection microscope. It can be seen from Figure 4 that the liposome fusion rate is the fastest and the fusion effect is better when the carbon nanotubes with a concentration of 0.4 mg / mL are inserted on the surface of the artificial cells, which is conducive to signal transmission.

[0043] Example 3: Carbon nanotube insertion into artificial cells accelerates ion transport

[0044] (6) To analyze the role of embedded CNTs as artificial ion channels to enhance ion transport, the transport of magnesium ions from the outside to the inside of CNT-embedded liposome artificial cells (ArtifCell@CNTs) was measured using chromium black T as an indicator. First, a solution of 0.1 mM chromium black T (pH = 10) was embedded in the artificial cells during the process of liposome artificial cells (ArtifCells). Then, CNTs were embedded on the surface of the artificial cells. Then, 10 mM MgCl2 solution was added to the solution, and the UV spectrum of the solution was measured. Changes in the UV spectrum indicate the concentration of ions entering the artificial cells.

[0045] The ArtifCell@CNTs prepared in this example were analyzed by UV-visible absorption spectroscopy, and the results are shown in Figure 6 , and Figure 6 (a) is a schematic diagram of embedded carbon nanotubes as artificial ion channels to accelerate ion transport. (b) UV-visible absorption spectra of chromium black T in artificial cells with or without CNTs before and after the addition of magnesium ions. As Figure 6 shows, the hypothesis that carbon nanotubes act as ion channels and material transport channels is verified, and the change in absorbance is more obvious in the group with carbon nanotubes inserted.

[0046] Example 4: Monitoring and imaging of miRNAs in living cells

[0047] (7) Fluorescence imaging of carbon nanotube insertion into artificial cells and living cells

[0048] HCT 116 cells were cultured in RPMI-1640 medium in a CO2 incubator at 37°C, 5% CO2. Subsequently, carbon nanotube-inserted artificial cells containing signal probes were prepared in cell culture medium with nucleic acids, metal ions, and fluorescent dyes. The mixture was then incubated in a CO2 incubator for 24 hours. After the incubation period, the culture medium in the cell culture dish was carefully removed with a pipette, and the cells were gently washed with PBS buffer. Finally, the green fluorescence in the HCT 116 cells was observed under an inverted fluorescence microscope (Olympus, IX73, Japan).

[0049] The ArtifCell@CNTs prepared in this example were analyzed by fluorescence inverted microscope characterization, and the results are shown in Figure 7 , and Figure 7The strategy of carbon nanotube-inserted artificial cells was used to monitor and detect miRNAs in living cells. (a) Fluorescence imaging of HCT 116 cells incubated with carbon nanotube-inserted artificial cells and non-inserted artificial cells with PBS, 0.1 nM, 1 nM and 10 nM let-7a for 12 hours. (b) Schematic diagram of the fusion process of carbon nanotube-inserted artificial cells with colorectal cancer cells. (c) Standard curve of the average gray value for let-7a levels using the proposed strategy of carbon nanotube-inserted artificial cells. The x-axis is the content of let-7a in HCT 116 cells. As Figure 7 It is shown that the fluorescence intensity is stronger as the concentration of the target in the cell increases. With the standard addition method, three concentrations of the target are added to the cell, the fluorescence image is taken with a fluorescence inverted microscope, the gray value is obtained, the standard curve is made, and finally the target content in HCT116 is obtained.

Claims

1. Use of liposome artificial cells containing carbon nanotubes inserted in enhancing cell imaging signal transmission, the preparation method of the liposome artificial cells is as follows: first, using thin film hydration method to synthesize liposome artificial cells (ArtifCell), taking 2-oleoyl lecithin, dissolving it completely with chloroform, removing chloroform by vacuum rotary evaporator, dissolving nucleic acid chain, dye and magnesium ion in PBS solution after the organic phase forms a film at the bottom of a round bottom flask; adding the prepared PBS solution into the film forming round bottom flask, eluting the phospholipid film by ultrasonic water bath to prepare liposome artificial cells; the method of inserting carbon nanotubes into artificial cells is as follows: cutting and purifying carbon nanotubes, mixing the purified carbon nanotube solution with a concentration of 0.1-0.4 mg / mL and the prepared liposome artificial cells in a centrifuge tube, and culturing in a water bath for 30 min to make the components interact effectively; the final solution is 0.1-0.4 mg / mL ArtifCell@CNTs.

2. Use of a fluorescent probe containing liposome artificial cells containing carbon nanotubes inserted in preparing a product for detecting the content of Let-7a in living colorectal cancer cell HCT116, the preparation method of the artificial cells is as follows: first, using thin film hydration method to synthesize liposome artificial cells (ArtifCell), taking 2-oleoyl lecithin, dissolving it completely with chloroform, removing chloroform by vacuum rotary evaporator, dissolving nucleic acid chain, dye and magnesium ion in PBS solution after the organic phase forms a film at the bottom of a round bottom flask; adding the prepared PBS solution into the film forming round bottom flask, eluting the phospholipid film by ultrasonic water bath to prepare liposome artificial cells; the method of inserting carbon nanotubes into artificial cells is as follows: cutting and purifying carbon nanotubes, mixing the purified carbon nanotube solution with a concentration of 0.1-0.4 mg / mL and the prepared liposome artificial cells in a centrifuge tube, and culturing in a water bath for 30 min to make the components interact effectively; the final solution is 0.1-0.4 mg / mL ArtifCell@CNTs.

3. Use according to claim 1 or 2, characterized in that, The volume ratio of the liposome artificial cells and the carbon nanotube solution is 2:

1.

4. Use according to claim 1 or 2, characterized in that, The concentration of ArtifCell@CNTs is 0.4 mg / mL.

5. Use according to claim 1 or 2, characterized in that, The nucleic acid chain is W1, W2 and SUB, the dye is THT, the molar concentration ratio of W1, W2, SUB, magnesium ion and THT is 1:1:2:1000:4000, W1 is shown as SEQ ID NO. 1, W2 is shown as SEQ ID NO. 2, and SUB is shown as SEQ ID NO. 3.