Biological method for regulating storage tolerance of rice seeds and application thereof

Abstract

The application discloses a biological method for regulating rice seed storage tolerance and application. The LOC_Os01g12160 gene in the application has a nucleotide sequence as shown in SEQ ID NO. 1, does not affect the germination of fresh seeds, and after seed storage, the seed storage tolerance of the LOC_Os01g12160 gene knockout strain is reduced. Therefore, the application of overexpression of the LOC_Os01g12160 gene in improving the seed storage tolerance of rice is provided.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of rice breeding, and relates to a biological method for regulating seed storage tolerance of rice and application thereof. BACKGROUND

[0002] Long-term storage of crop seeds is of great significance for germplasm conservation, food supply and sustainable production. Seed storage tolerance (also known as seed longevity or anti-aging ability) refers to the ability of seeds to maintain seed viability and seed nutritional value under certain environmental conditions. Rice is an important food crop with huge production and consumption reserves worldwide, but it is prone to lose food value and seed viability during storage. Germination ability is a key indicator for identifying seed storage tolerance.

[0003] At present, rice storage tolerance has not been paid much attention in breeding, and only a few breeders take it as a breeding goal, so the progress of seed storage breeding is slow. Rice storage tolerance is a complex trait regulated by multiple genes, although a large number of QTL loci have been identified, only a few QTL loci have been cloned, which limits the genetic improvement of this trait.

[0004] Therefore, the present application is proposed. SUMMARY

[0005] The purpose of the present application is to provide the function of LOC_Os01g12160 gene in regulating seed storage tolerance, and to provide technical support for improving seed storage tolerance by using LOC_Os01g12160 gene.

[0006] The first purpose of the present application is to provide LOC_Os01g12160 gene, and the nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO. 1.

[0007] The present application also provides the application of the above-mentioned LOC_Os01g12160 gene in regulating seed storage tolerance.

[0008] Preferably, it is the application of knocking out LOC_Os01g12160 gene in reducing seed storage tolerance of rice.

[0009] The second purpose of the present application is to provide a method for reducing seed storage tolerance of rice, which is to knock out LOC_Os01g12160 gene in rice.

[0010] Preferably, the LOC_Os01g12160 gene in rice is knocked out, and the knockout target is: GGCGGCGTCGAGTACCTCCGGGG.

[0011] A third object of the present application provides the use of LOC_Os01g12160 gene in rice breeding.

[0012] Preferably, the use in rice breeding is the use in seed storability improvement.

[0013] Compared with the prior art, the present application has the following beneficial effects:

[0014] (1) The present application provides the function of LOC_Os01g12160 gene in regulating seed storability. We prove that LOC_Os01g12160 gene can regulate seed storability through transgenic.

[0015] (2) There are few genes reported to be related to rice seed storability at present. The LOC_Os01g12160 gene in the present application does not affect the germination of fresh seeds, but the seed storability of the LOC_Os01g12160 gene knockout strain is reduced after seed storage. Therefore, the present application provides the use of overexpression of LOC_Os01g12160 gene in improving rice seed storability. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 : Knockout target and detection results of LOC_Os01g12160 gene. ZH11 is the control material, and jar2-1 and jar2-2 are gene knockout strains.

[0017] Figure 2 : Function of LOC_Os01g12160 gene in regulating seed germination rate. Statistical comparison uses one-way t-test, * indicates significant difference of p<0.05 in t-test, and ** indicates significant difference of p<0.01 in t-test.

[0018] Figure 3 : Function of LOC_Os01g12160 gene in regulating seed storability. Statistical comparison uses one-way t-test, * indicates significant difference of p<0.05 in t-test, and ** indicates significant difference of p<0.01 in t-test. DETAILED DESCRIPTION

[0019] The following examples are further illustrations of the present application and are not intended to limit the present application. The specific experimental conditions and methods are not specified in the following examples, and the technical means used is the conventional means known to those skilled in the art.

[0020] Example 1: Construction of LOC_Os01g12160 gene knockout strain

[0021] The nucleotide sequence of the LOC_Os01g12160 gene is shown as SEQ ID NO. 1. We designed a gene knockout target: GGCGGCGTCGAGTACCTCCGGGG. The transgenic vector was constructed according to the published CRISPR / Cas9 system (Xingliang, Ma. "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants." Molecular Plant 8.8 (2015): 1274-1284.). After the constructed knockout vector was transformed into Agrobacterium BGK03, the callus of ZH11 was infected with the Agrobacterium to obtain the transgenic lines, which were separated by propagation. The primers (5'-GAACGTCTGGAACGCG AGGA-3', 5'-GCGACGAGGAGTACTAGGGT-3') were used to detect the gene editing, and the transgenic lines with homozygous knockout of the LOC_Os01g12160 gene were obtained by comparing the sequence with the control material ZH11, and the two knockout lines were jar2-1 and jar2-2, respectively. jar2-1 deleted 2bp at the target position, and jar2-2 deleted 10bp at the target position. Figure 1

[0022] Example 2: Effect of LOC_Os01g12160 gene on fresh seed germination rate

[0023] Select 50 full and normal rice seeds without disease spots per portion of control ZH11, knockout lines (jar2-1 and jar2-2), soak the seeds for 24h to make the seeds fully swollen, and then sow them in a culture dish with a diameter of 9cm and a layer of filter paper. The control and knockout lines are set up with 6 independent biological replicates, 8mL of sterile water is added to each culture dish to keep the filter paper and seeds moist, and the water is supplemented according to the moisture level during the seed germination period. All culture dishes are placed in a constant temperature incubator (Ningbo Jiangnan Instrument Factory, temperature 28±1℃, humidity 75%±5%) for culture, and the number of germinated seeds is counted every 12h, and the germination standard is set as the embryo bud transmitting out of the shell ≥1mm. Figure 2 The statistical results show that the final germination rate of jar2-1 has no significant difference with ZH11, close to 100%, and the germination rate of jar2-2 is lower than that of ZH11, but can reach more than 90%.

[0024] Example 3: Effect of LOC_Os01g12160 gene on seed storage resistance

[0025] ​According to the same method, the seeds of the control ZH11, knock-out lines (jar2-1 and jar2-2) stored at room temperature for 180 days were used for germination test. The germination rate of the seeds was calculated by the following formula: germination rate (%) = (the number of germinated seeds / the total number of seeds) x 100. Figure 3 It can be seen that the germination rate of jar2-1 and jar2-2 was significantly lower than that of the control ZH11 at each time period, indicating that the LOC_Os01g12160 gene regulated the storage tolerance of rice seeds.

[0026] The sequence of the LOC_Os01g12160 gene is as follows (SEQ ID NO. 1):

[0027] ATGTTGGAGAAGAAGGCGACGAGGAGTACTAGGGTGGATGGGGTGAGCGGCGAGGCGGTGATCGA

[0028] GGAGTTCGAGCGGGTGACGCGCGACGCGGCCAATGTGCAGCGGGAGACGCTGCGGCGGATCCTCG

[0029] CCGAGAACGGCGGCGTCGAGTACCTCCGGGGGCTGGGCCTCGCCGGCGCCACCGACCCGGCCACC

[0030] TTCCGCGCGCGCGTCCCGCTCGCCACCCACGCCGACCTCGAGCCCTACATTGACCGCATCGCCGAC

[0031] GGCGACGCCTCCCCCGTCCTCACCGCCAAGCCCGCCACCTCCATCTCCCTCAGCTCCGGCACGACG

[0032] CAGGGGAAGCGCAAGTACCTGCTATTCAACGAGGAGCTCGTCAAGTCCACGATGCAGATATACCGG

[0033] ATCTCCTACGCGTTCCGGAACAGGGAGTTTCCGGTGGAGAACGGGAAGGCGCTGCAGTTCATCTAC

[0034] AGCAGCAGGGAGACGAGGACGAAGGGGGGGCTTACGGCGACGACGGCGACGACGAACGTGTACC

[0035] GGAGCGAGGAGTTCAAGGCGACGATGAGGGACATCCAGTCGCAGTGCTGCAGCCCCGACGAGGTG

[0036] ATCTTCGGCCCGGACTTCGCGCAGTCGCTCTACTGCCACCTCCTCGCCGGCCTCCTCGCCGCCGGCG

[0037] ACGTGCAGATCGTGTCCGCCACCTTCGCCCACAGCGTCGTCCTCGCGTTCCAGACGTTCGAGCGCG

[0038] CCTGGGAGGACCTCTGCGCCGACATCCGCCGCGGCGAGGTGTCGCCGTCGCGGGTCACCTCGCCG

[0039] GCCGTCCGCCGCGCCATGGCGGCGCTCCTCGCCGCGCCCAACCCGGGCCTCGCCGACGAGGTCGC

[0040] CCGCAAGTGCGCCGCCCTGAGCAACTGGTACGGCGTCATCCCGGCGCTGTGGCCCAACGCCAGGT

[0041] ACGTGTACGGCATCATGACGGGGTCCATGGAGCACTACGTCAAGAAGCTCCGCCACTACGCCGGCG

[0042] GCCTGCCGCTCGTCGCCGCCGAGTACGGCGCCTCCGAGGGGTGGGTCGGCGCCAACGTCGAGCCC

[0043] GGGACGCCGCCGGAGCGCGCCACCTTCACCGTGCTCCCCGACATCGCCTACTTCGAGTTCATCCCC

[0044] CTCAAGCCCGTCGCCGGCGACGGCGGCTACGCCGAGGCGGAGCCCGTCGGCCTCACGGAGGTCGC

[0045] CGCCGGCGAGCTCTACGAGGTCGTCATGACCACCTTCGCAGGGCTTTACCGGTATCGGCTGGGGGA

[0046] CGTGGTGAAGGTGGCAGGGTTCTACAACGCGACGCCCAAGCTCAAGTTCGTGTGCAGGAGGAACC

[0047] TGATGCTGTCGATCAACATCGACAAGAACAGCGAGCAGGACCTGCAGCTGGCGGTGGACGCGGCG

[0048] GCGAGGGCGGTGCTCGCCGGCGAGAAGCTGGAGGTGGTGGACTACACCAGCCACGCCGACGTGTC

[0049] GTCGGACCCGGGCCACTACGTCGTCTTCCTGGAGCTCAACGCCGCCGACCCCGCCGCCGTCGACGG

[0050] CGACGTGATGCAGGCCTGCTGCGACGAGCTGGACAGGGCGTTCGCCGACGCCGGCTACGTCGGGT

[0051] CGAGGAAGTCCGGCGCCATCGCCCCGCTCGAGCTCCGCGTGCTGCAGCGTGGAACCTTCCAGAAG

[0052] GTTCTCCGCCACTACCTCTCCCTCGGCGCCCCCGTCAGCCAGTTCAAGTCCCCCCGCTGCGTCTCCC

[0053] GCTCCAACTCCGGCGTCCTCCAGATCCTCGCCGGCTGCACCGTCAACGTCTTCTTCAGCTCCGCCTA

[0054] CGACTG.

Claims

1. The application of knocking out the LOC_Os01g12160 gene in reducing the seed storage tolerance of rice, characterized in that, The nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.

1.

2. A method for reducing the storage tolerance of rice seeds, characterized in that, The LOC_Os01g12160 gene in rice is knocked out, and the nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.

1.

3. The method according to claim 2, characterized in that, The target site for knocking out the LOC_Os01g12160 gene in rice is: GGCGGCGTCGAGTACCTCCGGGG.

4. The application of the LOC_Os01g12160 gene in rice breeding, characterized in that the application in rice breeding is the application in reducing seed storage tolerance, and the nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.1.

Images