A SNP molecular marker related to growth traits of haimen goat and application thereof

Abstract

The application discloses a SNP molecular marker related to growth traits of Haimen goats and application thereof, and belongs to the field of biotechnology and livestock breeding. The SNP molecular marker comprises an EGFR g.776097C>T mutation site. The application adopts a method of directly sequencing a PCR product as a template of blood genomic DNA of the Haimen goats to determine the genotype. The CC genotype is significantly related to the body length of the Haimen goats at three months old and the body weight, body length, body height, chest depth and chest circumference traits of the Haimen goats at six months old, and can be used as an effective molecular marker for improving the growth traits of the Haimen goats. The detection method is simple, rapid, accurate and low in price, can improve the breeding efficiency of the Haimen goats, and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and livestock breeding, and relates to a SNP molecular marker related to the growth traits of Haimen goats and its application. Background Technology

[0002] High-quality breeds are the foundation of modern livestock production. Strengthening the protection and utilization of breed resources and increasing the degree of improved breeds play a vital role in promoting the high-quality development of animal husbandry. Haimen goats are unique to Haimen, Jiangsu Province, and are excellent local breed resources, as well as a national-level protected livestock breed. Protecting the Haimen goat breed is of great significance for strengthening awareness of livestock breed protection, increasing local farmers' income, and promoting the high-quality development of my country's animal husbandry. Currently, the production performance of Haimen goats is not high, and their population size is small. Therefore, by strengthening the breeding of the Haimen goat breed to improve its quality and expand its population, it is possible to transform high-quality germplasm resources into advantageous economic benefits, thus promoting the high-quality development of modern animal husbandry in my country.

[0003] In livestock production, improving the growth performance of superior breeds of livestock and poultry can directly enhance the economic benefits of livestock production. Among these, the weight and body size of goats are important indicators of growth performance. Therefore, improving the growth performance of goats is a key focus of breeding research on Haimen goats. With the development of genetics and molecular biology, marker-assisted selection (MAS) technology has provided new ideas for animal breeding. MAS eliminates the interference of environmental factors on phenotypic traits, directly selecting for target genotypes, effectively improving breeding efficiency, reducing the blind spots in the breeding process, and providing strong technical support for the breeding of fast-growth traits in Haimen goats.

[0004] SNPs are a class of point mutations in DNA sequences that are widely distributed in the genome, caused by a single base change. They are characterized by wide distribution, high polymorphism, and genetic stability. The allele frequencies of SNP genetic markers vary in different populations. This characteristic can be used for population genetic diversity analysis, candidate gene analysis and mining for variety-specific traits, and variety identification (Shen Zejia, 2024; Lin Yuexia, 2022).

[0005] Epidermal growth factor receptor (EGFR), also known as ErbB1 / HER1, is the prototype of the EGFR family. Due to its role in promoting cell proliferation and inhibiting apoptosis, it is often considered a proto-oncogene. EGFR is the receptor for epidermal growth factor (EGF) cell proliferation and signal transduction, activating at least four major downstream signaling cascades, including RAS-RAF-MEK-ERK, PI3K-AKT, PLCgamma-PKC, and STATs. It may also activate the NF-kappa-B signaling cascade and is associated with tumor cell proliferation, angiogenesis, tumor invasion, metastasis, and inhibition of apoptosis. Studies have shown that EGFR not only promotes the proliferation of mammary epithelial cells in dairy goats but is also closely related to cashmere production performance and lambing traits in Yanshan cashmere goats. However, currently, no studies have reported molecular markers associated with EGFR and growth traits in Haimen goats. Summary of the Invention

[0006] In order to overcome the shortcomings of existing technologies in the breeding of growth traits in Haimen goats, the purpose of this invention is to provide a SNP molecular marker related to growth traits in Haimen goats and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention claims protection for the use of a substance for detecting the EGFR g.776097C>T polymorphism or genotype at the SNP site in the goat genome in any of the following:

[0009] (a1) Application in identifying or assisting in the identification of growth traits in goats;

[0010] (a2) Application in the preparation of products for the identification or auxiliary identification of growth traits in goats;

[0011] (a3) Application in screening or assisted screening of goats with fast growth traits;

[0012] (a4) Application in the preparation of products for screening or assisting in the screening of goats with fast growth traits;

[0013] (a5) Application in breeding goats with the fast growth trait;

[0014] The SNP site EGFR g.776097C>T is located at the 776097th bp of exon 28 on chromosome 22 of the goat genome, and its polymorphism is C or T.

[0015] The physical location of the SNP site EGFR g.776097C>T was determined based on the whole genome sequence of a goat, whose accession number is ENSCHIG00000020547 (reference genome version: ARS1.1).

[0016] Furthermore, the substance is (b1) or (b2) or (b3) as follows:

[0017] (b1) PCR primers for amplifying goat genomic DNA fragments containing the SNP site EGFR g.776097C>T;

[0018] (b2) PCR reagents containing the PCR primers described in (b1);

[0019] (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

[0020] Furthermore, the PCR primer (P1) comprises an upstream primer F1 and a downstream primer R1;

[0021] Upstream primer F1: 5'-TCATGCACGTTTCTTTGAGC-3' (SEQ ID NO.2);

[0022] Downstream primer R1: 5'-CCTTAAAGATGCCATTCGACT-3' (SEQ ID NO.3).

[0023] Furthermore, the growth traits mentioned are body length at three months of age and / or weight, body length, body height, chest width, chest depth, and chest circumference at six months of age; different genotypes of the SNP locus EGFR g.776097C>T have a significant impact on the body length at three months of age and weight, body length, body height, chest depth, and chest circumference at six months of age in goats. The body length at three months of age and weight, body length, body height, chest depth, and chest circumference at six months of age in goats with the CC genotype are significantly higher than those with the CT genotype and the TT genotype.

[0024] Secondly, the present invention claims protection for the use of the above-mentioned PCR primers in the preparation of products for detecting the aforementioned SNP site EGFRg.776097C>T polymorphism or genotype.

[0025] Thirdly, the present invention claims protection for a product containing the aforementioned substances or the aforementioned PCR primers.

[0026] Fourthly, the present invention claims a method for identifying or assisting in the identification of growth traits in goats, using the above-mentioned PCR primers or the above-mentioned products to detect the polymorphism or genotype of the SNP site EGFR g.776097C>T in the goat genome; the body length, weight, body length, body height, chest depth, and chest circumference of the CC genotype goats at three months and six months of age are significantly higher than those of the CT and TT genotypes.

[0027] Fifthly, the present invention claims a breeding method for a fast-growing goat, which uses the above-mentioned PCR primers or the above-mentioned product to detect the polymorphism or genotype of the SNP site EGFR g.776097C>T in the goat genome; retains individuals with the CC homozygous genotype, eliminates individuals with the CT heterozygous genotype and the TT homozygous genotype, and improves the growth trait of the goats generation by generation.

[0028] Furthermore, the method for detecting the genotype of the SNP site EGFR g.776097C>T in the goat genome is as follows: using the genomic DNA of the goat blood to be tested as a template, PCR amplification is performed using the above-mentioned PCR primers or products, and the genotype of the SNP site EGFR g.776097C>T in the goat genome is determined by direct sequencing of the PCR amplification products.

[0029] In a specific embodiment of the present invention, the genotype is determined by direct sequencing of the PCR product. The genotype of EGFR g.776097C>T is determined based on the sequencing peak diagram: when the peak diagram shows a single C peak, the genotype is CC; when the peak diagram shows a double peak of C and T, the genotype is CT; when the peak diagram shows a single T peak, the genotype is TT.

[0030] In a specific embodiment of the present invention, the PCR amplification reaction system is 20 μL, comprising: 10 μL of 2×Taq PlusMaster Mix II; 0.6 μL each of upstream and downstream primers; 1 μL of template DNA; and 7.8 μL of deionized water. The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; and storage at 4℃ after PCR.

[0031] In a specific embodiment of the present invention, the body weight, body length, body height, chest depth, and chest circumference of six-month-old Haimen goats with the CC genotype were increased by 3.86 kg, 3.19 cm, 2.98 cm, 3.76 cm, 2.05 cm, and 10.24 cm, respectively, compared with those with the CT genotype, and by 6.66 kg, 6.18 cm, 6.29 cm, 4.69 cm, 6.66 cm, and 11.37 cm, respectively, compared with those with the TT genotype.

[0032] Sixthly, the present invention claims protection for a molecular marker containing the aforementioned SNP site EGFR g.776097C>T. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the EGFR g.776097C>T site is represented by [C / T], and the SNP site EGFR g.776097C>T is located at 139 bp of SEQ ID NO.1.

[0033] In a specific embodiment of the present invention, the goat is a Haimen goat.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] This invention is the first to discover effective SNP molecular markers affecting the growth traits of Haimen goats in the EGFR gene. Using the kit provided by this invention, the genotypes of the molecular markers are detected by PCR amplification and direct sequencing of the products. This method is simple, rapid, accurate, and inexpensive. Using the molecular markers of this invention to screen Haimen goats, retaining individuals with the CC homozygous genotype and eliminating those with the CT heterozygous and TT homozygous genotypes, can improve the growth performance of Haimen goats and accelerate their breeding progress, demonstrating high application value. Attached Figure Description

[0036] Figure 1 The results of 2% agarose gel electrophoresis of mixed-pool PCR amplification products of EGFR g.776097C>T site (primers F1 and R1) are shown, where M represents DL2000 Plus DNA Marker and 1 represents EGFR g.776097C>T.

[0037] Figure 2 This is a sequencing image of the PCR amplification product of the EGFR g.776097C>T site (primer P1); the arrows indicate the mutation sites.

[0038] Figure 3 The results of the association analysis between the EGFR g.776097C>T locus and the body length of three-month-old Haimen goats are shown; where the same letter indicates no significant difference (p<0.05), and different letters indicate significant differences (p>0.05).

[0039] Figure 4 The association analysis results between the EGFR g.776097C>T locus and the body weight, body length, body height, chest depth, and chest circumference of Haimen goats at six months of age are shown. Among them, the same letter indicates no significant difference (p<0.05), and different letters indicate significant differences (p>0.05). Detailed Implementation

[0040] The technical solution of the present invention will be further described in detail below with reference to the embodiments and related drawings. However, it is worth noting that the embodiments of the present invention are not limited thereto, and those skilled in the art can implement them in other different forms without departing from the spirit and purpose of the present invention.

[0041] Example 1: Genotyping and Identification of SNP Molecular Markers in the EGFR Gene of Haimen Goat

[0042] 1. Collection of experimental animals and samples

[0043] The Haimen goats used in this experiment were sourced from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd., totaling 585 individuals. All goats were healthy and raised under identical conditions and environments. 10 mL of blood was collected from the jugular vein and placed in anticoagulant tubes containing EDTA, stored at -20°C. Phenotypic information, including weight and body size, was collected at three months (90 ± 15 days) and six months (180 ± 15 days) of age for subsequent association analysis.

[0044] 2. Main Instruments

[0045] Pipettes (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortex mixer (Dalong), digital display constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis apparatus (Beijing Liuyi, DYY-6C), fully automated digital gel imaging system (Tanon, Tanon-4100).

[0046] 3. Main reagents

[0047] TRANSGEN Blood Genomic DNA Extraction Kit (Centrifuge Column), 50×TAE (Solarbio), Agarose (BIOWEST), 2×Taq Plus Master Mix II (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed Nucleic Acid Gel Dye (TSINGKE, TSJ003), DL2000 DNA Marker (TSINGKE, TSJ011-100).

[0048] 4. Methods

[0049] 4.1 Extraction of genomic DNA from goat blood

[0050] Remove the goat blood from the -20°C freezer beforehand and thaw it at 4°C. Once the blood is completely thawed, extract DNA from the whole blood according to the instructions of the TRANSGEN Blood Genomic DNA Extraction Kit.

[0051] DNA concentration and quality were detected using a micro-spectrophotometer, including OD. 260 / 280 It should be between 1.80 and 2.00, OD 260 / 230 The value should be between 1.80 and 2.20. DNA samples that pass the test should be stored at -20°C.

[0052] 4.2 Screening of candidate SNP sites and primer design

[0053] SNPs of the missense variant were selected based on previous resequencing data. The genes containing the annotated sites were subjected to KEGG PATHWAY enrichment analysis using KOBAS 3.0. A sliding window method was used, employing the Fst genetic differentiation index for selection signal detection. A 50kb window size and a 25kb step size were used, with parameters set to `fst-window-size50000` and `fst-window-step 25000`. The top 5% of the windows were selected as the selection region. The CDS sequences of the genes within the selection region were translated into protein sequences. Based on the protein sequences, GO analysis was performed using g:Profiler, and KEGG PATHWAY enrichment analysis was performed using KOBAS 3.0. In summary, the candidate SNP site EGFR g.776097C>T was obtained through SNP functional analysis and selection signal analysis based on mutation annotation.

[0054] The EGFR g.776097C>T site sequence information was found using the Ensembl database (https: / / asia.ensembl.org / index.html), and genotyping primers were designed using Oligo 7 software. SNP site information and primer information are shown in Tables 1 and 2.

[0055] Table 1. EGFR gene SNP site information

[0056]

[0057] Table 2 Primer sequences for EGFR SNP genotyping

[0058]

[0059] 4.3 Validation of candidate SNP sites primers

[0060] 4.3.1 Mixing Pool Preparation

[0061] 120 DNA samples were randomly selected from 585 DNA samples from Haimen goats. Based on the weight data of 6-month-old Haimen goats, blood DNA from individuals with the highest and lowest weights was selected, resulting in 30 DNA samples in total. 1 μL of each sample was added to the same 1.5 mL centrifuge tube to prepare four DNA pools for subsequent primer verification and preliminary genotyping verification.

[0062] 4.3.2 Mixed-pool PCR amplification

[0063] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0064] (2) PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0065] 4.3.3 Agarose gel electrophoresis of mixed-cell PCR products

[0066] (1) Preparation of 2% agarose gel: Measure 1g of agarose and 50mL of 1×TAE and pour them into an Erlenmeyer flask. Heat in a microwave oven on high for 3-5 minutes until the solution is clear and transparent. After standing until the solution is no longer hot to the touch, add 5μL of nucleic acid dye, mix thoroughly, pour into a plate, and wait for solidification.

[0067] (2) After the agarose gel solidifies, the sample loading operation is performed. The PCR product loading volume is 10 μL and the DNA Marker loading volume is 10 μL. Gently place the agarose gel into the electrophoresis tank containing 1×TAE (the liquid level of 1×TAE should cover the gel surface), and perform electrophoresis at 140V and 300mA for 35 min.

[0068] (3) After electrophoresis, the gel was transferred to a fully automated digital gel imaging system for observation.

[0069] The mixed-pool DNA was subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the EGFR SNP site shows a clear band at 441 bp, consistent with the expected fragment size, and without any nonspecific bands, indicating that the primer pair has good specificity and can be used for subsequent operations. The nucleotide sequence of the gene fragment amplified using primer P1 is shown in SEQ ID NO.1, where the EGFR g.776097C>T site is represented by [C / T] and is located at 139 bp in SEQ ID NO.1.

[0070] ACCAGTTCTTTAGCAGAGAGTCTTCCCCAGGCTTCCCTGCCTCTGTCATCCA GCGCCTCTTTGAAGAATAGTCACAGGGTTTAGAAAGAGCTGTGAAATCCTGTTGAGG ATGATGCTTTGCTGATTACACTTGAT[C / T]TCTTTTCAATTTCAGAATATGTAAACCAAT CTGTTCCCAAAAGACCTGCAGGCTCTGTCCAGAACCCTGTCTATCACAATCAGCCTCTATATCCAGCTCCTGGCAGAGACCCTCAGTACCAAAATTCACGCAGCAACGCCGTGGACAACCCTGAGTATCTCAACACCA CCCATCCTGCCGTATCAATGGTGTACTCGACGGCCCTGCCCTCTGGGCTCAGAAGGGCAGTCACCAAATTAGCCTAGACAACCCTGACTACCAGCAGGCCTTCTTTCCCAAGGAAGCCAAGTCGAATGGTTTT(SEQ ID NO.1)

[0071] 4.4 Genotyping

[0072] The PCR products and primer P1 were sent to Qingke Biotechnology for first-generation sequencing, and the sequencing results were compared and analyzed using SnapGene software.

[0073] The genotype of EGFR g.776097C>T was determined based on the sequencing peak diagram: when the peak diagram shows a single C peak, the genotype is CC; when the peak diagram shows a double peak of C and T, the genotype is CT; when the peak diagram shows a single T peak, the genotype is TT. Figure 2 ).

[0074] The above results indicate that PCR amplification of Haimen goat genomic DNA using primer P1, followed by genotyping via direct sequencing, enables rapid and accurate identification of the EGFR gene SNP sites in Haimen goats.

[0075] Example 2: Statistical analysis of EGFR gene SNP polymorphism and its relationship with growth traits in Haimen goats.

[0076] 1. Population genetic parameters statistics of the EGFR g.776097C>T locus

[0077] Genotyping was performed on 585 Haimen goats using the primers and methods designed in Example 1, and population genetic parameters at the locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective number of alleles, polymorphism information content, and Hardy-Weinberg equilibrium P-value.

[0078] The results are shown in Table 3. The EGFR g.776097C>T locus exhibited three genotypes in Haimen goats: CC, CT, and TT. CC was the dominant genotype, and C was the dominant allele, indicating moderate polymorphism (0.25%). <PIC

[0079] <0.5), and is in Hardy-Weinberg equilibrium (P>0.05).

[0080] Table 3 Population genetic parameters of the EGFR g.776097C>T locus

[0081]

[0082] 2. Association between EGFR g.776097C>T site and growth traits in Haimen goats.

[0083] Using SAS (8.0) software and the GLM program, least squares statistical analysis was performed to analyze the association between different EGFR g.776097C>T genotypes and growth traits of Haimen goats.

[0084] Using gender as a fixed effect, the model is: Y ijk =μ+G i +S j +e ijk In the formula, Y ijk Individual weight and body size phenotypic values; μ is the population mean; G i Genotype effect; S j For fixed effects; e ijk This is random error.

[0085] 2.1 Association analysis between the EGFR g.776097C>T locus and growth traits in three-month-old Haimen goats

[0086] Fixed effects other than genotype effects that were not significantly associated with individual phenotypic values ​​were removed. Association analysis was performed between EGFR gene SNP loci and body weight and size of Haimen goats. Results are expressed as "least square mean ± standard error".

[0087] The results are shown in Table 4 and Figure 3 As shown, the EGFR g.776097C>T locus is significantly associated with the body length of Haimen goats at three months of age, and the growth traits of individuals with the CC genotype are significantly better than those with the CT and TT genotypes.

[0088] Table 4. Association between EGFR g.776097C>T gene SNP sites and growth traits in three-month-old Haimen goats.

[0089]

[0090] Note: The same lowercase letter in the epaulette indicates no significant difference (p<0.05), while different lowercase letters in the epaulettes indicate a significant difference (p>0.05).

[0091] 2.2 Association analysis between the EGFR g.776097C>T locus and growth traits in six-month-old Haimen goats

[0092] Fixed effects other than genotype effects that were not significantly associated with individual phenotypic values ​​were removed. Association analysis was performed between EGFR gene SNP loci and body weight and size of Haimen goats. Results are expressed as "least square mean ± standard error".

[0093] The results are shown in Table 5 and Figure 4 As shown, the EGFR g.776097C>T locus was significantly associated with the body weight, body length, body height, chest depth, and chest circumference of Haimen goats at six months of age. The growth traits of individuals with the CC genotype were significantly better than those with the CT and TT genotypes.

[0094] Table 5. Association results between EGFR g.776097C>T gene SNP sites and growth traits in Haimen goats at six months of age.

[0095]

[0096] Note: The same lowercase letter in the epaulettes indicates no significant difference (p<0.05), while different lowercase letters in the epaulettes indicate a significant difference (p>0.05).

[0097] Example 3: Method for improving growth traits of Haimen goats

[0098] The main methods for improving the growth traits of Haimen goats include the following steps:

[0099] 1. Collect blood samples from the Haimen goats to be tested and extract genomic DNA from the blood.

[0100] 2. Using primer P1 as described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification products.

[0101] in:

[0102] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0103] (2) PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0104] (3) Sequencing: The PCR product and primer P1 were sent to Qingke Biotechnology Co., Ltd. for first-generation sequencing.

[0105] (4) Genotype determination: The EGFR g.776097C>T site sequencing peak diagrams were compared and analyzed using SnapGene software. When the peak diagram showed a single peak C, the genotype was CC; when the peak diagram showed a double peak of C and T, the genotype was CT; when the peak diagram showed a single peak T, the genotype was TT.

[0106] 3. The CC genotype of EGFR g.776097C>T can serve as an effective molecular marker for improving the growth traits of Haimen goats.

[0107] At three months of age, Haimen goats with the CC genotype had a body length 1.87 cm longer than those with the CT genotype and 2.94 cm longer than those with the TT genotype. At six months of age, the CC genotype individuals had a body weight, body length, body height, chest depth, and chest circumference that were 3.86 kg, 3.19 cm, 2.98 cm, 1.86 cm, and 3.63 cm longer than those with the CT genotype, and 6.66 kg, 6.18 cm, 6.29 cm, 2.84 cm, and 7.29 cm longer than those with the TT genotype, respectively.

[0108] By using the SNP molecular markers of this invention to screen Haimen goats, retaining individuals with the CC genotype for genetic selection, and eliminating individuals with the CT and TT genotypes, the breeding goal of improving the growth performance of Haimen goats can be achieved.

Claims

1. Detection of SNP sites in the goat genome EGFR g.776097 C >T The use of polymorphic or genotypic substances in any of the following: (a1) Application in identifying or assisting in the identification of growth traits in goats; (a2) Application in the preparation of products for the identification or auxiliary identification of growth traits in goats; (a3) Application in screening or assisting screening of goats with fast growth traits; (a4) Application in the preparation of products for screening or assisting in the screening of goats with fast growth traits; (a5) Application of the fast-growth trait in goat breeding; The SNP sites EGFR g.776097 C >T Located at 776097th base on chromosome 22 of the goat genome, its polymorphism is C or T; Goat reference genome version: ARS1.1; The growth traits mentioned are body length at three months of age and weight, body length, body height, chest width, chest depth, and chest circumference at six months of age; The goat in question is a Haimen goat; The breeding program aims to select individuals with rapid growth in body length at three months of age and weight, body length, body height, chest width, chest depth, and chest circumference at six months of age. The body length, weight, body length, body height, chest depth, and chest circumference of CC genotype goats at three months of age and six months of age are significantly higher than those of CT and TT genotypes.

2. The application according to claim 1, characterized in that, The substance is (b1) or (b2) or (b3) as follows: (b1) Used to amplify sites containing the SNPs. EGFR g.776097 C >T PCR primers for goat genomic DNA fragments; (b2) PCR reagents containing the PCR primers described in (b1); (b3) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

3. The application according to claim 2, characterized in that, The PCR primers described herein comprise an upstream primer F1 and a downstream primer R1; Upstream primer F1: 5'-TCATGCACGTTTCTTTGAGC-3'; Downstream primer R1: 5'-CCTTAAAGATGCCATTCGACT-3'.

4. A method for identifying or assisting in the identification of growth traits in goats, characterized in that, Detection of SNP sites in the goat genome of claim 1 using the PCR primers described in claim 2 or 3. EGFR g.776097 C >T The polymorphism or genotype; the body length, weight, body length, body height, chest depth and chest circumference of the CC genotype goats at three months and six months of age are significantly higher than those of the CT and TT genotypes; the goats mentioned are Haimen goats, and the growth traits mentioned are body length at three months and weight at six months of age, body length, body height, chest width, chest depth and chest circumference.

5. A genetic breeding method for goats with a fast growth trait, characterized in that, Detection of SNP sites in the goat genome of claim 1 using the PCR primers described in claim 2 or 3. EGFR g.776097 C >T Polymorphism or genotype; retain individuals with homozygous CC genotype, eliminate individuals with heterozygous CT genotype and homozygous TT genotype, and improve the growth traits of goats generation by generation; the goats mentioned are Haimen goats; the growth traits mentioned are body length at three months of age and weight, body length, body height, chest width, chest depth and chest circumference at six months of age.

6. The method according to claim 4 or 5, characterized in that, The detection of SNP sites in the goat genome EGFR g.776097 C >T The genotyping method is as follows: using the genomic DNA of the goat blood to be tested as a template, PCR amplification is performed using the PCR primers described in claim 2 or 3, and the SNP sites in the goat genome described in claim 1 are determined by direct sequencing of the PCR amplification products. EGFR g.776097 C >T The genotype.

Images