Application of Venetola ABT-199 in the preparation of drugs for preventing and treating rotavirus

Abstract

The present invention relates to the field of biotechnology, in particular to the use of venetola ABT-199 in the preparation of drugs for the prevention and treatment of rotavirus. Compared with the prior art, the present invention determines the CC in cells infected with rotavirus and healthy cells. 50 Value and IC 50 The results showed that venetoclax can be used as an inhibitor of rotavirus. Further immunofluorescence showed that venetoclax had a good inhibitory effect on rotavirus at a concentration of 1-5 μM, and almost completely inhibited the replication of rotavirus at a concentration of 5 μM, providing a new candidate drug for the prevention and treatment of rotavirus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to application of venetoclax ABT-199 in preparing medicines for preventing and treating rotavirus. Background Art

[0002] Rotavirus (RV) belongs to the Reoviridae family. Reoviridae ) Rotavirus ( Rotavirus RV is divided into 6 groups, A to F, among which group A rotavirus (RVA) is one of the main causes of severe gastroenteritis in infants and young mammals. The RVA genome consists of 11 segmented double-stranded RNAs, encoding 6 structural proteins (VP1-4, VP6 and VP7) and 6 non-structural proteins (NSP1-NSP5 / NSP6).

[0003] Venetoclax (ABT-199) is a BCL-2 inhibitor used to treat chronic lymphocytic leukemia (CLL) and acute myeloid leukemia (AML). By selectively inhibiting the BCL-2 protein, ABT-199 promotes apoptosis of cancer cells that rely on this protein for survival. ABT-199 also shows potential for antiviral applications. Certain viruses (such as herpes virus and HIV) prolong the survival of infected cells by upregulating BCL-2 family proteins, thereby promoting viral replication and spread. ABT-199 induces apoptosis of infected cells and reduces viral replication and spread by inhibiting BCL-2. At present, the antiviral effect of ABT-199 is mainly in the basic research stage, and studies have shown its potential role in herpes virus and HIV infection. In general, ABT-199 has potential in antiviral therapy.

[0004] Currently, oral and intravenous rehydration remain the mainstay of rotavirus treatment; however, this does not alleviate the course and severity of diarrhea because it is only symptomatic. Therefore, there is an urgent need to study anti-rotavirus drugs based on ABT-199. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides the use of venetola ABT-199 in the preparation of a drug for preventing and treating rotavirus.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0007] One of the purposes of the present invention is to provide the use of venetolazepine ABT-199 as the only active ingredient in the preparation of a drug for preventing and treating rotavirus.

[0008] The second object of the present invention is to provide a drug for preventing and treating rotavirus, comprising venetola ABT-199.

[0009] Furthermore, the drug for preventing and treating rotavirus also contains a pharmaceutically acceptable carrier and / or excipient.

[0010] Furthermore, the dosage form of the drug is one of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0011] Compared with the prior art, the present invention measures the CC of cells infected with rotavirus. 50 Value and IC 50 The results showed that venetoclax can be used as an inhibitor of rotavirus. Further immunofluorescence showed that venetoclax had a good inhibitory effect on rotavirus at a concentration of 1-5 μM, and almost completely inhibited the replication of rotavirus at a concentration of 5 μM, providing a new candidate drug for the prevention and treatment of rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 ABT-199 inhibits rotavirus infection in CC 50 and IC 50 The value of the measurement diagram: (a) is CC 50 Determination diagram; (b) is IC 50 Determination diagram.

[0013] Figure 2 This is a graph showing the inhibitory effect of venetoclax ABT-199 on rotavirus titer.

[0014] Figure 3 This is a graph showing the inhibitory effect of venetoclax ABT-199 on the rotavirus genome copy number.

[0015] Figure 4 This is a graph showing the inhibitory effect of venetoclax ABT-199 on the expression of rotavirus VP6 protein.

[0016] Figure 5 This is the result of immunofluorescence observation of rotavirus inhibition by venetoclax ABT-199. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0018] The Caco2 cells used in the following examples are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. Caco2 cells are a cell line derived from human colon adenocarcinoma. The cell line can spontaneously differentiate into polar monolayer cells similar to small intestinal epithelial cells and is the best in vitro model for studying anti-rotavirus drugs. Other related reagents used, unless otherwise specified, are commercially available agents, and the methods involved, unless otherwise specified, are all well-known methods.

[0019] The compound used, venetolazepine ABT-199, was purchased from Shanghai Yuanye Biotechnology Co., Ltd., and its chemical molecular structure is shown below:

[0020] .

[0021] Rotavirus strains used: Rotavirus vaccine strain LLR (G10P

[15] ), maintained by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, subcultured on MA104 cells; MA104 cells (African green monkey embryonic kidney cells), maintained by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, passage number 23.

[0022] In order to verify whether Venetola ABT-199 can be used as the only active ingredient to prepare drugs for the prevention and treatment of rotavirus, the following tests were conducted:

[0023] 1. CC of Venetoclax ABT-199 in Caco2 cells 50 and IC 50

[0024] (1) A 10 mM venetoclax solution dissolved in 30 μL dimethyl sulfoxide (DMSO) was diluted serially with basal DMEM medium to obtain a venetoclax dilution solution with a concentration of 12.5 to 200 μM.

[0025] (2) Caco2 cells were cultured at 1×10 5 Cells / well were plated in a 96-well cell plate (the culture medium was DMEM medium containing 20% ​​FBS) to obtain a cell plate containing Caco2 and to detect the half cytotoxic concentration CC of venetoclax. 50 , as follows:

[0026] The experimental wells were set up as follows: venetoclax solutions with final concentrations of 12.5-200 μM were added to the cell plates containing Caco2 cells, and each concentration of venetoclax solution was repeated in 8 replicate wells (one column in a 96-well plate); the blank wells were set up as follows: containing only culture medium; the experimental wells were set up as follows: containing cells, culture medium and venetoclax solution treatment; the control wells were set up as follows: no venetoclax solution treatment.

[0027] After culturing the cells (37°C, 5% CO2) for 24 h, 10 μL of CCK-8 solution was added to each well. After the culture plate was incubated in the incubator for 4 h, the absorbance at 450 nm was measured using a microplate reader, and the cell viability (%) was calculated according to Formula I.

[0028] Formula I: Cell survival rate (%) = [(OD value of experimental well - OD value of blank well) / (OD value of control well - OD value of blank well)] × 100

[0029] When the cell survival rate is 50%, the concentration of the venetolazepine dilution in the corresponding experimental well is the half cytotoxic concentration CC of venetolazepine. 50 .

[0030] (3) Using the cell plate containing Caco2 cells obtained in step (1) as an example, the IC of venetoclax was detected. 50 , as follows:

[0031] After infecting Caco2 cells with rotavirus at an MOI of 0.01, venetoclax was diluted with basal DMEM medium to obtain a venetoclax solution with a concentration of 1.25-20 μM.

[0032] 1.25, 2.5, 5, 10 and 20 μM venetoclax solution was added to the cell plate, and after culturing for 24 h, the viral genome copy number was detected by fluorescence quantitative PCR targeting the rotavirus NSP3 gene. The total volume of the fluorescence quantitative PCR reaction system was 25 μL, including 12.5 μL Premix Ex Taq (2×); 0.5 μL upstream and downstream primers, 0.5 μL probe, 2 μL template, and sterile deionized water was added to 25 μL; the upstream primer sequence was:

[0033] ACCATCTWCACRTRACCCTCTATGAG;

[0034] The downstream primer sequence is:

[0035] GGTCACATAACGCCCCTATAGC;

[0036] The probe sequences are:

[0037] FAM-AGTTAAAAGCTAACACTGTCAAA-MGB, the drug concentration of venetola in Caco2 cells that inhibits half of the rotavirus is calculated, which is the IC 50 .CC 50 Assay results and IC 50 The results of the test are as follows Figure 1 As shown in (b) and (a).

[0038] Depend on Figure 1 It can be seen that the CC of venetoclax in Caco2 cells 50 The value is 56.83 μM, indicating that the half cytotoxic concentration of venetola in Caco2 cells is 56.83 μM, indicating that it has low cytotoxicity to the cells; the IC 50 The value was 1.26 μM, indicating that venetola can exert a good anti-rotavirus effect at a concentration of 1.26 μM. The results suggest that venetola is a potential rotavirus inhibitor.

[0039] 2. Effect of venetoclax treatment on rotavirus infection in Caco2 cells

[0040] Effects on the titer of rotavirus in cells

[0041] Caco2 cells with good growth status were subcultured and inoculated into 96-well cell plates (the culture medium was DMEM medium containing 20% ​​FBS). After culturing (37°C, 5% CO2) for 24 h, rotavirus was inoculated at different dilutions (10 -1 ~10 -6 ) were inoculated and treated with different concentrations of venetoclax (1, 1.25, 2.5 μM). The control group was treated with DMSO and then cultured (37°C, 5% CO2) for 48 h. The cytopathic effect (CPE) was observed, the number of diseased / non-lesional wells was recorded, and the virus titer was calculated according to the Reed-Muench method.

[0042] After Caco2 was treated with different concentrations of venetola after rotavirus infection, the virus titer calculation results were as follows: Figure 2 As shown. The results showed that in Caco2 cells, compared with the control group, with the increase of venetola concentration, the rotavirus titer gradually decreased. The results show that venetola can inhibit the replication of rotavirus.

[0043] Effects on the copy number of rotavirus in cells

[0044] Caco2 cells (2 × 10) were cultured in 12-well plates using DMEM medium containing 20% ​​FBS. 6 / well), the experimental group was inoculated with rotavirus (MOI=0.01), and then treated with different concentrations (1, 1.25, 2.5 μM) of venetoclax, and the infection control group was treated with rotavirus (MOI=0.01) mixed with DMSO. The blank control was treated with cells without rotavirus and culture medium. The cell plate was cultured at 37°C and 5% CO2 for 24 h, and then the total cell RNA was extracted by Omega Virus RNA Extraction Kit (R6874-02) and reverse transcribed into cDNA. Finally, the viral genome copy number was detected by fluorescence quantitative PCR targeting the rotavirus NSP3 gene. The total volume of the fluorescence quantitative PCR reaction system was 25 μL, including 12.5 μL Premix ExTaq (2×); 0.5 μL upstream and downstream primers, 0.5 μL probe, 2 μL template, and sterile deionized water was added to 25 μL; the upstream primer sequence was:

[0045] ACCATCTWCACRTRACCCTCTATGAG;

[0046] The downstream primer sequence is:

[0047] GGTCACATAACGCCCCTATAGC;

[0048] The probe sequences are:

[0049] FAM-AGTTAAAAGCTAACACTGTCAAA-MGB.

[0050] The viral copy number of Caco2 cells was calculated after rotavirus infection and treatment with different concentrations (1, 1.25, and 2.5 μM) of venetoclax. Figure 3 As shown. The results showed that in Caco2 cells, compared with the control group, with the increase of venetola concentration, the rotavirus genome copy number gradually decreased. The results show that venetola can inhibit rotavirus replication in a dose-dependent manner.

[0051] Effects on the expression of rotavirus VP6 protein in cells

[0052] Caco2 cells (2 × 10) were cultured in 12-well plates using DMEM medium containing 20% ​​FBS. 6 / well), the experimental group was inoculated with rotavirus (MOI=0.01) and then treated with different concentrations (1, 1.25, 2.5 μM) of venetoclax, and the infection control group was treated with rotavirus (MOI=0.01) mixed with DMSO. The blank control was treated with cells without rotavirus and culture medium. The cell plate was incubated at 37°C, 5% CO2 for 24 h, the cell culture supernatant was discarded, the membrane was rinsed three times with PBS, 1×SDS-PAGE loading buffer was added for protein denaturation (100°C, 10 min), and then centrifuged for 10 min (12,000 r / min). The protein samples were homogenized and added to the sample tank of the gel. After electrophoresis (120 V, 30 min), the bromophenol blue dye fell to the edge of the gel and then transferred to a 0.2 μm nitrocellulose membrane (NC membrane) (100 V, 1 h). The membrane was blocked with 5% skim milk powder (1 h), the skim milk powder was discarded, and the NC membrane was washed with 1×TBST. The primary antibody was added and placed in a refrigerator at 4°C overnight. The NC membrane was washed with 1×TBST (5 times / 5 min), the corresponding secondary antibody was added (incubated for 1 h), and 1×TBST was used to wash (5 times / 5 min). Finally, the ECL luminescent solution was used for exposure to detect the expression of rotavirus VP6 protein.

[0053] The expression of rotavirus VP6 protein in Caco2 cells treated with different concentrations of venetol after rotavirus infection is shown in Figure 2. Figure 4 As shown, Figure 4 In the experiment, the size of VP6 protein is 43kD, the size of β-actin protein is 42kD, and 40kD represents the protein marker position. The results showed that in Caco2 cells, compared with the control group, the expression of rotavirus VP6 protein gradually decreased with the increase of venetola concentration. The results show that venetola can inhibit rotavirus replication.

[0054] Effects on rotavirus immunofluorescence in cells

[0055] Caco2 cells (2 × 10) were cultured in 12-well plates using DMEM medium containing 20% ​​FBS. 6 / well), the experimental group was inoculated with rotavirus (MOI=0.01) and then treated with different concentrations (1, 1.25, 2.5 μM) of venetoclax; the infection control group was treated with rotavirus (MOI=0.01) mixed with DMSO, recorded as the DMSO group; the blank control was treated with cultured Caco2 cells without rotavirus (2×10 6 / well), recorded as the Mock group. The cell plate was incubated at 37°C and 5% CO2 for 24 h, the cell culture supernatant was discarded, and the cells were rinsed three times with PBS and fixed with 4% formaldehyde for 30 min. Then, the cells were permeabilized by treating with 0.3% Triton for 10 min. Blocking: Block with 5% BSA at room temperature for 1 h. Then, the blocking solution was discarded, and the primary antibody dilution solution (rotavirus VP6 monoclonal antibody, 1:200 dilution) prepared with 5% BSA was directly added, and incubated at 4°C overnight (protected from light). Then, the fluorescent secondary antibody labeled with fluorescein isothiocyanate (FITC) was incubated at 37°C for 1 h. After the incubation, the antibody was discarded, and the cells were washed three times with PBST and observed under an inverted fluorescence microscope.

[0056] After Caco2 was treated with different concentrations of venetoclax after rotavirus infection, the results of virus fluorescence observation were as follows Figure 5 As shown. The results showed that in Caco2 cells, compared with the control group, with the increase of venetola concentration, the rotavirus fluorescence decreased significantly. The results show that venetola can inhibit rotavirus replication.

[0057] In summary, venetola ABT-199 can be used as the sole active ingredient to prepare a drug for preventing and treating rotavirus. Of course, the prepared drug contains venetola ABT-199 and also contains a pharmaceutically acceptable carrier and / or excipient; the dosage form of the drug is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0058] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of venetola ABT-199 as the sole active ingredient in the preparation of a drug for preventing and treating rotavirus, characterized in that: The concentration of venetoclax is 1-5 μM.

Images