Adeno-associated virus virions with variant capsids and uses thereof

Abstract

The present invention provides an adeno-associated virus virion with a variant capsid and its use. Specifically, the present invention provides an adeno-associated virus capsid protein variant, a recombinant AAV virus particle containing the capsid protein, a preparation method thereof, and use thereof in the treatment and prevention of diseases.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and virology, and in particular to an adeno-associated virus virion with a variant capsid and uses thereof. Background Art

[0002] Significant progress has been made in the field of gene therapy using viruses to deliver therapeutic genetic material. Adeno-associated virus (AAV) has attracted considerable attention as an efficient viral vector for gene therapy due to its low immunogenicity and ability to effectively transduce non-dividing cells. AAV can infect a variety of cell and tissue types, and its viral system has made significant progress in the past decade, making this viral system suitable for human gene therapy.

[0003] The prior art (CN 107012171 A) uses an AAV2 variant AAV2.7m8 for ocular gene therapy. AAV2.7m8 is an improved adeno-associated virus (AAV) vector that enhances the infectivity to retinal cells by inserting 10 peptide amino acids between amino acids 587 and 588 in the GH loop of the AAV2 capsid protein. Although AAV2.7m8 has shown enhanced infectivity to retinal cells during directed evolution, there are still areas that need further improvement.

[0004] For example, when treating certain ocular indications, intravitreal injection may be required, which is less damaging to the human eye. However, when AAV is injected into the vitreous cavity, AAV is generally limited by the inner limiting membrane and cannot reach the inner nuclear layer or outer nuclear layer, which limits the efficacy of AAV variants. Although AAV2.7m8 has stronger penetration than wild-type AAV2 when injected into the vitreous cavity, relatively few viruses can enter the inner nuclear layer and outer nuclear layer. Further modification of the variant insertion peptide can increase the level or duration of gene expression to ensure therapeutic effect.

[0005] Therefore, there is still a need to develop new AAV vector subtypes in this field to improve the performance and clinical application potential of AAV vectors as gene therapy vectors. Summary of the invention

[0006] The present invention provides an adeno-associated virus virion with a variant capsid and uses thereof.

[0007] In a first aspect of the present invention, an adeno-associated virus (AAV) capsid protein variant is provided, characterized in that the VP1 of the AAV capsid protein variant has an inserted peptide relative to the parent AAV capsid protein VP1, the inserted peptide is 9 amino acids in length, and its amino acid sequence differs from the sequence shown in SEQ ID NO: 4 by no more than 3, 2 or 1 amino acids.

[0008] In another preferred embodiment, the amino acid sequence of the inserted peptide differs from the sequence shown in SEQ ID NO: 4 by no more than 1 amino acid.

[0009] In another preferred embodiment, the amino acid sequence of the inserted peptide is as shown in QGVPXQPGR (SEQ ID NO: 7), wherein X is an amino acid selected from the following group: N, S, Q, T, G, V, D, H, A, M and K.

[0010] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in any one of SEQ ID NOs: 2, 4, 20-52.

[0011] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in any one of SEQ ID NO: 2, 4, 31, 43 or 52.

[0012] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in SEQ ID NO: 2 or 4.

[0013] In another preferred embodiment, the inserted peptide is inserted between any two adjacent amino acid residues at positions 585-602 of the amino acid sequence of the parent AAV capsid protein VP1.

[0014] In another preferred embodiment, the functional peptide is inserted between positions 585 and 586, between positions 586 and 587, between positions 587 and 588, between positions 588 and 589, between positions 590 and 600, between positions 600 and 601, or between positions 601 and 602 of the corresponding parent AAV capsid protein VP1 amino acid sequence.

[0015] In another preferred embodiment, the parent AAV capsid protein is AAV1 capsid protein, AAV2 capsid protein, AAV3 capsid protein, AAV4 capsid protein, AAV5 capsid protein, AAV6 capsid protein, AAV7 capsid protein, AAV8 capsid protein, AAV9 capsid protein, AAV10 capsid protein, AAV11 capsid protein, AAV12 capsid protein, or AAV13 capsid protein.

[0016] In another preferred embodiment, the parent AAV capsid protein is AAV2 capsid protein.

[0017] In another preferred embodiment, the AAV2 capsid protein VP1 amino acid sequence is shown in SEQ ID NO: 6.

[0018] In another preferred embodiment, the VP1 of the AAV capsid protein variant comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3.

[0019] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant is selected from the following group:

[0020] (i) a sequence as shown in SEQ ID NO: 1 or 3;

[0021] (ii) a sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 1 or 3.

[0022] In another preferred embodiment, the VP1 amino acid sequence of the AAV capsid protein variant is as shown in SEQ ID NO: 1 or 3.

[0023] In the second aspect of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide encodes the AAV capsid protein variant described in the first aspect of the present invention.

[0024] In another preferred embodiment, the polynucleotide sequence is as shown in SEQ ID NO: 8 or 9.

[0025] In the third aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide as described in the second aspect of the present invention.

[0026] In another preferred embodiment, the vector is a plasmid.

[0027] In the fourth aspect of the present invention, a host cell is provided, wherein the host cell contains the vector as described in the third aspect of the present invention, or the polynucleotide as described in the second aspect of the present invention is integrated into the genome.

[0028] In another preferred embodiment, the host cell further contains a helper plasmid containing the target nucleic acid.

[0029] In another preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.

[0030] In another preferred embodiment, the host cell is a plant cell, an insect cell, or an animal cell, preferably a mammalian cell.

[0031] In another preferred embodiment, the host cell is HEK-293T cell.

[0032] In a fifth aspect of the present invention, a recombinant adeno-associated virus (rAAV) particle is provided, wherein the rAAV particle comprises:

[0033] (i) The AAV capsid protein variant as described in the first aspect of the present invention.

[0034] (ii) a nucleic acid of interest packaged within the AAV capsid.

[0035] In another preferred embodiment, the target nucleic acid is an ophthalmic disease-related gene, or a nucleic acid encoding a protein for treating ophthalmic diseases.

[0036] In another preferred embodiment, the ratio of the transduction efficiency E1 of the rAAV particles to the target cells to the transduction efficiency E0 of the AAV particles containing the parent AAV capsid protein is E1 / E0≥2, preferably E1 / E0≥5, and more preferably E1 / E0≥10.

[0037] In the sixth aspect of the present invention, a method for preparing the rAAV particles as described in the fifth aspect of the present invention is provided, comprising the steps of: culturing the host cells as described in the fourth aspect of the present invention under suitable conditions to obtain the rAAV particles.

[0038] In another preferred example, the method further comprises the step of isolating and / or purifying the rAAV particles from the culture.

[0039] In a seventh aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0040] (a) the rAAV particle according to the fifth aspect of the present invention; and

[0041] (b) a pharmaceutically acceptable carrier.

[0042] In an eighth aspect of the present invention, a drug combination is provided, comprising:

[0043] (a) a first active ingredient: the rAAV particle according to the fifth aspect of the present invention, or the pharmaceutical composition according to the seventh aspect of the present invention; and

[0044] (b) a second active ingredient.

[0045] In another preferred embodiment, the second active ingredient is an immunomodulator, such as an immunosuppressant.

[0046] In another preferred embodiment, the second active ingredient is an ophthalmic therapeutic agent.

[0047] In the ninth aspect of the present invention, there is provided the use of the rAAV particles as described in the fifth aspect of the present invention, or the pharmaceutical composition as described in the seventh aspect of the present invention, or the drug combination as described in the eighth aspect of the present invention, or a combination thereof in the preparation of a drug for treating a disease.

[0048] In another preferred embodiment, the disease is an eye disease.

[0049] In another preferred embodiment, the eye disease is selected from the following group: dry age-related macular degeneration (dAMD), geographic atrophy, crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, inherited retinal degeneration (IRD).

[0050] In another preferred embodiment, the drug further comprises an active ingredient for treating a disease selected from the following group: hemophilia, Canavan disease, Alzheimer's disease, lysosomal storage disease, adrenomedullary neuropathy, Parkinson's disease, amyotrophic lateral sclerosis (ALS), hereditary cardiomyopathy, familial hypercholesterolemia, Wilson's disease, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), epidermolysis bullosa (EB), hereditary deafness, and type 1 diabetes.

[0051] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0053] Figure 1 An experimental procedure for screening AAV variants for enhanced retinal cell transduction is shown.

[0054] Figure 2 The distribution of the top 500 variant sequences enriched in the third round of the AAV variant screening experiment is shown.

[0055] Figure 3 The transduction activity of RC-V25, AAV2, and AAV2.7m8 viral vectors in human retinal organoids is shown.

[0056] Figure 4The transduction activity of RC-V36, AAV2, and AAV2.7m8 viral vectors in human retinal organoids is shown.

[0057] Figure 5 The transduction activity of RC-V25, RC-V36, AAV2, and AAV2.7m8 viral vectors on the RGC5 cell line is shown.

[0058] Figure 6 The results of in vivo autofluorescence (AF) examination after intravitreal injection of RC-V25-mScarlet, RC-V36-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet in mice are shown.

[0059] Figure 7 The results of retinal section examination after intravitreal injection of RC-V25-mScarlet, RC-V36-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet in mice are shown.

[0060] Figure 8 The results of in vivo autofluorescence (AF) examination after subretinal injection of RC-V25-mScarlet, RC-V36-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet in mice are shown.

[0061] Fig. 9 The results of retinal flat mount examination after subretinal injection of RC-V25-mScarlet, RC-V36-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet in mice are shown. DETAILED DESCRIPTION

[0062] After extensive and in-depth research, the inventors have developed for the first time an adeno-associated virus virion with a variant capsid and its use. Specifically, the present invention improves the transduction efficiency of the AAV virus to the retina by inserting a 9aa length specific polypeptide into the parent AAV capsid protein. The transduction efficiency of the AAV variants (such as RC-V25, RC-V36) of the present invention to retinal cells is significantly enhanced compared with the parent AAV2 and the prior art AAV2.7m8 variant. The AAV variants of the present invention are suitable for both subretinal and intravitreal administration. On this basis, the present invention was completed.

[0063] The new AAV variants RC-V25 and RC-V36 discovered in the present invention have higher transduction efficiency and penetration in the eyes of living animals than the variant AAV2.7m8 in the prior art. When injected into the vitreous cavity of the mouse eye, fundus photographs and sections showed that RC-V25 and RC-V36 can carry reporter genes to a wider area within the eye than AAV2.7m8, and more often reach the inner nuclear layer and outer nuclear layer.

[0064] The new AAV variants RC-V25 and RC-V36 discovered in the present invention have verified their transduction efficiency in human retinal cells in human retinal organoids, and both RC-V25 and RC-V36 have shown that their transduction effects are significantly higher than AAV2.7m8. This shows that RC-V25 and RC-V36 will have more advantages in drug delivery for human eye diseases, and can overcome the disadvantage that existing AAV variants cannot effectively transduce in the treatment of eye diseases.

[0065] the term

[0066] For the purpose of interpreting this specification, the following definitions will be used, and whenever appropriate, terms used in the singular may also include the plural, and vice versa. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0067] The term "about" or "approximately" includes within statistically significant ranges of values. Such ranges may be within an order of magnitude of a given value or range, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% or within 1%. The permissible variations encompassed by the term "about" or "approximately" depend on the specific system under study and can be readily appreciated by those of ordinary skill in the art.

[0068] As used herein, the term "and / or" means any one of the alternatives or two or more or all of the alternatives.

[0069] As used herein, the term "comprising" or "including" means including the stated elements, integers or steps, but not excluding any other elements, integers or steps. In this article, when the term "comprising" or "including" is used, unless otherwise indicated, it also covers the situation consisting of the stated elements, integers or steps. For example, when referring to a polypeptide "comprising" a specific sequence, it is also intended to cover a polypeptide consisting of the specific sequence.

[0070] As described in this article, adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependinovirus of the family Parvoviridae. It is the simplest type of single-stranded DNA defective virus discovered so far, and requires a helper virus (usually adenovirus) to participate in replication. It encodes the VP1 gene and rep gene in the middle of the inverted repeat sequence (ITR) at the two ends. ITR plays a decisive role in the replication and packaging of the virus. The VP1 gene encodes the viral capsid protein, and the rep gene participates in the replication and integration of the virus. AAV can infect a variety of cells. Because adeno-associated virus is smaller than other viral vectors, has no pathogenicity, and can transfect dividing and non-dividing cells, gene therapy methods based on AAV vectors for eye diseases, especially inherited retinal degenerative diseases, have received widespread attention.

[0071] Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its good safety, wide range of host cells (dividing and non-dividing cells), low immunogenicity, and long-term expression of foreign genes in vivo, it is regarded as one of the most promising gene transfer vectors and is widely used in gene therapy and vaccine research worldwide. In medical research, rAAV is used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments). At the same time, as a characteristic gene transfer vector, it is also widely used in gene function research, construction of disease models, preparation of gene knockout mice, etc.

[0072] The term "capsid protein" refers to a protein that is part of the viral capsid. For adeno-associated viruses, the capsid proteins are generally referred to as VP1, VP2 and / or VP3, and are each encoded by a single VP1 gene. For AAV, these three AAV capsid proteins are produced in an overlapping manner from the capsid open reading frame (ORF) via alternate mRNA splicing and / or alternate translation start codons. All three proteins use a common stop codon (Warrington et al. (2004) J. Virol. 78: 6595). The amino acid sequences of the capsid proteins of adeno-associated viruses are well known in the art and are generally conserved. Accordingly, although the amino acid positions provided herein can be provided relative to the capsid protein VP1 of AAV2, and unless otherwise specified, the amino acid positions provided herein are determined with reference to the amino acid positions of the AAV2 capsid protein shown in SEQ ID NO: 6, the technician can separately and easily determine the corresponding positions of the same amino acids in different AAV serotypes. The "capsid protein" described in this article includes capsid proteins of existing serotypes such as AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), and AAV type 9 (AAV9).

[0073] As used herein, the term "rAAV" refers to recombinant adeno-associated virus, also referred to as recombinant adeno-associated viral particles or recombinant AAV.

[0074] The term "retinal cell" may refer herein to any cell type, including the retina, such as retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells, and photoreceptor cells (including rods and cones), Mullerian glial cells, and retinal pigment epithelial cells.

[0075] As used herein, the phrase "operably linked" includes a physical juxtaposition (e.g., in three-dimensional space) of components or elements that interact directly or indirectly with each other, or otherwise coordinate with each other to participate in a biological event, which juxtaposition achieves or allows such interaction and / or coordination. In some embodiments, "operably linked" involves covalent linkage of the associated components or elements to each other. However, those skilled in the art will appreciate that in some embodiments, covalent linkage is not required to achieve effective operable linkage.

[0076] The term "capsid protein variant" includes a capsid protein having at least one mutation (eg, substitution, deletion or insertion) compared to the corresponding capsid protein as a parent.

[0077] In this article, amino acid mutation can be amino acid substitution, deletion or insertion. Any combination of substitution, deletion or insertion can be performed to obtain optimized variants with desired properties. Amino acid deletion and insertion are included in the deletion and insertion of the amino and / or carboxyl terminal of the polypeptide sequence, and are also included in the deletion and insertion inside the polypeptide sequence. In some embodiments, amino acid mutation is amino acid substitution, such as single amino acid substitution, or a combination of several amino acid substitutions. In some embodiments, amino acid mutation is insertion, such as the insertion of several amino acid fragments. The inserted amino acid can simply be inserted between two given amino acids of capsid protein. Amino acid insertion can also be carried out together with the deletion of a given amino acid of capsid protein at the insertion site.

[0078] Herein, when referring to the amino acid position of the capsid protein to be mutated, it is determined by reference to the amino acid sequence shown in SEQ ID NO: 6. The corresponding amino acid position on the hybrid protein or polypeptide with other amino acid sequences can be identified by comparing the amino acid sequence with SEQ ID NO: 6.

[0079] The term "transduction" or "infection" and the like refers to the introduction of nucleic acid into target cells by a viral vector. The term "transduction efficiency" refers to the fraction (e.g., percentage) of cells expressing the target nucleotide after incubation with a set number of viral vectors containing the target nucleotide. Well-known methods for determining transduction efficiency include fluorescence-activated cell sorting of cells transduced with a fluorescent reporter gene, PCR for expression of the target nucleotide, and the like.

[0080] "Identity" or "percent identity (%)" of an amino acid sequence or nucleic acid sequence refers to the percentage of amino acid residues / nucleotides in a candidate sequence that are identical to the amino acid residues / nucleotides of a specific sequence shown in this specification, after aligning the candidate sequence with the specific sequence shown in this specification and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity, and not considering any conservative substitutions as part of the sequence identity. In some embodiments, the present invention includes variants of proteins or polypeptides or nucleic acids of the present invention, which have a considerable degree of identity, such as at least 80%, 85%, 90%, 95%, 97%, 98% or 99% or more, relative to the polypeptides or proteins or nucleic acids specifically disclosed herein. The variants may contain conservative changes.

[0081] The terms "individual" or "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0082] The term "treatment" includes administering a composition or hybrid polypeptide to prevent or delay the onset of symptoms, complications, or biochemical indications of a disease, to alleviate symptoms, or to arrest or inhibit further development of a disease, condition, or disorder. The term "prevention" includes inhibition of the occurrence or development of a disease or disorder or symptoms of a particular disease or disorder.

[0083] The term "pharmaceutical excipient" refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete)), excipient, carrier, stabilizer, or the like, which is administered together with the active substance.

[0084] The term "pharmaceutical composition" refers to a composition that is in a form that permits the biological activity of the active ingredient contained therein to be effective, and that contains no additional ingredients that are unacceptably toxic to a subject to which the composition would be administered.

[0085] The term "effective amount" refers to that amount or dosage of a rAAV or composition or combination of the invention which, after administration in single or multiple doses to a patient, produces the desired effect in a patient in need of treatment or prevention.

[0086] The term "therapeutically effective amount" refers to an amount effective to achieve the desired therapeutic outcome at the required dosage and for the required period of time. A therapeutically effective amount is also an amount in which any toxic or deleterious effects of the rAAV or composition or combination are outweighed by the therapeutically beneficial effects. A "therapeutically effective amount" preferably inhibits a measurable parameter or improves a measurable parameter by at least about 40%, even more preferably by at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or even 100% relative to an untreated subject.

[0087] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogs. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. As used herein, the term polynucleotide may refer alternately to double-stranded and single-stranded molecules.

[0088] The term "target nucleic acid" refers to the nucleic acid to be transduced by recombinant AAV viral particles, which encodes, for example, preventive or therapeutic proteins, particularly proteins for preventing or treating ophthalmic diseases, such as AIPL1, PROM1, RS1, RPE65, macromolecular antibodies and antibody analogs, etc.

[0089] AAV capsid protein variants

[0090] In some embodiments, the present invention relates to a novel AAV capsid protein variant having a 9aa insertion peptide relative to the parent AAV capsid protein.

[0091] In some embodiments, the amino acid sequence of the inserted peptide has a sequence identity of ≥60%, ≥70%, ≥80% or ≥90% with the sequence shown in SEQ ID NO: 4. In some embodiments, the amino acid sequence of the inserted peptide may have 3, 2 or 1 amino acid differences with the sequence shown in SEQ ID NO: 4, and the difference does not change or substantially does not change the retinal transduction efficiency of the AAV virus particles containing the capsid protein variant of the present invention. In some embodiments, the amino acid sequence of the inserted peptide is as shown in QGVPXQPGR (SEQ ID NO: 7), wherein X is any amino acid. For example, X can be an amino acid selected from the group consisting of N, S, Q, T, G, V, D, H, A, M and K. In some embodiments, the amino acid sequence of the inserted peptide may be as shown in any one of SEQ ID NOs: 2, 4, 20-52. In some embodiments, the amino acid sequence of the inserted peptide is as shown in any one of SEQ ID NOs: 2, 4, 31, 43 or 52. In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in SEQ ID NO: 2 or 4.

[0092] The present invention also relates to a plasmid comprising a nucleic acid encoding the capsid protein variant of the present invention.

[0093] Target nucleic acid

[0094] The capsid protein of the present invention can package the target nucleic acid to form virus particles.

[0095] The nucleic acid of interest suitable for being encoded by the viral particles of the present invention is any nucleic acid encoding a therapeutic or preventive protein, in particular a nucleic acid encoding a protein for the prevention or treatment of ophthalmic diseases, such as ophthalmology-related genes, such as RPE65, AIPL1, PROM1, RS1 genes, etc. In some embodiments, proteins for the prevention or treatment of ophthalmic diseases include, but are not limited to, for example, RPE65, AIPL1, PROM1, RS1 or antibody analogs, etc.

[0096] The nucleic acid of interest can be contained in an expression cassette and packaged within an AAV capsid.

[0097] In some embodiments, the expression cassette comprises at least one ITR sequence so that the vector genome can be smoothly assembled by the capsid. The expression cassette can be single-stranded DNA, double-stranded DNA, or single-stranded RNA or double-stranded RNA.

[0098] In some embodiments, the expression cassette may comprise one or more regulatory sequences to direct the expression of the target nucleic acid coding sequence in a target cell (e.g., a retinal target cell, such as a photoreceptor cell or an optic nerve cell). The regulatory sequence may be selected from a transcription initiation sequence, a termination sequence, a promoter and / or an enhancer sequence operably linked to the coding sequence; an efficient RNA processing signal such as a splicing and polyadenylation (poly A) region, including a human growth hormone polyadenylation region; an inverted repeat sequence (e.g., L-ITR or R-ITR); a selective marker or reporter gene, such as a resistance gene; a microRNA; a post-transcriptional regulatory sequence, such as WPRE (a post-transcriptional regulatory sequence of woodchuck hepatitis virus); a sequence that stabilizes cytoplasmic mRNA; a nucleic acid restriction site; a homologous recombination sequence; a sequence that enhances translation efficiency (e.g., a Kozak sequence); a sequence that enhances protein stability; and a sequence that enhances secretion of the encoded product when desired.

[0099] In some preferred embodiments, the regulatory sequence is located in the 5'UTR or 3'UTR. In some preferred embodiments, the regulatory sequence is selected from one or more of the following:

[0100] Promoters, inverted repeats, introns, enhancers, post-transcriptional regulatory sequences, polyadenylation regions, selectable markers or reporter genes.

[0101] Examples of promoters suitable for use in the present invention include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including monkeys and humans). Promoters may be constitutive or inducible. Constitutive promoters initiate RNA synthesis independently of regulatory influences.

[0102] The expression cassette of the present invention may also include a selective marker or reporter gene, for example to determine the expression of the vector in a growth system (e.g., bacterial cell) or in a target cell." Selectable marker " or " reporter gene " of the present invention may be selected from those known in the art. Suitable reporter genes include, but are not limited to, enhanced green fluorescent protein, red fluorescent protein, luciferase and secreted embryo alkaline phosphatase (seAP), which may include sequences encoding geneticin, hygromycin or puromycin resistance, etc. Such selective markers or reporter genes (which may be located or not located outside the viral genome to be packaged into the virion) may be used to send a signal of the presence of a plasmid in a bacterial cell, such as an antibiotic resistance marker gene, for example ampicillin or tetracycline resistance or kanamycin resistance.

[0103] The expression cassette or expression vector of the present invention may also comprise a polyadenylation region, such as hGHpA (human growth hormone polyadenylation region).

[0104] The expression cassette or expression vector of the present invention may also contain introns, such as introns of chimeric or native genes.

[0105] Virus particles

[0106] The present invention relates to a recombinant AAV virus (rAAV) particle comprising

[0107] (i) an AAV capsid protein variant of the present invention; and

[0108] (ii) a target nucleic acid packaged in the AAV capsid, such as a gene associated with an ophthalmic disease or a nucleic acid encoding a protein for treating an ophthalmic disease.

[0109] Preparation method

[0110] The present invention relates to a method for preparing recombinant AAV virus particles (rAAV). Many methods are known in the art for packaging and producing rAAV. Currently commonly used rAAV packaging systems mainly include a three-plasmid co-transfection system, a system with adenovirus as a helper virus, a packaging system with herpes simplex virus type 1 (HSV1) as a helper virus, and a packaging system based on baculovirus. Each packaging system has its own characteristics, and those skilled in the art can make appropriate choices as needed.

[0111] rAAV production cultures for producing rAAV viral particles all require: 1) suitable host cells, including, for example, human-derived cell lines such as HEK-293T cells, or insect-derived cell lines (in the case of baculovirus production systems); 2) suitable helper functions, which are provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpes virus, baculovirus, or plasmid constructs that provide helper functions; 3) AAV rep and VP1 genes and gene products; 4) the target gene / target nucleic acid, which is flanked by at least one AAV ITR sequence that retains full function and is preferably driven by an operably linked promoter; and 5) a suitable culture system to support rAAV production.

[0112] In some embodiments, the present invention relates to a method for producing recombinant AAV virus particles, comprising culturing packaging cells under conditions sufficient to produce recombinant AAV virus particles, wherein the packaging cells comprise a plasmid comprising a nucleic acid encoding a capsid protein variant according to the present invention or a capsid protein variant encoding nucleic acid according to the present invention.

[0113] In some embodiments, the packaging cell further comprises a helper plasmid and / or a transfer plasmid comprising the nucleic acid of interest.

[0114] In some embodiments, the method further comprises isolating the recombinant AAV viral particles from the culture supernatant.

[0115] In some embodiments, the method further comprises lysing the packaging cells and isolating recombinant AAV viral particles from the cell lysate.

[0116] In some embodiments, the method further comprises one or more of the following steps:

[0117] a. Remove cell debris,

[0118] b. Treating the supernatant containing recombinant AAV virus particles with universal nuclease,

[0119] c. Concentrated recombinant AAV virus particles,

[0120] d. Purify the recombinant AAV virus particles.

[0121] Therefore, the present invention also relates to a packaging cell for producing recombinant AAV virus particles, wherein the packaging cell comprises a plasmid comprising a nucleic acid encoding a capsid protein variant according to the present invention or a capsid protein encoding nucleic acid according to the present invention or an expression cassette according to the present invention.

[0122] Composition, medicine or preparation

[0123] The present invention provides a preparation, composition or drug, which contains (a) the rAAV of the present invention, and (b) pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0124] As used herein, "pharmaceutical carrier" includes any and all solvents, dispersion media, isotonic and absorption delaying agents, etc. that are physiologically compatible. For the use of pharmaceutical excipients and their uses, see also "Handbook of Pharmaceutical Excipients", 8th Edition, RC Rowe, PJ Seskey and SC Owen, Pharmaceutical Press, London, Chicago.

[0125] In some embodiments, pharmaceutical excipients include, but are not limited to, one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here refers to the ability of the components in the composition to blend with the active ingredients of the present invention and with each other without significantly reducing the efficacy of the active ingredients. Suitable pharmaceutical excipients will be known to those skilled in the art. Examples of pharmaceutically acceptable carrier parts include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0126] The preparation or composition or medicine of the present invention can be liquid or solid, for example powder, gel or paste. Preferably, the preparation or composition or medicine of the present invention is liquid, preferably an injectable liquid. Preferably, the injectable liquid is provided as a capsule or in a syringe.

[0127] The rAAV of the present invention or a preparation, composition or drug comprising the same can be administered intravenously, intramuscularly, subcutaneously, orally, by mucosal contact, intraperitoneally and intralesionally, preferably topically to the eye, for example, by intraretinal administration or intravitreal administration, for example, intravitreal injection, subretinal injection or suprachoroidal injection. In some embodiments, the rAAV of the present invention or a preparation, composition or drug comprising the same can be administered intraretinally or intravitreally, for example, by intravitreal or subretinal administration, for example, intravitreal administration (IVT administration). In any mode of administration, preferably, the preparation, composition or drug of the present invention is provided as an injectable liquid.

[0128] The composition or formulation or medicament may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0129] The composition of the present invention, such as a pharmaceutical composition or a pharmaceutical preparation, may further comprise other active ingredients, such as one or more other therapeutic agents, such as an immunomodulator (eg, an immunosuppressant).

[0130] Combination Products

[0131] The invention also provides combination products (eg, pharmaceutical combination products) comprising the rAAV of the invention, and one or more other therapeutic agents. The combination products of the invention can be used in the treatment methods of the invention.

[0132] The present invention also provides a kit comprising the combination product, for example, the kit comprises in the same package:

[0133] A first container containing the rAAV of the present invention or a medicament comprising the same;

[0134] A second container of a pharmaceutical composition comprising one or more additional therapeutic agents (eg, an immunomodulatory agent).

[0135] In some embodiments, the other therapeutic agent is an immunomodulator, such as an immunosuppressant, for example, to reduce the immune response generated by the rAAV particles, such as an immune inflammatory response.

[0136] Treatment

[0137] In one embodiment, the rAAV, formulation or composition or medicament of the invention is used to treat an ocular disease.

[0138] In some embodiments, ocular diseases include, but are not limited to, dry age-related macular degeneration (dAMD), geographic atrophy, crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, hereditary retinal degeneration (IRD), congenital cataract, glaucoma, congenital retinal, iris or choroidal coloboma, retinoblastoma, pathological myopia, congenital optic neuropathy, strabismus, keratoconus, etc.

[0139] In one embodiment, the rAAV, formulation or composition or medicament of the invention is administered intraocularly, for example, intraretinal administration or intravitreal administration, for example, subretinal administration or intravitreal administration. In one embodiment, the administration is injection.

[0140] In one embodiment, the present invention also relates to the use of recombinant AAV virus particles, preparations or compositions or combination products containing the same in the preparation of a medicament for treating an eye disease of the present invention.

[0141] The main advantages of the present invention include:

[0142] (a) The present invention provides a series of novel AAV variants with stronger retinal transduction efficiency, which solves the problem of insufficient transduction efficiency or weak expression during intravitreal injection for intraocular treatment in the prior art;

[0143] (b) The present invention verifies the transduction efficiency of AAV variants in human retinal cells through transduction experiments in human retinal organoids, which is closer to the clinical application environment than the existing technology that only verifies the transduction efficiency in primates.

[0144] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0145] Example 1 Screening of AAV variants with enhanced retinal cell transduction

[0146] Construction of RC-C07-V2 serotype capsid plasmid

[0147] Experimental methods and principles: A mutation was introduced into the CAP gene of wild-type AAV2 by polymerase chain reaction (PCR) and GIBSON ligation to generate a peptide display library between amino acids 588 and 589 of the wild-type AAV2 genome.

[0148] Steps: The experimental steps are as follows Figure 1As shown. Using the AAV2 CAP gene as a template, the upstream primer 9mer-F (TACCAACCTCCAGAGAGGCAACAGA(NNN)×9 CAAGCAGCTACCGCAGATGT, SEQID NO: 12) carrying a random 27-nucleotide insertion was used together with the antisense primer 9mer-R (TCCCGACATCGTATTTCCG, SEQ ID NO: 13) to PCR to obtain a double-stranded DNA fragment with a 27-nucleotide insertion. The double-stranded DNA was inserted and cloned between the 588th and 589th amino acid sequences of the CAP of the genome using the Gibson ligation method to generate a 9mer display library with high diversity, and then the 9mer display library was packaged (Perabo et al., 2003; Muller et al., 2003). Viruses are generated so that each variant viral capsid contains its corresponding viral genome. Therefore, by associating the infection information of the virus library with its corresponding genome information, the infection status of each variant can be identified.

[0149] The viral library was screened in mice expressing GFP specifically in rod photoreceptors (rho-GFP) (Wensel et al. (2005) Vision Res. 45: 3445). Briefly, adult rho-GFP mice were intravitreally injected with 2 μL of iodixanol-purified viral library diluted in phosphate-buffered saline (PBS) at a genome titer of approximately 1 × 10 12 Viral genomes (vg) / mL. One week after injection, the eyes were dissected and the retinas were treated with Neural Tissue Dissociation Kit – Postnatal Neurons (Miltenyi Biotec, 130-094-802). Then, photoreceptor cells with GFP were isolated using a flow cytometer (FACS), the cell genome was extracted, and the viral gene was amplified using PCR. The amplified fragments were subjected to a new round of 9mer display library construction and packaging, and injected again, and repeated three times. In this way, directed evolution can be simulated to screen AAV variants that infect photoreceptors more strongly.

[0150] In the third round of screening, PCR was performed on the viral library and the genome of GFP-positive cells recovered by FACS to amplify the viral genes and perform second-generation sequencing to find the most enriched viral variants. Among the top 500 most enriched variants, Figure 2 As shown, nearly one-third of the variants contained sequences similar to "QGVPNQPGR".

[0151] The selected partial sequences are shown in Table 1. The subsequent examples were studied using SEQ ID NO: 2 and SEQ ID NO: 4. The sequences shown in SEQ ID NO: 20-52 were ranked higher than SEQ ID NO: 2 and 4 in the screening, and it is expected that they will have similar or better effects than SEQ ID NO: 2 and 4.

[0152] Table 1 Sequence screening results

[0153]

[0154] *During screening, the ratio of DNA enriched in mouse photoreceptors to viral library DNA of the corresponding variant. The higher the difference fold (FC), the higher the enrichment in mouse photoreceptors.

[0155] Example 2 Preparation of AAV variants

[0156] According to the above screening rules, representative AAV variants were designed, namely the RC-V25 variant with the short peptide "QGVPTQPGR (SEQ ID NO: 2)" inserted after position 588 of VP1 of AAV2 and the RC-V36 variant with the short peptide "QGVPNQPGR (SEQ ID NO: 4)".

[0157] Follow the steps below to construct plasmids and package a series of AAV viruses with mScarlet transgenes, including RC-V25, RC-V36, AAV2, AAV2.7m8, etc., for subsequent in vitro cell and in vivo mouse transduction experiments.

[0158] (1) Construction of RC-V25 plasmid

[0159] The cap gene and downstream poly sequence of AAV2 plasmid were completely digested with Swa I at 2003 bp and Sma I at 4348 bp to obtain a linearized vector, the cap gene and downstream poly sequence of AAV2 were removed, and replaced by a 2372 bp fragment containing RC-V25 cap and downstream poly sequence through homologous recombination. The fragment was amplified by polymerase chain reaction (PCR), and PCR was performed using AAV2 plasmid as a template to obtain two amplification products: (a) upstream of the 589-597aa mutation region, the 5' end amplification primer was RC-V25-F1, AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO: 14), and the 3' end amplification primer was RC-V25-R1, GCTGGGTGGGCACGCCCTGTCTGTTGCCTCTCTGGAGGTTG (SEQ ID NO: 15); (b) Downstream of the 589-597aa mutation region, the 5' end amplification primer was RC-V25-F2, GGCGTGCCCACCCAGCCCGGCAGACAAGCAGCTACCGCAGATG (SEQ ID NO: 16), and the 3' end amplification primer was RC-V25-R2, CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO: 17). The above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V25 cap and the downstream partial poly sequence.

[0160] (2) Construction of RC-V36 plasmid

[0161] Similar to the above construction method, the RC-V36 vector was constructed by homologous recombination of the fragment containing the RC-V36 cap with the linearized vector. The fragment containing RC-V36 cap was obtained by PCR amplification. Using AAV2 plasmid as template, PCR obtained two amplification products: (a) upstream of the 589-597aa mutation region, the 5' end amplification primer was RC-V36-F1, AACAATAAAATGATTTAAATCAGGTATGG (SEQ ID NO: 14), and the 3' end amplification primer was RC-V36-R1, GGGCTGGTTGGGCACGCCCTGTCTGTTGCCTCTCTGGAGG (SEQ ID NO: 18); (b) downstream of the 589-597aa mutation region, the 5' end amplification primer was RC-V36-F2, CGTGCCCAACCAGCCCGGCAGACAAGCAGCTACCGCAGATG (SEQ ID NO: 19), and the 3' end amplification primer was RC-V36-R2, CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO: 17). The above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V36 cap and part of the downstream poly sequence.

[0162] (2) AAV packaging and purification

[0163] Use 300ml suspension medium (SMM 293-CD1, Sino Biological) to dilute the seed cells to 1E+6 / ml, and culture at 37℃, 120rpm, 5% CO2 in a shaker. Add 300μg of plasmid to 15ml of SMM 293-TII without antibiotics and GlutaMax. The molar ratio of LX-GOI-E10 (mScarlet reporter genome plasmid), RC-V25 (Rep-Cap plasmid), and pHelper (auxiliary packaging plasmid) for 3 plasmid packaging is 1:1:1. Add 300μl Fecto VIR-AAV to the dilution, vortex and stand at room temperature for 30min. Add the transfection mixture dropwise to the suspension cells and culture at 37℃, 120rpm, 5% CO2 in a shaker. After 24h and 48h of packaging, feed according to the ratio of 35ml / L SMS 293-SUPI (Sino Biological) per liter of cell fluid. After 72 hours, the cells were collected by centrifugation at 1500 rpm for 10 minutes in a horizontal rotor, the supernatant was discarded, the cells were resuspended with PBS, and the all-purpose enzyme was added at 50 U / ml sample, and digested at 37 degrees on a shaker for 1 hour; the cells were centrifuged at 4000 rpm for 15 minutes in a horizontal rotor, the supernatant was collected, and iodixanol ultracentrifugation was performed. The 40% iodixanol layer was taken and PBS was replaced using a 50 ml Millipore 100KD ultrafiltration tube, and the virus was stored at -80°C.

[0164] Example 3 Retinal organoid experiment

[0165] Retinal organoids (optic cups) are differentiated from human iPSC cells and can form a three-dimensional structure containing all retinal cell types. The optic cup is highly similar to the human retinal structure and can better simulate the effect of AAV infection of the human retina. When the optic cup differentiates to the mature stage of photoreceptor cells (about 150 to 200 days), this example detects the transduction activity of RC-V25, RC-V36, AAV2, and AAV2.7m8 viral vectors in human retinal organoids.

[0166] Experimental steps:

[0167] (1) Optic cup differentiation

[0168] Wild-type H9 cells were used for retinal organoid differentiation. On Day 0, human embryonic stem cell line H9 cells were gently digested at 37°C and embryoid bodies (EBs) were established in ultra-low attachment 6-well plates. On Day 1-5, NIM medium (DMEM / F12 + 1xN2+MEM-NEAA+Heparin) was replaced every 2 days. On Day 7-15, EBs were transferred to a 6-well plate in Matrigel Coat using a Pasteur pipette, and half of the NIM medium was replaced on D9, D12, and D15. On Day 16-25, 3:1 Medium (DMEM / F12 + 1x B27+MEM-NEAA) was used to replace the medium every 2 days to separate the optic cup. The cells were scraped off with the cross method of the pipette tip and transferred to a low-adhesion 6-well plate with a Pasteur pipette. After the optic cup was separated, the culture medium was changed to 3D-RDM (DMEM / F12 +10% FBS+MEM-NEAA+1x B27+100μM Taurine+CDLS); on Day 30-40, the optic cup with obvious structure was picked up under a stereomicroscope for long-term culture. The first stage of optic cup differentiation lasts as late as the sixth week after separation, and this stage is characterized by the beginning of the appearance of a black core in the center; 17-24 weeks after the optic cup is separated, most iPSC-derived optic cups develop to the second stage, which is characterized by the appearance of obvious surface hair-like appendages and the reappearance of a thin outer edge. At the beginning of the third stage of differentiation (later than 148-196 days), the optic cup reaches an advanced state of photoreceptor cell development, including the formation of inner and outer segments, outer nuclear layer and outer plexiform layer, and can be tested for AAV infection.

[0169] (2) Optic cup infection

[0170] AAV2, AAV2.7m8, and RC-V25 viruses were uniformly diluted to 1E11vg / μl. Differentiated mature retinal organoids were infected with 1E8vg and 1E9vg, and the 3D-RDM medium was changed every three days. On Day 34 of infection, the cells were photographed and digested, the medium was discarded, and then the Neurosphere Dissociation Kit (miltenyibiotec, 130095943) was used to dissociate them into single cells and then the autofluorescence in the cells was detected by flow cytometry.

[0171] Results: Figure 3 As shown in (ae), at the multiplicity of infection (MOI) = 1E8 and 1E9, the fluorescence photos and flow cytometry statistical results showed that the transduction efficiency, transduction average fluorescence intensity and total fluorescence intensity of RC-V25 were significantly higher than those of AAV2 and AAV2.7m8. Figure 4As shown in (ae), at MOI=1E8 and 1E9, the fluorescence photographs and flow cytometry statistical results showed that the transduction efficiency, transduction average fluorescence intensity and total fluorescence intensity of RC-V36 were also significantly higher than those of AAV2 and AAV2.7m8.

[0172] Example 4 RGC5 transduction experiment

[0173] The RGC5 cell line is a mouse photoreceptor cell line and is widely used to study the biological characteristics of the retina. In this example, AAV2, AAV2.7m8, RC-V25, and RC-V36 were used to infect RGC5 and flow cytometry was performed.

[0174] Steps: AAV2, AAV2.7m8, RC-V25, and RC-V36 viruses were uniformly diluted to 1E12 vg / μl. RGC5 cells were plated in 48-well plates at a density of 1E4 cells / well, and RGC5 was infected at MOI=2000 / 10000 24 hours later. After 24 hours of infection, the culture medium was replaced with 10% FBS high-glucose DMEM. After 72 hours of infection, the cells were digested, the culture medium was discarded, 300 μL PBS was added to the cells, PBS was discarded, 50 μL Typsin was added, and the cells were placed in a 37°C incubator for digestion for 3 minutes. 200 μL DMEM containing 10% FBS was added to terminate the digestion, and the autofluorescence in the cells was detected by flow cytometry.

[0175] Results: Figure 5 As shown in (a), the percentage of transduced cells of RC-V25 and RC-V36 is twice that of AAV2 and 20% to 50% higher than that of AAV2.7m8; Figure 5 As shown in (b, c), the average fluorescence intensity and total fluorescence intensity of cells transduced with RC-V25 and RC-V36 were also significantly higher than those of AAV2 and AAV2.7m8.

[0176] Example 5 Intravitreal (IVT) injection efficacy test in animals

[0177] The above RC-V25 and RC-V36 were packaged with a vector having a CAG-mScarlet transgene to demonstrate their transduction properties.

[0178] Three C57 WT mice aged 6-8 weeks were prepared, and the prepared RC-V25-mScarlet, RC-V36-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet serotypes were administered by intravitreal (IVT) injection at a dose of 1E9 vg / eye. In vivo transduction efficiency was evaluated by in vivo autofluorescence (AF) examination and retinal section examination at 4 and 6 weeks after administration, respectively.

[0179] Results: Figure 6 As shown in (ac), AF showed that the fluorescence intensity of RC-V25 and RC-V36 was higher than that of AAV2.7m8 and AAV2. ImageJ was used to count the fluorescence intensity of both eyes of AF of all mice. The statistical results showed that the average fluorescence intensity and total fluorescence intensity of RC-V25 and RC-V36 were higher than those of AAV2.7m8 and AAV2. Although only RC-V25 had a statistical difference, RC-V36 had a trend of being stronger than AAV2.7m8 and AAV2. Therefore, the total fluorescence intensity of RC-V25 and RC-V36 was higher than that of AAV2.7m8 and AAV2.

[0180] Six weeks later, the mouse retina was sliced ​​and fluorescent photos were taken. Figure 7 ) showed that RC-V25 and RC-V36 robustly expressed mScarlet in many cell types, including retinal ganglion cells (RGCs) and Muller cells, as well as outer nuclear layer (ONL) nuclei, and the slice panorama showed that mScarlet was uniformly expressed throughout the retinal slice. However, although AAV2.7m8 also expressed mScarlet on RGCs and Muller cells, the number of expression in each cell and the expression intensity of the target protein were less than those of RC-V25 and RC-V36, and the target protein was only expressed in local locations in retinal slices, with a far lower uniformity and breadth than RC-V25 and RC-V36. In mice infected with AAV2, only a small amount of RGC expression was observed in the retina, no other cell types were observed, and the expression fluorescence intensity was very weak. Therefore, in vivo, RC-V25 and RC-V36 are expressed in more cell types in retinal tissues than AAV2.7m8 and AAV2, and the fluorescence expression of the target protein is stronger and more widely distributed.

[0181] Example 6 In vivo subretinal (SR) injection efficacy test in animals

[0182] Three C57 WT mice aged 6-8 weeks were prepared, and the three serotypes of RC-V25-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet were administered by subretinal (SR) injection at a dose of 2E8vg / eye. In vivo autofluorescence (AF) examination and retinal flat mount examination were performed 4 and 6 weeks after administration to evaluate the in vivo transduction efficiency.

[0183] Results: Figure 8As shown in (ab), AF showed that the fluorescence intensity of RC-V25 and RC-V36 was higher than that of AAV2.7m8 and AAV2. ImageJ was used to count the fluorescence intensity and fluorescence area of ​​AF in both eyes of all mice. The statistical results showed that although the fluorescence intensity of RC-V25 and RC-V36 was only significantly higher than that of AAV2, the fluorescence area of ​​RC-V25 and RC-V36 was significantly higher than that of AAV2.7m8 and AAV2, and the total fluorescence intensity of RC-V25 and RC-V36 was higher than that of AAV2.7m8 and AAV2. The results suggest that RC-V25 and RC-V36 have higher retinal transfection efficiency than AAV2.7m8 and AAV2.

[0184] Six weeks later, the mouse retinas were mounted and fluorescent photographs were taken. Fig. 9 As shown in (ab), the retinal flat mounts show that the target protein expressed by RC-V25 and RC-V36 is widely distributed, about half of the entire retinal flat mount, and the fluorescence intensity is strong; the protein area expressed by AAV2.7m8 on the retinal flat mount is lower than that of RC-V25 and RC-V36; AAV2 is far lower than RC-V25 and RC-V36 in terms of both the intensity of target protein expression and the distribution of fluorescence area. Fig. 9 As shown in (c), the RPE choroid flat mount showed that both the intensity of target protein expression and the distribution of fluorescence area were much higher in RC-V25 and RC-V36 than in AAV2.7m8 and AAV2. ImageJ was used to calculate the total fluorescence intensity of all mouse eye flat mounts. The statistical results showed that the total fluorescence intensity of RC-V25 and RC-V36 was much higher than that of AAV2.7m8 and AAV2 in both retinal flat mounts and RPE choroid flat mounts.

[0185] sequence:

[0186] RC-V25 VP1 amino acid sequence (SEQ ID NO: 1):

[0187] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQGVPTQPGRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL

[0188] Amino acid sequence of replacement peptide 1 (SEQ ID NO: 2):

[0189] QGVPTQPGR

[0190] VP1 amino acid sequence of RC-V36 (SEQ ID NO: 3):

[0191] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQGVPNQPGRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL

[0192] Amino acid sequence of replacement peptide 2 (SEQ ID NO: 4):

[0193] QGVPNQPGR

[0194] VP1 amino acid sequence of AAV2.7m8 (SEQ ID NO: 5):

[0195] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNLALGETTRPARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL

[0196] Amino acid sequence of VP1 of AAV2 (SEQ ID NO: 6):

[0197] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL

[0198] Insert peptide amino acid sequence (SEQ ID NO: 7):

[0199] QGVPXQPGR, X = N, S, Q, T, G, V, D, H, A, M or K

[0200] VP1 nucleic acid sequence of RC-V25 (SEQ ID NO: 8):

[0201]

[0202] RC-V36 VP1 nucleic acid sequence (SEQ ID NO: 9):

[0203]

[0204] AAV2.7m8 nucleic acid sequence (SEQ ID NO: 10):

[0205]

[0206] AAV2 VP1 nucleic acid sequence (SEQ ID NO: 11):

[0207]

[0208] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. An adeno-associated virus (AAV) capsid protein variant, characterized in that The VP1 amino acid sequence of the AAV capsid protein variant is shown in SEQ ID NO: 1 or 3.

2. An isolated polynucleotide, characterized in that The polynucleotide encodes the AAV capsid protein variant according to claim 1.

3. A carrier, characterized in that The vector contains the polynucleotide according to claim 2.

4. A host cell, characterized in that The host cell contains the vector as claimed in claim 3, or the polynucleotide as claimed in claim 2 is integrated into its genome.

5. A recombinant adeno-associated virus particle, characterized in that: The recombinant adeno-associated virus particle comprises: (i) the AAV capsid protein variant according to claim 1; (ii) a nucleic acid of interest packaged in the AAV capsid.

6. A method for preparing the recombinant adeno-associated virus particle according to claim 5, characterized in that: The method comprises the steps of: culturing the host cell as claimed in claim 4 under suitable conditions, wherein the host cell further contains a helper plasmid containing the target nucleic acid, thereby obtaining the recombinant adeno-associated virus particles.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (a) the recombinant adeno-associated virus particle of claim 5; and (b) a pharmaceutically acceptable carrier.

8. A pharmaceutical combination product, characterized in that: The drug combination includes: (a) a first active ingredient: the recombinant adeno-associated virus particle according to claim 5, or the pharmaceutical composition according to claim 7; and (b) a second active ingredient.

9. Use of the recombinant adeno-associated virus particle according to claim 5, or the pharmaceutical composition according to claim 7, or the pharmaceutical combination product according to claim 8, or a combination thereof in the preparation of a medicament for treating an eye disease.

10. The use according to claim 9, characterized in that The eye disease is selected from the group consisting of dry age-related macular degeneration (dAMD), crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), Fabry disease, inherited retinal degeneration (IRD), or a combination thereof.

11. The use according to claim 10, characterized in that The inherited retinal degeneration (IRD) is selected from the group consisting of retinitis pigmentosa (RP), choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis, Leber congenital amaurosis, or a combination thereof.

12. The use according to claim 11, characterized in that The retinitis pigmentosa (RP) is X-linked retinitis pigmentosa.

Images