sgRNA targeting TARDBP gene knockout in bovine mammary epithelial cells and its constructed cell line

Abstract

The present invention provides a sgRNA for targeted knockout of bovine mammary epithelial cell TARDBP gene and a cell line constructed thereof. The sgRNA includes sgRNA1 and sgRNA2, and the nucleotide sequences of the sgRNA are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The sgRNA of the present invention can accurately guide the Cas9 protein to target and cut the bovine mammary epithelial cell TARDBP gene, and the expression vector cell conversion rate obtained by constructing the sgRNA is high, which greatly improves the success rate of knocking out the bovine mammary epithelial cell TARDBP gene, and obtains the TARDBP gene knockout mammary epithelial cell line. In order to facilitate the study of the function and mechanism of the TARDBP gene in milk fat secretion and milk production of dairy cows, a cell model is provided, which lays the foundation for dairy cow biological breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to an sgRNA targeting the TARDBP gene of bovine mammary epithelial cells and a cell line constructed therefrom. Background Art

[0002] The statements in this section merely provide background information related to the present invention and do not necessarily constitute prior art.

[0003] The TARDBP gene, also known as the TDP-43 gene, is located on bovine chromosome 16 and encodes the TAR DNA-bindingprotein 43 (TDP-43) protein, which is a DNA and RNA binding protein with multiple functions such as transcriptional regulation and post-transcriptional regulation. Studies on mice have found that knocking out the TARDBP gene causes large milk fat droplet aggregation and severe milk fat secretion defects, ultimately leading to lactation failure. Mechanistic studies have found that the TDP-43 protein affects milk fat secretion by post-transcriptionally regulating the mRNA stability of milk fat secretion-related genes Btn1a1 and Xdh. Studies on humans have found that the expression level of TARDBP is positively correlated with higher milk production. However, the function and mechanism of the TARDBP gene in milk fat secretion and milk production performance of dairy cows still need further study.

[0004] At present, the siRNA interference technology is generally used to silence genes in the study of bovine gene function at the cellular level, but this technology has the problem of low interference efficiency. The establishment of a mammary epithelial cell line with knockout or deletion of the bovine TARDBP gene can provide a stable cell model for studying the function and mechanism of this gene, and lay the foundation for revealing the molecular mechanism of regulating milk fat secretion and production performance of dairy cows.

[0005] As the third generation of gene editing technology, CRISPR / Cas9 gene editing technology has advantages over the previous two generations of gene editing technologies, such as simple construction system, high precision, low cost, and the ability to perform site-specific editing on multiple sites at the same time. It has become the current mainstream gene editing technology. However, there are still some problems with the system, such as the editing efficiency is greatly affected by the target (sgRNA), the editing efficiency varies significantly in different species, and the delivery efficiency is different in different cells. The editing efficiency is also affected by the delivery method. In short, there are many influencing factors, and the editing efficiency is completely unpredictable.

[0006] Although there have been studies on the use of CRISPR / Cas9 technology in bovine cells, no studies have proven whether CRISPR / Cas9 technology can knock out the TARDBP gene in bovine mammary epithelial cells, as well as the function and mechanism of the TARDBP gene in milk fat secretion and milk production in dairy cows. Summary of the invention

[0007] In order to overcome the deficiencies of the above-mentioned prior art, the first object of the present invention is to provide an sgRNA for targeting the TARDBP gene of bovine mammary epithelial cells; the second object of the present invention is to provide an sgRNA expression vector for targeting the TARDBP gene of bovine mammary epithelial cells; the third object of the present invention is to provide a kit for knocking out the TARDBP gene of bovine mammary epithelial cells; the fourth object of the present invention is to provide a CRISPR / Cas9 system; the fifth object of the present invention is to provide a kit for constructing a bovine mammary epithelial cell TARDBP gene cell line; the sixth object of the present invention is to provide a method for constructing a bovine mammary epithelial cell TARDBP gene knockout cell line; the seventh object of the present invention is to provide a bovine mammary epithelial cell TARDBP gene knockout cell line.

[0008] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:

[0009] In a first aspect, the present invention provides a sgRNA for targeted knockout of the TARDBP gene in bovine mammary epithelial cells.

[0010] Includes sgRNA1 or sgRNA2;

[0011] The nucleotide sequence of the sgRNA1 is as follows: GAGATACCATCGGAAGACGA (SEQ ID NO. 1);

[0012] The nucleotide sequence of the sgRNA2 is as follows: GTCTTCCGATGGTATCTCAA (SEQ ID NO. 2).

[0013] The above-mentioned sgRNA was designed using the online tool E-Crisp and obtained after screening. The sgRNA can accurately guide the Cas9 protein to target and cut the TARDBP gene.

[0014] In a second aspect, the present invention provides an sgRNA expression vector for targeted knockout of the TARDBP gene in bovine mammary epithelial cells, characterized in that the vector comprises the DNA sequence of the sgRNA1 or sgRNA2 described in the first aspect.

[0015] Preferably, a primer containing sgRNA1 is annealed to obtain a double-stranded DNA fragment 1, and the DNA fragment 1 is ligated to an expression plasmid using a DNA ligase;

[0016] Alternatively, a primer containing sgRNA2 is annealed to obtain a double-stranded DNA fragment 2, and the DNA fragment 2 is ligated to an expression plasmid using a DNA ligase;

[0017] Preferably, the expression plasmid is Genloci pGK1.1 (Puro r ).

[0018] Preferably, the primer of sgRNA includes, sgRNA1-F: caccGAGATACCATCGGAAGACGA (SEQ ID NO. 3);

[0019] sgRNA1-R: aaacTCGTCTTCCGATGGTATCTC (SEQ ID NO.4);

[0020] Or, sgRNA2-F: caccGTCTTCCGATGGTATCTCAA (SEQ ID NO. 5);

[0021] sgRNA2-R: aaacTTGAGATACCATCGGAAGAC (SEQ ID NO. 6).

[0022] In a third aspect, the present invention provides a kit for knocking out the TARDBP gene in bovine mammary epithelial cells, comprising the primers described in the second aspect.

[0023] In a fourth aspect, the present invention provides a CRISPR / Cas9 system, which includes the gRNA expression vector described in the second aspect, a plasmid containing Cas9 or the sgRNA described in the first aspect and an exogenous cas9 protein.

[0024] In a fifth aspect, the present invention provides a kit for constructing a bovine mammary epithelial cell TARDBP gene cell line, wherein the kit comprises the CRISPR / Cas9 system described in the fourth aspect.

[0025] In a sixth aspect, the present invention provides a method for constructing a bovine mammary epithelial cell TARDBP gene knockout cell line, comprising the following steps:

[0026] The sgRNA1, sgRNA2 described in the first aspect or the sgRNA expression vector described in the second aspect or the system described in the fourth aspect is transferred into the host cell via liposomes, and then PCR identification and monoclonal culture are performed; positive clone cells are identified by PCR and sequencing to complete the construction of the knockout cell line.

[0027] Preferably, the host cell is a MAC-T cell; the primers for PCR identification are:

[0028] F: GCCTTTACTTTCTCGTTT (SEQ ID NO.7);

[0029] R: CTTGGCATTAGTTCAGCA (SEQ ID NO. 8).

[0030] In the seventh aspect, the present invention provides a bovine mammary epithelial cell TARDBP gene knockout cell line, wherein the cell line is a cell line in which the bovine TARDBP gene is targeted and knocked out using the sgRNA described in the first aspect, or a cell line constructed using the sgRNA expression vector described in the second aspect, the system described in the fourth aspect, the kit described in the fifth aspect, or the method described in the sixth aspect.

[0031] In an eighth aspect, the present invention provides the above-mentioned sgRNA, sgRNA expression vector, kit, CRISPR / Cas9 system, construction method and cell strain of bovine mammary epithelial cell TARDBP gene knockout for targeted knockout in regulating triglyceride synthesis of bovine mammary epithelial cells. Specifically, it is manifested as: inhibiting the synthesis of cellular triglycerides. Thus, a corresponding cell model is constructed for studying milk fat secretion and milk production performance of dairy cows.

[0032] One or more of the above technical solutions have the following beneficial effects:

[0033] The present invention provides a sgRNA for targeted knockout of the TARDBP gene, which can effectively target the TARDBP gene and accurately edit the TARDBP gene. The sgRNA is constructed into the CRISPR / Cas9 system, and a large number of monoclonal bovine mammary epithelial cells with knockout of the TARDBP gene can be obtained by transfecting cells, and the knockout efficiency is very high.

[0034] Compared with ZFNs and TALENs, this technology has the advantages of simple operation, precise and efficient knockout, etc. This study used CRISPR / Cas9 technology to knock out the TARDBP gene in bovine mammary epithelial cells, providing a cell model and laying a foundation for studying the function and related mechanisms of this gene.

[0035] It is preliminarily predicted that TARDBP is related to milk fat secretion in dairy cows, and knocking out or knocking down the TARDBP gene may inhibit milk fat secretion in dairy cows and affect milk production performance. Specifically, a bovine mammary epithelial cell model with the TARDBP gene knocked out was obtained through CRISPR / Cas9 gene editing technology; the triglyceride content in the cell culture medium was detected with the help of a triglyceride detection kit, and it was found that the triglyceride content in the cell culture medium with the TARDBP gene knocked out was significantly lower than that in the control group cells. Therefore, the bovine mammary epithelial cells with the TARDBP gene knocked out inhibited their triglyceride synthesis ability.

[0036] Advantages of additional aspects of the present invention will be given in part in the following description, and in part will become obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0038] Figure 1 This is a schematic diagram of the targeted knockout strategy of the bovine TARDBP gene according to Example 1 of the present invention.

[0039] Figure 2 This is the sequencing and identification result of sgRNA1 and sgRNA2 connected to the pGK1.1 vector in Example 2 of the present invention.

[0040] Figure 3 This is the sequencing peak diagram for detecting the effectiveness of knocking out the bovine TARDBP gene using pGK1.1-sgRNA1 / sgRNA2 in Example 3 of the present invention.

[0041] Figure 4 This is the peak graph and sequence analysis result of monoclonal cell sequencing of bovine TARDBP gene knockout mediated by sgRNA1 in Example 3 of the present invention.

[0042] Figure 5 This is the peak graph and sequence analysis result of monoclonal cell sequencing of bovine TARDBP gene knockout mediated by sgRNA2 in Example 3 of the present invention.

[0043] Figure 6 This is a comparison analysis of the amino acid coding sequences of TARDBP before and after sgRNA1-mediated knockout in Example 3 of the present invention.

[0044] Figure 7 This is a comparison analysis of the amino acid coding sequences of TARDBP before and after sgRNA2-mediated knockout in Example 3 of the present invention.

[0045] Figure 8 This is Example 3 of the present invention, in which Western blot was used to detect the expression of TARDBP protein in MAC-T cells before and after knockout.

[0046] Fig. 9 This is the MAC-T cell line with TARDBP gene knocked out in Example 3 of the present invention.

[0047] Fig.10 This is the GPO-PAP enzymatic method for determining the triglyceride content in the cell culture medium in Example 3 of the present invention, **P≤0.01.

[0048] Fig.11This is a differential gene volcano plot in Example 3 of the present invention; the horizontal axis in the figure is the log2FoldChange value, the vertical axis is -log10padj or -log10pvalue, and the blue dotted line represents the threshold line of the differential gene screening standard.

[0049] Fig.12 This is a GO enrichment analysis bar graph of Example 3 of the present invention; the horizontal axis in the figure is GO Term, and the vertical axis is the significance level of GOTerm enrichment, expressed by -log10(padj), and different colors represent different functional classifications.

[0050] Fig.13 This is a scatter plot of GO enrichment analysis in Example 3 of the present invention; the horizontal axis in the figure is the ratio of the number of differential genes annotated to GO Term to the total number of differential genes, and the vertical axis is GO Term.

[0051] Fig.14 This is a KEGG enrichment scatter plot of Example 3 of the present invention; the horizontal axis in the figure is the ratio of the number of differential genes annotated to the KEGG pathway to the total number of differential genes, and the vertical axis is the KEGG pathway.

[0052] Fig.15 RT-qPCR verification of differentially expressed genes in Example 3 of the present invention. AB: PPARG gene relative expression and FPKM value; CD: FABP4 gene relative expression and FPKM value; EF: DGAT1 gene relative expression and FPKM value; GH: MAP2 gene relative expression and FPKM value; IG: FYN gene relative expression and FPKM value; KL: WDHD1 gene relative expression and FPKM value; MN: PCLAF gene relative expression and FPKM value; *P≤0.1; **P≤0.01; ***P≤0.001; ****P≤0.0001. DETAILED DESCRIPTION

[0053] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the following examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The experimental methods for which specific conditions are not specified in the text are usually carried out under conventional conditions described in the Molecular Cloning Experiment Guide or under conditions recommended by the reagent manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art.

[0054] Main instruments: PCR instrument (Applied Biosystems, USA); DYY-6C electrophoresis power supply (Beijing Liuyi Biotechnology Co., Ltd.); agarose horizontal electrophoresis tank (Beijing Liuyi Biotechnology Co., Ltd.); small vertical electrophoresis system (BIO-RAD, USA); Trans-Blot SD semi-dry transfer instrument (BIO-RAD, USA); ChemiScope 6200 chemiluminescence imaging system (Shanghai Qinxiang Scientific Instrument Co., Ltd.); inverted fluorescence microscope (OLYMPUS); electric constant temperature incubator DNP-9162 (Shanghai Senxin Experimental Instrument Co., Ltd.); sterile test bench (Wujiang Xinglong Purification Equipment Factory); ultra-low temperature refrigerator (Midea); pipette (Eppendorf).

[0055] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0056] Example 1: Design and screening of sgRNA targeting bovine TARDBP gene

[0057] Using the online tool E-Crisp (www.e-crisp.org / E-CRISP / designcrispr.html), select Bos taurus UMD3.1 according to the prompt Select organism, select GeneSymbol for the input category and enter TARDBP, and other options are defaulted. Output multiple available sgRNAs. The purpose of the present invention is to knock out the TARDBP gene, so that the TDP-43 protein cannot be expressed, and then establish bovine mammary epithelial cells with knockout TARDBP gene, which is convenient for subsequent research on the function of bovine TARDBP gene. Therefore, among the many sgRNA sequences designed and generated, in addition to considering the high score rate, it is also necessary to comprehensively evaluate whether the knockout site can destroy the TDP-43 protein coding, determine whether its functional region can be knocked out, and evaluate the off-target risk. After screening with creative labor, the following two sgRNAs of the present invention are finally obtained, both of which target bovine TARDBP (NCBI, gene number: NC_037343ARS-UCD1.2, website:

[0058] The sgRNA oligonucleotide sequence of the second exon of the gene was obtained by sequencing the sgRNA oligonucleotide sequence of the second exon of the gene (https: / / www.ncbi.nlm.nih.gov / nuccore / NC_037343.1?report=genbank&from=42593898&to=42605452&strand=true).

[0059] The nucleotide sequence of sgRNA1 is: GAGATACCATCGGAAGACGA (SEQ ID NO.1); the nucleotide sequence of sgRNA2 is: GTCTTCCGATGGTATCTCAA (SEQ ID NO.2).

[0060] The designed sgRNA1 sequence is consistent with the positive strand of the TARDBP gene, while the sgRNA2 sequence is consistent with the antisense strand of the TARDBP gene (e.g. Figure 1 The complementary sequences of two sgRNAs were artificially designed, and BbsI restriction sites were added at both ends of the sequences to synthesize oligo sequences. The specific sequence information is shown in Table 1, where capital letters represent the designed sgRNA sequences and lowercase letters represent the BbsI restriction site sequences.

[0061] name sequence SEQ ID NO. sgRNA1-F caccGAGATACCATCGGAAGACGA 3 sgRNA1-R aaacTCGTCTTCCGATGGTATCTC 4 sgRNA2-F caccGTCTTCCGATGGTATCTCAA 5 sgRNA2-R aaacTTGAGATACCATCGGAAGAC 6

[0062] Example 2: Construction of CRISPR / Cas9 gene editing vector targeting TARDBP gene

[0063] 1. Annealing to form double-stranded DNA

[0064] Dilute the upstream and downstream oligo sequence powders to 10 μM. Pipette 5 μL of sgRNA1-F / R and sgRNA2-F / R into PCR tubes respectively, mix well by pipetting, and put the PCR tubes into a water bath preheated to 95°C. After 10 minutes of water bath, turn off the water bath. When the water bath temperature drops to room temperature, take out the PCR tubes and briefly centrifuge the liquid on the tube wall to the bottom of the tube to obtain double-stranded DNA, which are DNA fragments 1 and 2 respectively.

[0065] 2. Expression vector construction

[0066] Select the mammalian cell expression vector Genloci pGK1.1 (Puro r ) (Girui Biotechnology, GP0132), hereinafter referred to as pGK1.1, this vector contains the purine resistance gene (Puro r ), which is convenient for subsequent cell drug screening. After extracting the plasmid of the vector, the vector was cut with BbsI enzyme to form a linear vector with sticky ends, which was connected with the DNA fragments annealed in step 2 at 16°C overnight. The BbsI enzyme cutting system and the connection system are shown in Table 2 and Table 3, respectively.

[0067] The ligation product was transformed into Escherichia coli DH5α competent cells, single clones were picked and shaken, and after bacterial solution sequencing and identification, the positive bacterial solution plasmid (endotoxin-free) was extracted to obtain the CRISPR / Cas9 gene editing vectors pGK1.1-sgRNA1 and pGK1.1-sgRNA2 targeting the TARDBP gene.

[0068] Sequencing was performed to identify whether pGK1.1-sgRNA1 and pGK1.1-sgRNA2 were successfully constructed. The results are as follows Figure 2 As shown, sgRNA has been inserted into pGK1.1, proving that the sgRNA expression vector was successfully constructed.

[0069] Table 2 BbsI restriction enzyme system

[0070]

[0071]

[0072] Table 3 Connection system

[0073]

[0074] Example 3: Construction of bovine mammary epithelial cell TARDBP gene knockout cell line

[0075] 1. Liposome transfection of cells and drug screening

[0076] Cell culture and transfection:

[0077] Bovine mammary epithelial cell line MAC-T was cultured in a 37°C incubator with a CO2 concentration of 5% using DMEM / F12 culture medium (Invitrogen (Shanghai) Trading Co., Ltd., catalog number: A5669701) and 1% double antibody (Invitrogen (Shanghai) Trading Co., Ltd., catalog number: 15070063) in a 37°C incubator. The cells were plated in a 6-well culture plate one day before transfection. When the cell confluence reached about 80%, Invitrogen Lipofectamine TM The constructed gene editing vector pGK1.1-sgRNA was transfected into MAC-T cells using 3000 transfection reagent (Invitrogen (Shanghai) Trading Co., Ltd., Cat. No.: L3000015). The specific operation of cell transfection in each well is as follows:

[0078] Transfection solution preparation:

[0079] (1) Solution I: 125 μL opti-MEM (Invitrogen (Shanghai) Trading Co., Ltd., Catalog No.: 31985070) + 1 μL Lipofectamine 3000 (mix by gentle pipetting)

[0080] (2) Solution II: 125 μL opti-MEM + 2.5 μg pGK1.1 recombinant vector + 5 μL P3000 (mix by gentle pipetting)

[0081] (3) After solutions I and II were allowed to stand for 5 minutes, they were combined and mixed, and allowed to stand for 10 to 15 minutes. 250 μL of the suspension of solutions I and II was added dropwise to the normal culture medium of MAC-T cells cultured in a 6-well plate.

[0082] Cell drug screening:

[0083] 48 hours after transfection of bovine mammary epithelial cells, the medium was changed to normal culture medium for 24 hours, and then changed to drug screening medium with a concentration of 3 μg / mL purine (purine was added to normal culture medium). After drug screening for 120 hours (5 days), the medium was changed to normal culture medium for 24 to 48 hours depending on the cell state. After trypsin digestion of the cells and centrifugation and discarding the supernatant, 1 mL of normal culture medium was used to suspend the cells and mix them by pipetting to obtain a cell pool with targeted editing of the TARDBP gene.

[0084] About one-third of the cells were removed and genomic DNA was extracted (wild-type MAC-T cell genomic DNA was extracted as a control) to detect the effectiveness of pGK1.1-sgRNA vector knockout. The remaining cells were frozen and prepared for plating 96-well plates to screen monoclonal cells.

[0085] 2. Detection of the effectiveness of CRISPR / Cas9 knockout of TARDBP gene

[0086] Primer F and primer R were designed upstream and downstream of the target sequences of bovine TARDBP gene sgRNA1 and sgRNA2 (such as Figure 1 The primer sequences are shown in Table 4:

[0087] name sequence SEQ ID NO. F GCCTTTACTTTCTCGTTT 7 R CTTGGCATTAGTTCAGCA 8

[0088] Using the cell DNA obtained in step 1 as a template, PCR amplification was performed using primers F / R to obtain a PCR product.

[0089] The PCR product was obtained by PCR amplification using primers F / R with wild-type MAC-T cell DNA as template.

[0090] Amplification system: DNA template 50 ng, 2×GC Buffer I 12.5 μL, dNTP Mixture (2.5 mM each) 4 μL, LA Taq enzyme (Takara Bio, catalog number RR02BG) 0.25 μL, upstream and downstream primers (10 μmol / μL) 0.5 μL each, supplemented with ddH2O to 25 μL.

[0091] Amplification program: 95°C for 5 min; 94°C for 30 s, 50.4°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 10 min; 4°C for 10 min.

[0092] The PCR product was 651 bp in length. After detection by 1% agarose gel electrophoresis, a portion of the PCR product was sequenced.

[0093] According to the sequencing results, the effectiveness of the knockout of the pGK1.1-sgRNA vector was analyzed. If the knockout is effective, the PCR product sequencing peak graph will show overlapping peaks at the target sequence. The results are as follows Figure 3 As shown in the figure, it was found that the PCR product sequencing peaks of the cell pool DNA after transfection with pGK1.1-sgRNA1 and pGK1.1-sgRNA2 plasmids showed overlapping peaks at the corresponding sgRNA target sequences, while the PCR product of wild-type cell DNA had no overlapping peaks, indicating that the Cas9 nuclease cut the target gene under the guidance of sgRNA1 and sgRNA2, resulting in knockout or edited frameshift mutations in the target region. This shows that the gene editing vectors pGK1.1-sgRNA1 and pGK1.1-sgRNA2 are effective for TARDBP gene knockout.

[0094] The knockout efficiency of the remaining PCR products was calculated using the TA cloning sequencing method: the PCR products were purified by gel recovery and connected to the pMD19-T vector (Takara Bio, catalog number: 6013), the ligated products were transformed into Escherichia coli, different monoclonal bacteria were picked, shaken, sequenced, and the sequences were compared and analyzed to calculate the knockout efficiency, that is, the ratio of the number of mutant clones to the number of effective sequencing (the sum of the number of wild-type and mutant clones). According to statistical analysis, the knockout efficiency of sgRNA1 is about 52.6%, and the knockout efficiency of sgRNA2 is about 29.3%. However, there are documents in the prior art that in order to verify the gene editing efficiency of Dutch Stein cattle, sgRNA was transferred into MAC-T cells, and it was found that the editing efficiency was 13.8%. It can be seen that screening suitable sgRNA is crucial to obtaining target cells for gene editing (Lotti SN, Tasan I., Zhao H., Wheeler MB (2015) 239 MAC-T CELLS ASA TOOL TO EXAMINE GENOME EDITING USING CLUSTERED REGULARLY INTERSPACED SHORTPALINDROMIC REPEATS (CRISPR). Reproduction, Fertility and Development 28, 251-251.).

[0095] 3. Screening of TARDBP gene knockout monoclonal cells

[0096] After the pGK1.1-sgRNA plasmid drug screening was transfected in step 1, the cells were thawed and revived in normal culture medium for 24 hours. After trypsin digestion of the cells, centrifugation and discarding of the supernatant, the cells were resuspended, and the cells were counted, and a cell suspension of about 20 cells / 10mL of culture medium was prepared. The cell suspension was inoculated into a 96-well plate. After culturing for 1 week, the monoclonal cells with good cell growth in the 96-well plate were observed under a microscope, and the corresponding wells were marked. When the amount of cells in the 96-well plate reached more than 1 / 4 of the area of ​​the well, the monoclonal cells were transferred to the 24-well plate for expansion and culture. After the 24-well plate cells were full of cells, the cells were trypsinized, a small amount of cells were taken from each well to extract DNA, and the above primers F / R were used for PCR amplification, and sequencing was used to identify whether the monoclonal cells were TARDBP gene knockout cells. The amino acid sequence of the target gene of the positive cloned cells identified was analyzed. The remaining cells were inoculated in 6-well plates for expansion, and the identified positive cloned cells were frozen to complete the construction of the knockout cell line for subsequent TARDBP gene function studies.

[0097] like Figure 4As shown, six biallelic knockout monoclonal cells were screened and identified in MAC-T cells transfected with pGK1.1-sgRNA1 plasmid. Monoclonal clones 1-1, 1-2, and 1-3 inserted a C, A, and G base, respectively, and monoclonal clones 1-4, 1-5, and 1-6 deleted 10 bases, respectively, of which 1-4 and 1-5 had the same deleted base sequence;

[0098] like Figure 5 As shown, two biallelic knockout monoclonal cells were screened and identified in MAC-T cells transfected with pGK1.1-sgRNA2 plasmid. Monoclonal 2-1 had one A base inserted, and monoclonal 2-2 had two bases deleted. The TARDBP amino acid sequence of the biallelic knockout monoclonal cells was analyzed and compared with the normal TARDBP amino acid sequence.

[0099] like Figure 6 As shown, it was found that after inserting one base, the TARDBP amino acid sequences of monoclonal cells 1-1, 1-2, and 1-3 began to become disordered at the 23rd, 22nd, and 22nd amino acids, respectively, and the translation was terminated at the 81st amino acid; after deleting 10 bases, the TARDBP amino acid sequences of monoclonal cells 1-4, 1-5, and 1-6 began to become disordered at the 21st, 21st, and 20th amino acids, respectively, and the translation was terminated prematurely at the 48th amino acid.

[0100] Figure 7 As shown, it was found that after inserting one base, the TARDBP amino acid sequence of monoclonal cell 2-1 began to have coding errors at the 18th amino acid, and the translation was terminated prematurely at the 81st amino acid; after deleting two bases, the coding errors of monoclonal cell 2-2 began to occur at the 17th amino acid, and the translation was terminated prematurely at the 80th amino acid.

[0101] 4. Western blot detection of TARDBP protein expression in mammary epithelial cells after knockout

[0102] The knockout cells selected in this example are the MAC-T cell strain obtained by expanding the monoclonal clone 1-6 obtained in step 3.

[0103] MAC-T wild-type cells and the knockout cells were plated in 6-well plates using normal culture medium and cultured until the cell confluence reached more than 95%. Proteins were extracted and Western blot experiments were performed. The internal reference protein was Vinculin ( Figure 8 ), it can be seen that KO cell lines 1-6 did not express TARDBP protein, sgRNA-mediated targeted knockout of TARDBP was successful, and a usable cell line was obtained.

[0104] like Fig. 9As shown, wild-type MAC-T cells expressed TARDBP protein, while knockout cells did not express TARDBP protein, which proved that the bovine mammary epithelial cell model with TARDBP gene knockout was successfully constructed in the present invention. Fig. 9 This is a MAC-T cell line with TARDBP gene knocked out, and the cell growth is stable after passaging and freezing and thawing.

[0105] The method of the present invention is used to obtain for the first time a bovine TARDBP gene knocked-out mammary epithelial cell line, which is simple to operate and has precise and efficient knockout.

[0106] Since the MAC-T cell line has the ability to synthesize and secrete milk fat, after staining the MAC-T cells with Oil Red O, red lipid droplets can be observed in the cells, but the secretion amount is very small. Therefore, in this example, 2.5 μg / mL prolactin, 5 μg / mL insulin and 1 μg / mL hydrocortisone were added to the cell culture medium to increase the secretion of triglycerides in the cell line, and the triglyceride content in the cell culture medium was determined by the GPO-PAP enzymatic method. The results are shown in Figure 2. Fig.10 As shown, the secreted triglyceride content in the cell culture medium was significantly reduced (P≤0.01) after knocking out bovine TARDBP (knockout using sgRNA1) compared with the control group.

[0107] The WT cells in the control group and the KO cells in the experimental group (knocked out using sgRNA1) were collected for transcriptome sequencing to analyze the effect of knocking out the TARDBP gene on genes related to milk fat synthesis and secretion in bovine mammary epithelial cells.

[0108] The volcano plot can intuitively show the distribution of differentially expressed genes in the KO vs WT groups. Fig.11 As shown, there were 2385 differentially expressed genes in the KOvsWT group, including 729 up-regulated genes and 1656 down-regulated genes. Among the significantly down-regulated genes, the core transcription factor gene PPARG and the PPARG coactivator gene PPARGC1A that regulate milk fat synthesis and secretion, as well as milk fat synthesis-related genes CD36, FABP4 and DGAT1 were screened, but the BTN1A1 and XDH genes regulated by TARDBP protein binding reported in studies on mice were not screened. However, no genes related to milk fat synthesis and secretion were screened among the significantly up-regulated genes.

[0109] In order to reveal the biological functions of differentially expressed genes, clusterProfiler software was used to perform GO functional enrichment analysis on the differential gene set. GO (Gene Ontology) is a comprehensive database used to describe gene functions, including biological processes, cellular components, and molecular functions. GO enrichment analysis was performed on bovine mammary epithelial cells with TARDBP gene knockout. The padj value less than 0.05 was used as the threshold for significant enrichment, and the 30 most significant terms were selected for bar graph and scatter plot display. The results are shown in the figure below. Fig.12 and Fig.13 As shown in the figure, among the 30 most significant terms, there are 394 differentially expressed genes involved in biological process (BP), which are mainly enriched in immune response, regulation of multicellular biological process, hormone metabolism process, defense response, positive regulation of stimulus response, multicellular biological homeostasis, positive regulation of multicellular biological process and response to external stimulus; there are 263 differentially expressed genes involved in cellular component (CC), which are mainly enriched in extracellular region, extracellular matrix part, membrane raft, membrane microdomain, membrane region, apical part of the cell and apical plasma membrane; there are 209 differentially expressed genes involved in molecular function (MF), which are mainly enriched in signal receptor binding, receptor ligand activity, molecular function regulator, cytokine receptor binding and receptor regulation activity.

[0110] KEGG (Kyoto Encyclopedia of Genes and Genomes) is a comprehensive database that integrates genomic, chemical, and system functional information. The padj value less than 0.05 was used as the threshold for significant enrichment, and the 20 most significant KEGG pathways were selected for scatter plot display. The results are shown in the figure below. Fig.14 As shown in the figure, the 20 most significant KEGG pathways enriched were lipid and atherosclerosis, taste transduction, viral myocarditis, NF-kappa B signaling pathway, IL-17 signaling pathway, type I diabetes, complement and coagulation cascade, protein digestion and absorption, cytokine-cytokine receptor interaction, cell adhesion molecules and TNF signaling pathway. The differentially expressed genes involved in the lipid and atherosclerosis pathways included 44 genes, including PPARG, CD36, MMP9, ICAM1, MAP3K5, CXCL8, LYN, GRO1, CAMK2D, HCK, VAV2, CXCL3, and PLCB1. Among them, the differentially expressed genes PPARG and CD36 were related to milk fat synthesis.

[0111] After analyzing the differentially expressed genes in the transcriptome sequencing results, in order to ensure the accuracy of the transcriptome sequencing results, this study selected the down-regulated genes PPARG, FABP4, DGAT1, MAP2 and FYN; up-regulated genes WDHD1 and PCLAF. The selected 7 genes were verified by RT-qPCR technology. The results are as follows Fig.15 As shown in the results, the transcriptome sequencing results showed that the expression levels of PPARG, FABP4, DGAT1, MAP2 and FYN in the bovine mammary epithelial cells with TARDBP gene knockout were significantly lower than those in the wild-type bovine mammary epithelial cells in the control group (P≤0.01), while the expression levels of WDHD1 and PCLAF in the bovine mammary epithelial cells with TARDBP gene knockout were significantly higher than those in the wild-type bovine mammary epithelial cells in the control group (P≤0.01). After RT-qPCR verification, the expression changes of PPARG, FABP4, DGAT1, MAP2, FYN, WDHD1 and PCLAF genes were consistent with the transcriptome sequencing results, indicating that the transcriptome sequencing results were highly accurate.

[0112] In summary, knocking out the TARDBP gene in bovine mammary epithelial cells may reduce the mRNA levels of PPARG and PPARGC1A, which are bound by TARDBP, by affecting their mRNA splicing or stability, thereby leading to decreased expression of downstream milk fat synthesis-related genes and decreased cellular triglyceride synthesis capacity, ultimately significantly reducing the triglyceride content secreted into the culture medium by TARDBP knockout cells.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. sgRNA targeted knockout in cattle TARDBP Gene cell lines, or sgRNA expression vectors or CRISPR / Cas9 systems or kits or bovine mammary epithelial cells TARDBP Application of the method for constructing a gene knockout cell line in regulating triglyceride synthesis in bovine mammary epithelial cells, wherein the sgRNA includes sgRNA1 or sgRNA2; The nucleotide sequence of the sgRNA1 is as follows: GAGATACCATCGGAAGACGA (SEQ ID NO. 1); The nucleotide sequence of the sgRNA2 is as follows: GTCTTCCGATGGTATCTCAA (SEQ ID NO. 2); The sgRNA expression vector includes the DNA sequence of sgRNA1 or sgRNA2; The CRISPR / Cas9 system includes the sgRNA expression vector, a plasmid containing Cas9, or includes the sgRNA and exogenous cas9 protein; The kit includes the CRISPR / Cas9 system; Bovine mammary epithelial cells TARDBP The method for constructing a gene knockout cell line includes the following steps: The sgRNA1, sgRNA2 or the sgRNA expression vector or the CRISPR / Cas9 system is transferred into the host cell via liposomes, and then PCR identification and monoclonal culture are performed; positive clone cells are identified by PCR and sequencing to complete the construction of the knockout cell line.

2. The use according to claim 1, characterized in that The method for constructing the sgRNA expression vector comprises: annealing a primer containing sgRNA1 to obtain a double-stranded DNA fragment 1, and connecting the DNA fragment 1 to an expression plasmid using a DNA ligase.

3. The use according to claim 1, characterized in that: The method for constructing the sgRNA expression vector comprises: annealing a primer containing sgRNA2 to obtain a double-stranded DNA fragment 2, and connecting the DNA fragment 2 to an expression plasmid using a DNA ligase.

4. The use according to claim 2 or 3, characterized in that: The expression plasmid is Genloci pGK1.

1.

5. The use according to any one of claims 2 to 4, characterized in that: The primers for sgRNA included, sgRNA1-F: caccGAGATACCATCGGAAGACGA (SEQ ID NO. 3); sgRNA1-R: aaacTCGTCTTCCGATGGTATCTC (SEQ ID NO.4); sgRNA2-F:caccGTCTTCCGATGGTATCTCAA (SEQ ID NO.5); sgRNA2-R: aaacTTGAGATACCATCGGAAGAC (SEQ ID NO. 6).

6. The use according to claim 1, characterized in that: The host cell is a MAC-T cell.

7. The use according to claim 1, characterized in that: The primers used for the PCR identification are: F: GCCTTTACTTTCTCGTTT (SEQ ID NO.7); R: CTTGGCATTAGTTCAGCA (SEQ ID NO. 8).

Images