A circRNA, a detection primer thereof, an application and a detection kit thereof

Abstract

The application discloses a kind of circRNA and its detection primer, application and detection kit.One kind of circRNA, linear nucleotide sequence is circularized and formed by SEQ ID NO:1.It provides a primer pair for detecting the above-mentioned circRNA for the target, and the nucleic acid sequence of primer pair is as shown in SEQ ID NO:2-5.The application of the above-mentioned primer pair in detecting the development condition of mother pigeon follicle includes the following steps: extracting total RNA in mother pigeon tissue;Total RNA reverse transcription obtains cDNA;Using the above-mentioned primer pair for PCR reaction with cDNA as template;According to the expression amount of the circRNA in mother pigeon tissue obtained from PCR reaction result.The application provides a detection kit based on the above-mentioned detection method.The quantitative primer in related detection reagent provided by the application is specific, and the expression level of the above-mentioned circRNA can be clearly reflected.

Description

Technical Field

[0001] The present invention relates to a method for detecting the reproductive performance of a female pigeon, and in particular to a circRNA and a detection primer, application and detection kit thereof. Background Art

[0002] Due to the unique reproductive characteristics of pigeons, with an egg-laying cycle of approximately 8-12 days, paired pigeons only produce two eggs during each cycle, resulting in a shortage of pigeon egg production. Therefore, there is an urgent need to improve fertility to meet consumer demand. This can be achieved by understanding the molecular mechanisms of pigeon follicle development.

[0003] Granulosa cells are the most numerous, most important, and most functional cells within the follicle of a poultry ovarian follicle. Their proliferation and apoptosis dominate follicular development. Under the influence of FSH, granulosa cells rapidly proliferate and differentiate into the dominant follicle stage. Apoptosis of granulosa cells located on the inner surface of the granulosa layer leads to follicular atresia. Granulosa cells are responsible for the production of mature oocytes and ovulation, as well as for the secretion of estradiol, insulin-like growth factor, and progesterone to maintain endocrine balance. These are key regulators of follicular development. Without these growth-promoting factors, granulosa cells lose their regulatory function and may even undergo apoptosis. Therefore, granulosa cell differentiation plays a crucial role in pigeon follicle selection.

[0004] Circular RNA (circRNA) is a class of endogenous noncoding RNA, distinct from linear RNA. When pre-mRNA is covalently spliced ​​into it through backsplicing, it forms a closed loop. CircRNAs were first discovered in plant viruses and are broadly categorized by their origin into circRNAs formed from intronic sequences (ciRNA), circRNAs formed from exonic sequences (ecircRNA), and circRNAs formed from both intronic and exonic sequences. With the advancement of high-throughput sequencing (RNA-Seq) technology and bioinformatics, a large number of circRNAs have been identified in diverse organisms, tissues, and cells. Numerous studies have demonstrated that circRNAs possess unique biological structures, and their location determines their diverse regulatory functions, playing a crucial role in cell differentiation, development, and reproduction. Currently, little research has been conducted on circRNAs in the context of hen pigeon reproduction, particularly in the mechanisms of follicle development. Therefore, identifying circRNAs that influence hen pigeon reproductive performance has become a new focus of research in hen pigeon reproduction and genetic breeding, as well as in ovarian function. Summary of the Invention

[0005] Objectives of the invention: The objective of the present invention is to provide a circRNA to address the problem of how to obtain a target for detecting the reproductive performance of female pigeons. Another objective of the present invention is to provide a primer pair for detecting the circRNA, thereby addressing the problem of how to obtain primers that can be used to detect circRNA. A third objective of the present invention is to provide the use of the primer pair in detecting the development of female pigeon follicles, thereby addressing the problem of how to identify the development of female pigeon follicles. A fourth objective of the present invention is to provide a detection kit to address the problem of how to conveniently detect circRNA.

[0006] Technical solution: The circRNA described in the present invention is formed by cyclizing the linear nucleotide sequence shown in SEQ ID NO: 1.

[0007] In a second aspect, the present invention provides a primer pair for detecting the circRNA target site, wherein the nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO: 3;

[0008] Or the nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 4, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO: 5.

[0009] The present invention first identified the circularization site (backward splicing site) of the circRNA (circFBXW11) and designed the primer pairs targeting this site. SEQ ID NOs: 2 and 3 are the reverse primer pairs designed to flank the circularization site, while SEQ ID NOs: 4 and 5 are the reverse primer pairs designed to target the linear nucleic acid sequence between the circularization sites. Both primer pairs successfully amplified the target band of circFBXW11 through PCR.

[0010] A third aspect of the present invention provides an application of the above primer pair in detecting the development of follicles in a female pigeon.

[0011] The specific method of the above application includes the following steps:

[0012] (1) Extracting total RNA from hen pigeon tissues;

[0013] (2) Reverse transcription of total RNA to obtain cDNA;

[0014] (3) using the cDNA as a template and performing a PCR reaction using the primer pair described in claim 2;

[0015] (4) The expression level of the circRNA in the mother pigeon tissue was obtained based on the PCR reaction results. The expression level of the circRNA was positively correlated with the development or maturation process of the follicle.

[0016] Preferably, in step (1), the mother pigeon tissue includes at least one of the diencephalon, pituitary gland, ovary, theca cells, granulosa cells, telencephalon, medulla oblongata, cerebellum, cerebrum, and pineal gland.

[0017] Preferably, in step (3), the PCR reaction is a qRT-PCR or a conventional PCR reaction.

[0018] Preferably, the qRT-PCR reaction system is 5 μL 2×FastReal qPCR PreMix, 0.6 μL upstream primer at a concentration of 10 μM, 0.6 μL downstream primer at a concentration of 10 μM, 400 ng cDNA template, and ddH2O to 20 μL; the conventional PCR reaction system is: 1 μL cDNA template, 0.5 μL upstream primer at a concentration of 10 μM, 0.5 μL downstream primer at a concentration of 10 μM, 5 μL 2×Rapid Taq Master Mix, and ddH2O to 10 μL.

[0019] Preferably, the reaction conditions of the qRT-PCR are pre-denaturation at 95°C for 2 minutes; denaturation at 95°C for 5 seconds; annealing at 60°C for 10 seconds; and extension at 72°C for 15 seconds, for 40 cycles;

[0020] The conventional PCR reaction conditions are as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 55°C for 15 seconds; extension at 72°C for 5 seconds for 35 cycles; and complete extension at 72°C for 5 minutes.

[0021] Preferably, in step (3), the internal reference of the PCR reaction is GAPDH, the upstream primer sequence of GAPDH is shown as SEQ ID NO: 6, and the downstream primer sequence is shown as SEQ ID NO: 7.

[0022] The present invention provides a detection kit based on the above detection method, comprising the above primer pair, an internal reference primer pair and a PCR reaction reagent.

[0023] The present invention uses the GAPDH gene as an internal reference gene (its primer sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7). Other common internal reference genes, such as β-actin, can also be used.

[0024] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: the circRNA provided by the present invention has a stable structure and a high correlation with pigeon follicular granulosa cells, which can serve as a direct indicator or one of the criteria for identifying follicular development. This circRNA can be used as a molecular marker for screening the reproductive performance of female pigeons during molecular breeding, and can also serve as a target for artificial intervention in follicular development or atresia. The quantitative primers in the relevant detection reagents provided by the present invention are highly specific and can clearly reflect the expression level of this circRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the design principle of circFBXW11 Divergent / Convergent primers;

[0026] Figure 2 This is the sequencing map of the circFBXW11 reverse splicing site;

[0027] Figure 3 The results of amplification of gDNA and cDNA of follicular granulosa cell tissue using Divergent / Convergent primers were used with GAPDH as the control;

[0028] Figure 4 This is the result of identifying the resistance of circFBXW11 to RNase R;

[0029] Figure 5 To detect the relative expression of circFBXW11 in granulosa cells of pigeon follicles at stages LI3 and LI7 using qRT-PCR;

[0030] Figure 6 The qRT-PCR method was used to detect the relative expression level of circFBXW11 in the brain and heart-related tissues of female pigeons. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] Example 1: A circRNA formed by cyclization of the linear nucleotide sequence shown in SEQ ID NO: 1. SEQ ID NO: 1 is the linear nucleotide sequence of female pigeon circFBXW11, and the sequence is as follows:

[0033] aacacgtcagtaatggaggatcagaatgaagatgagtctccaaagaaaaataccctatggcagataagtaatggaacttcatct

[0034] gtgattgtctcaagaaaaagaccatcggaaggaaattacgaaaaagaaaaagacttgtgtattaaatattttgaccagtggtctgaatcag

[0035] atcaagttgaatttgtggaacaccttatttcacgaatgtgtcactatcagcatggacatattaactcttacttgaagcccatgttacaacggg

[0036] acttcatcactgcgttaccagagcaaggcttagatcacatagcagaaaacatcctttcctatctggacgccaggtcgctctgcgcagcag

[0037] agctggtgtgcaaggagtggcagagagtcatctcggaggggatgctctggaaaaagctgattgagaggatggtacgcacagatccg

[0038] ctctggaaggggctgtcggagagaaggggttgggatcagtacctgtttaaaaacagaccaacagacggccccccaaattcattttaca

[0039] ggtccttatacccaaagataatacaggatatagagactatagaatccaactggcgatgtggacgacacaacttgcaaaggatccagtgc

[0040] cgctccgaaaacagcaaaggtgtctactgtttacagtacgatgatgaaaagattatcagtggcctacgagataactccatcaagatttgg

[0041] gacaagacaagcttggaatgtttgaaggtattaacaggacatactggctcggttctttgtctgcagtacgacgagagggtcatcgtaact

[0042] ggatcttcagattctacagtgagagtttgggatgtaaatacgggtgaagttctgaacacgttgattcaccacaacgaggcagtgcttcattt

[0043] gaggttcagtaacggcttaatggtgacgtgctccaaggacagatcgatcgctgtttgggacatggcgtcgcccaccgacatcaccctg

[0044] cgccgtgtcttggttggccatcgtgctgccgtcaacgtagtcgacttcgatgacaagtatattgtgtcagcgtcaggtgacaggaccatta

[0045] aagtctggagtacaagtacgtgcgagttcgttcgtactctgaatgggcacaagcgcggcatcgcgtgcctgcagtaccgggaccggct

[0046] cgtcgtcagtgggtcttccgacaacaccattcggctatgggacattgaatgcggtgcctgtttaagagtactagaaggccacgaagaac

[0047] tggttcggtgcatcaggttcgacaataagaggattgttagtggagcctatgatggcaaaattaaagtttgggacttgcaagctgctcttga

[0048] ccctcgtgccccagcaagtacattatgcttgcgtacattagtggaacattcaggacgtgtcttcaggctccagtttgatgagtttcagatca

[0049] ttagtagttcccacgacgatacaattctgatttgggatttcttaaacgtgccacccagtgcccagaacgagacccgctctccatctagaac

[0050] atacacatacatctccagataacagtctgcactttcctaccctcggaag

[0051] Its ring structure and cyclization site are as follows Figure 1 and Figure 2 shown.

[0052] The experimental method for verifying the circular structure of pigeon circFBXW11 is as follows:

[0053] (1) Design of pigeon circFBXW11 primers

[0054] Based on the Sanger DNA sequencing results, a Divergent primer pair was designed at both ends of the circular linker position of circFBXW11. The sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO: 3. SEQ ID NO: 2 is the upstream primer sequence of the primer pair that specifically amplifies the circularization site of circFBXW11, and SEQ ID NO: 3 is the downstream primer sequence of the primer pair that specifically amplifies the circularization site of circFBXW11.

[0055] The remaining linear nucleotide sequence was used to design primers according to conventional methods, namely, the Convergent primers for circFBXW11. The primer sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5. SEQ ID NO: 4 is the upstream primer sequence of the primer pair that specifically amplifies FBXW11 mRNA; SEQ ID NO: 5 is the downstream primer sequence of the primer pair that specifically amplifies FBXW11 mRNA.

[0056] The present invention uses the GAPDH gene as an internal reference gene, and the upstream primer sequence for specifically amplifying GAPDH is shown in SEQ ID NO: 6, and the downstream primer sequence for specifically amplifying GAPDH is shown in SEQ ID NO: 7;

[0057] Primer name Sequence (5'-3') SEQ ID NO: 2 ttcttaaacgtgccacccagt SEQ ID NO: 3 cgtaatttccttccgatggtct SEQ ID NO: 4 gccgctccgaaaacagcaa SEQ ID NO: 5 tttcgtaatttccttccgatggt SEQ ID NO: 6 ctctactcatggccacttccg SEQ ID NO: 7 acaacgtattcagcaccagc

[0058] (2) RNA extraction from pigeon granulosa cells (conventional TRIZOL method)

[0059] After venous exsanguination, the follicles were carefully excised using sterile forceps and placed in PBS. Using a sterile blade, the follicles were quickly dissected and inverted in a Petri dish containing PBS. The yolk was rinsed and the composite membrane separated from the yolk. After the yolk was released, the composite membrane was placed in sterile PBS and shaken to allow the granulosa cell layer to separate and settle. The precipitate was collected as the granulosa cell layer tissue.

[0060] A soybean-sized sample was placed in a test tube. 800 μL of TRIZOL reagent (purchased from Vazyme Nanjing Co., Ltd.) was added to each pellet of cell tissue. Homogenize the sample 2-3 times using a homogenizer until no obvious particles were present. The sample was then incubated at room temperature for 5 minutes to completely separate the nucleic acid-protein complex. The homogenized sample was transferred to a 1.5 ml centrifuge tube (RNase-free), 160 μL of chloroform was added, and the tube was shaken vigorously for 15 seconds, two to three times, and then incubated at room temperature for 5 minutes. Centrifuge at 4°C, 12,000 × g for 15 minutes. After centrifugation, the solution separated into three layers, with RNA mainly in the top aqueous phase. 160 μL of the supernatant was transferred to a 1.5 ml centrifuge tube, 400 μL of pre-chilled isopropanol was added, and the mixture was mixed by inversion. The tube was then placed on ice for 10 minutes. The tube was then centrifuged at 4°C, 12,000 × g for 10 minutes, and the supernatant was discarded after cutting the tube in reverse. Add 400 μL of 75% pre-chilled ethanol, vortex to mix, centrifuge at 1000 × g at 4°C for 5 minutes, discard the supernatant, and repeat the above process once. Dry the RNA at room temperature for 10-20 minutes, add 20 μL of ddH2O, mix, and incubate at 4°C overnight to dissolve. Measure the concentration and purity of 1 μL of the RNA using a Thermo NANO Drop 2000 UV spectrophotometer. Store qualified RNA at -80°C for subsequent experiments.

[0061] (3) RNase R treatment experiment

[0062] RNA extracted from granulosa cell tissue samples was divided into two equal aliquots. One aliquot was directly reverse transcribed, while the other was treated with RNase R (purchased from Guangzhou Gisai Biotechnology Co., Ltd.) before reverse transcription. A 20 μL reaction system contained 5 μg of RNA, 2 μL of 10× reaction buffer, 15 U of RNase R (20 U / μL), and RNase-free water. The reaction was performed at 37°C for 30 minutes, followed by an inactivation reaction at 70°C for 10 minutes.

[0063] (4) RNA reverse transcription

[0064] RNA reverse transcription was performed according to the instructions in the TIANGEN reverse transcription kit (KR118). The specific steps are as follows: (41) Reverse transcription system configuration: 400 μg RNA, 4 μL 5×FastKing-RT SuperMix, RNase-free-ddH2O to 16 μL, and mix well. (42) Reverse transcription procedure: 42°C for 15 min to remove genomic DNA and reverse transcription reaction, and 95°C for 3 min to inactivate the enzyme.

[0065] (5) Extraction of whole genome DNA from pigeon granulosa cells

[0066] Processing materials: Take a soybean-sized sample and add PBS to crush it into a cell suspension

[0067] (6) PCR amplification and Sanger sequencing

[0068] PCR amplification system: 1 μL template, 0.5 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 2, SEQ ID NO: 3), 5 μL 2× Rapid Taq Master Mix (purchased from Vazyme Nanjing Co., Ltd.), and ddH2O to 10 μL. The reaction program was as follows: initial denaturation at 95°C for 3 min; 35 cycles (denaturation at 95°C for 15 s; annealing at 55°C for 15 s; extension at 72°C for 5 s); and complete extension at 72°C for 5 min. Products were electrophoresed on a 1.5% agarose gel containing Grad dye. PCR products were sent to Shanghai Bioengineering for Sanger sequencing and verification.

[0069] (7) qRT-PCR

[0070] qRT-PCR reaction system: 5 μL of 2× FastReal qPCR PreMix (SYBR Green) (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), 0.6 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, SEQ ID NO: 7), 400 ng of cDNA, and ddH2O to 20 μL. Reaction procedure: 95°C pre-denaturation for 2 min; 40 cycles (95°C denaturation for 5 s; 60°C annealing for 10 s; 72°C extension for 15 s). Biological and technical replicates were performed in triplicate, using 2 -△△Ct The relative gene expression was calculated using the △△Ct = (Ct target gene - Ct internal reference) - (Ct target gene - Ct internal reference) maximum. Untreated GAPDH was used as the internal reference. Significance analysis was performed using an independent-sample T-test. P < 0.05 indicated a significant difference, and P < 0.01 indicated an extremely significant difference.

[0071] The experimental results are as follows:

[0072] like Figure 1 、 2 As shown, circFBXW11 was amplified using specific primers spanning the reverse splicing site, and its circularization site was determined by Sanger sequencing (the arrow indicates the circularization site). The circular structure of circFBXW11 was confirmed.

[0073] GAPDH as a control, using Divergent / Convergent primer pairs (SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, SEQ ID NO: 7) to amplify the pigeon follicular granulosa cell cDNA and genomic gDNA as templates, the results are shown in Figure 3 . Figure 3 Lane M is DL 500 DNA Marker; cDNA and gDNA lanes are cDNA and gDNA of follicular granulosa cell tissue after RNase R digestion; GAPDH Convergent primer product is 138 bp; circFBXW11 Divergent Primer product is 226 bp; circFBXW11 Convergent Primer product is 232 bp; cDNA group has bands for both Divergent / Convergent primers, while gDNA group only has bands for Convergent primer, indicating that this circRNA exists objectively.

[0074] Figure 4 Figure 1A shows the electrophoretogram of FBXW11 mRNA and circFBXW11 PCR products of follicular granulosa cell tissue from left to right. Among them, the FBXW11 product is 232 bp, and the circFBXW11 product is 226 bp. Lane M is DL 500 DNA Marker; RNase R+ lane is cDNA of follicular granulosa cell tissue after RNase R digestion, and RNase R- lane is cDNA of follicular granulosa cell tissue without RNase R digestion; circFBXW11 Divergent Primer product is 226 bp; circFBXW11 Convergent Primer product is 232 bp. As shown in Figure 4 Figure 1A, total RNA was electrophoresed after RNase R enzyme digestion, and PCR detection of FBXW11 mRNA showed weak bands in the RNase R(+) group; while circFBXW11 had bands in both RNase R(-) and RNase R(+) groups, indicating that circFBXW11 is relatively stable in structure and resistant to digestion.

[0075] Figure 4 Figure 1B shows the results of detecting the resistance of circFBXW11 to RNase R enzyme by qRT-PCR method.

[0076] As shown in Figure 4As shown in Figure B, FBXW11 mRNA was amplified using GAPDH as an internal reference gene. A primer pair specifically amplifying the circularization site of circFBXW11 and a primer pair specifically amplifying FBXW11 mRNA were used, respectively. Total RNA from hen pigeon granulosa cells before and after RNase R digestion was used as a template. qRT-PCR analysis revealed a highly significant decrease in the amount of linear FBXW11 mRNA after RNase R digestion (P < 0.05), while the amount of circFBXW11 remained unchanged. This indicates that the structure of circFBXW11 is relatively stable and resistant to RNase R digestion, consistent with the principle that RNase R digestion enriches circRNAs. This further confirms the circular structure and stability of circFBXW11.

[0077] Example 2: The differential expression identification method of circFBXW11 in granulosa cells of pigeons during the egg-laying interval is as follows:

[0078] (1) Design of pigeon FBXW11 mRNA primers: Same as step (1) in Example 1.

[0079] (2) RNA extraction from pigeon granulosa cell tissue (conventional TRIZOL method).

[0080] Pigeon granulosa cells were isolated, and the RNA extraction method was the same as step (2) in Example 1, and the reverse transcription method was the same as step (4) in Example 1.

[0081] (3) qRT-PCR analysis of circFBXW11 expression in pigeon granulosa cells during the egg-laying interval.

[0082] qRT-PCR was performed using cDNA of pigeon granulosa cells on the third day (LI3) and the seventh day (LI7) of the egg-laying interval as templates and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 6, SEQ ID NO: 7 as primers. The reaction system and analysis method were the same as step (7) in Example 1.

[0083] The experimental results are as follows Figure 5 As shown in the figure, qRT-PCR was used to detect the relative expression levels of circFBXW11 in granulosa cells of pigeons on the third day (LI3) and the seventh day (LI7) of the egg-laying interval, using GAPDH as the internal reference gene. The results showed that the expression level of circFBXW11 in granulosa cells of pigeons on the third day (LI3) and the seventh day (LI7) of the egg-laying interval was significantly higher than that on the LI3 day (P<0.05).

[0084] Example 3: The differential expression identification method of circFBXW11 in different tissues of pigeons during the egg-laying interval is as follows:

[0085] The specific steps are as shown in steps (2), (4) and (7) of Example 1. In this example, qRT-PCR was performed using cDNA from each hen pigeon tissue as a template and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 6, SEQ ID NO: 7 as primers;

[0086] The tissues of female pigeons include the diencephalon, pituitary gland, ovary, theca cells, granulosa cells, telencephalon, medulla oblongata, cerebellum, cerebrum, and pineal gland.

[0087] The experimental results are as follows Figure 6 As shown, using GAPDH as an internal reference gene, qRT-PCR detected the expression of circFBXW11 in various tissues of hen pigeons, with higher expression in gonadal axis-related tissues, namely the diencephalon, pituitary gland, ovary, granulosa cells, and theca cells, suggesting that circFBXW11 may be involved in follicular development or maturation. Therefore, this target has the potential to serve as a molecular marker related to hen pigeon reproduction, providing a theoretical basis for evaluating reproductive performance, improving fertility, supplementing knowledge of pigeon follicle-related reproductive physiology, and proposing a new breakthrough direction for addressing current reproductive bottlenecks in the pigeon industry.

Claims

1. A circRNA, characterized in that It is formed by circularizing the linear nucleotide sequence shown in SEQ ID NO:

1.

2. A primer pair for detecting the circRNA according to claim 1, characterized in that: The nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO: 3; Or the nucleic acid sequence of the upstream primer is shown in SEQ ID NO: 4, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO:

5.

3. according to the application of primer pair in detecting female pigeon follicle development situation described in claim 2.

4. The use according to claim 3, characterized in that The steps include: (1) extracting total RNA from hen pigeon tissue, wherein the hen pigeon tissue is follicular granulosa cells; (2) Reverse transcription of total RNA to obtain cDNA; (3) using the cDNA as a template and the primer pair described in claim 2 to perform a PCR reaction; (4) The expression level of the circRNA in the mother pigeon tissue was obtained based on the PCR reaction results. The expression level of the circRNA was positively correlated with the development or maturation process of the follicle.

5. The use according to claim 4, characterized in that In step (3), the PCR reaction is qRT-PCR.

6. The use according to claim 5, characterized in that The qRT-PCR reaction system was 5 μL 2×FastReal qPCR PreMix, 0.6 μL 10 μM upstream primer, 0.6 μL 10 μM downstream primer, 400 ng cDNA template, and ddH 2 O added to 20 μL.

7. The use according to claim 5, characterized in that The reaction conditions of the qRT-PCR were as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s; annealing at 60°C for 10 s; and extension at 72°C for 15 s, repeated 40 times.

8. The use according to claim 4, characterized in that In step (3), the internal reference of the PCR reaction is GAPDH, the upstream primer sequence of GAPDH is shown in SEQ ID NO: 6, and the downstream primer sequence is shown in SEQ ID NO:

7.

9. A detection kit, characterized in that: The method comprises the primer pair, internal reference primer pair and PCR reaction reagents described in claim 2.

Images