Application of P450 Genes of Red Fire Ants

Abstract

The present invention provides the application of the red imported fire ant P450 gene, which is CYP6AS161 or CYP6AQ83, and the nucleotide sequences thereof are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. The present invention discovers the P450 genes CYP6AS161 and CYP6AQ83 involved in the detoxification metabolism of the red imported fire ant to pesticides, and uses the gene interference method to synthesize double-stranded RNA to knockdown the CYP6AS161 and CYP6AQ83 genes, thereby respectively improving the sensitivity of the worker ants and queens of the red imported fire ant to flonicamid. The present invention provides a new perspective for deeply understanding the resistance mechanism of the red imported fire ant to pesticides.

Description

Technical Field

[0001] The present invention relates to the technical field of biological genetic engineering, and specifically relates to the application of the Solenopsis invicta P450 gene. Background Art

[0002] The red imported fire ant Solenopsis invicta (Buren) belongs to the family Formicidae of the order Hymenoptera and is native to South America. In the 1920s, the red imported fire ant first appeared in the United States and has since spread rapidly around the world with the continuous development of global trade. It has now spread to many southern provinces of China. The red imported fire ant often builds its nest on the ground surface. When the ant nest is touched, a large number of worker ants and soldier ants will pour out of the nest to attack nearby organisms, seriously affecting local agricultural production and farming activities. In addition, the red imported fire ant is highly aggressive and will actively attack other organisms near the ant nest, causing great damage to the ecological environment of the invaded area. Chemical insecticides are the most effective measures for controlling the red imported fire ant, but the long-term use of chemicals can lead to unexpected rebounds and increase the drug resistance of the red imported fire ant population.

[0003] A large number of studies have shown that insects develop resistance to exogenous chemicals through detoxification metabolic enzymes in their bodies, including cytochrome P450 monooxygenase (P450), glutathione S-transferase (GST), and carboxylesterase (CarE). As a phase I detoxification metabolic enzyme, the P450 enzyme changes the structure of exogenous chemicals through catalytic oxidation reactions, including oxidation, hydroxylation, and deamination, to weaken their insecticidal activity against insects and plays a key role in the detoxification metabolism process of the red imported fire ant. The non-specificity of the P450 enzyme to exogenous substances leads to the development of insecticide resistance in insects.

[0004] A large number of studies have shown that members of the CYP4, CYP6, and CYP9 subfamilies play a key role in the process of insects metabolizing exogenous substances (Liu et al., 2015; Zhang et al., 2020; Manjon et al., 2018). Another characteristic of certain insect P450 genes is that their expression can be induced by both exogenous and endogenous compounds (Nauen et al., 2022). Siddiqui et al. (2022) found that the sensitivities of red imported fire ants from different regions to indoxacarb are different. Through transcriptomic data analysis, it was shown that the tolerance of red imported fire ants to indoxacarb is the result of the combined transcriptional regulation of multiple detoxification genes.

[0005] However, in Solenopsis invicta, the research on the mechanism of resistance mediated by detoxification metabolism genes is not deep enough. Therefore, it is necessary to identify the detoxification metabolism genes involved in the formation of resistance in Solenopsis invicta, study their detoxification metabolism mechanisms, and provide a theoretical basis for formulating scientific prevention and control strategies and rationally selecting highly effective insecticides to eliminate Solenopsis invicta. Summary of the Invention

[0006] In view of this, in response to the current situation that the invasive Solenopsis invicta has developed resistance to insecticides and is difficult to effectively control, the present invention further provides the application of Solenopsis invicta P450 genes. By identifying the P450 genes CYP6AS161 and CYP6AQ83 involved in the detoxification metabolism of insecticides in Solenopsis invicta and using gene interference to synthesize double-stranded RNA to knockdown the CYP6AS161 and CYP6AQ83 genes, the sensitivity of Solenopsis invicta workers and queens to flonicamid is increased respectively. The present invention provides a new perspective for in-depth understanding of the mechanism of resistance of Solenopsis invicta to insecticides.

[0007] To achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0008] In the first aspect, the present invention provides a Solenopsis invicta P450 gene, which is CYP6AS161 or CYP6AQ83 , and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0009] In the second aspect, the present invention provides dsRNA for knockdown of the expression of the Solenopsis invicta P450 gene, the dsRNA for knockdown of the expression of CYP6AS161 gene and the dsRNA for knockdown of the expression of CYP6AQ83 gene, and their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0010] In the third aspect, the present invention provides a preparation method of the dsRNA described in the second aspect, including the following steps:

[0011] Step 1, extract the total RNA of Solenopsis invicta and reverse transcribe it into cDNA;

[0012] Step 2, using the cDNA as a template, perform gene cloning to obtain CYP6AS161 gene fragment and CYP6AQ83 gene fragment;

[0013] Step 3, ligate the CYP6AS161 gene fragment and CYP6AQ83 gene fragment to the vector respectively, and transform through competent cells to obtain CYP6AS161 gene plasmid and CYP6AQ83 gene plasmid;

[0014] Step 4, usingCYP6AS161 The gene plasmid and CYP6AQ83 Using the full-length sequence of the gene plasmid as a template, PCR amplification was carried out, and the amplified product was purified to obtain the dsRNA.

[0015] Preferably, in step 2, the primers used for gene cloning are: CYP6AS161 The corresponding primer sequences are shown as SEQ ID NO:11 and SEQ ID NO:12 respectively; CYP6AQ83 The corresponding primer sequences are shown as SEQ ID NO:13 and SEQ ID NO:14 respectively; and / or,

[0016] In step 3, the vector is pEASY - Blunt; and / or,

[0017] In step 4, the primers used for PCR amplification are: CYP6AS161 The corresponding primer sequences are shown as SEQ IDNO:15 and SEQ ID NO:16 respectively; CYP6AQ83 The corresponding primer sequences are shown as SEQ ID NO:17 and SEQ ID NO:18 respectively.

[0018] Fourthly, the present invention provides the application of the Solenopsis invicta P450 gene described in the first aspect and / or the dsRNA described in the second aspect in the preparation of a kit for controlling Solenopsis invicta.

[0019] Fifthly, the present invention provides the application of the Solenopsis invicta P450 gene described in the first aspect and / or the dsRNA described in the second aspect in reducing the insecticide resistance of Solenopsis invicta.

[0020] Sixthly, the present invention provides a kit for controlling Solenopsis invicta, comprising: the Solenopsis invicta P450 gene described in the first aspect and / or the dsRNA described in the second aspect.

[0021] Preferably, the kit further comprises: an insecticide; preferably, the insecticide is selected from at least one of flonicamid, fipronil, and chlorpyrifos, and preferably flonicamid.

[0022] Seventhly, the present invention provides a method for controlling Solenopsis invicta, feeding Solenopsis invicta with the dsRNA described in the second aspect, and then applying an insecticide; preferably, the insecticide is selected from at least one of flonicamid, fipronil, and chlorpyrifos, and more preferably flonicamid.

[0023] Preferably, the dsRNA for knocking down CYP6AS161 gene expression is used for worker ants; the dsRNA for knocking down CYP6AQ83 gene expression is used for queen ants.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] The present invention discovers P450 genes CYP6AS161 and CYP6AQ83 involved in the detoxification and metabolism of insecticides in Solenopsis invicta, and uses gene interference means to synthesize double-stranded RNA to knockdown CYP6AS161 and CYP6AQ83 genes, which can respectively improve the sensitivity of Solenopsis invicta workers and queens to flonicamid. The present invention provides a new perspective for in-depth understanding of the insecticide resistance mechanism of Solenopsis invicta. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0027] Figure 1 is the transcriptome analysis of flonicamid-induced workers and queens in Example 1 of the present invention. Among them, Figure A is the correlation clustering heat map between different samples; red: positive correlation, green: negative correlation; Figure B is the principal component analysis diagram.

[0028] Figure 2 is the differential expression gene analysis of flonicamid-induced workers and queens in Example 1 of the present invention. Among them, Figures A-C are volcano plots of the distribution of differentially expressed genes; red: up-regulated, blue: down-regulated, gray: not significant; Figure D is the clustering heat map of differentially expressed genes; red: positive correlation, green: negative correlation.

[0029] Figure 3 is the relative expression level diagram of CYP4AA1, CYP336A65, CYP4BW9, and CYP6AS161 in workers treated with flonicamid verified by RT-qPCR in Example 2 of the present invention.

[0030] Figure 4 is the relative expression level diagram of CYP6AQ83 in queens treated with flonicamid verified by RT-qPCR in Example 3 of the present invention.

[0031] Figure 5 is the interference efficiency of RNA interference on CYP336A66 (Figure A), CYP18A1 (Figure B), CYP302A1 (Figure C) and CYP6AQ83 (Figure D) in Example 4 of the present invention; after treatment with LC 50 flonicamid for 24 hours, the mortality rate of queens fed with dsRNA (Figure E).

[0032] Figure 6are the interference efficiencies of RNA interference on CYP336A66 (Figure A), CYP18A1 (Figure B), CYP302A1 (Figure C), and CYP6AQ83 (Figure D) in Example 4 of the present invention; after treatment with LC 50 flonicamid for 24 hours, the mortality rate of queens fed with dsRNA (Figure E); after treatment with LC 50 flonicamid, the mortality rate of worker ants fed with dsRNA for 24 hours (Figure F). Detailed implementation manners

[0033] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The following is an explanation of the present invention rather than a limitation.

[0034] Example 1 Transcriptome mining of genes involved in the detoxification metabolism of Solenopsis invicta Buren to flonicamid

[0035] 1) Analyze the transcriptome changes induced by LC30 flonicamid using worker ants and queens of the Nanchong population. The four experimental groups include: worker ant control (0 mg / L), worker ant treatment (0.64 mg / L), queen control (0 mg / L), and queen treatment (2.51 mg / L). Each experimental group is set with 3 biological replicates, and each replicate uses 10 worker ants or a single queen. Total RNA is extracted using the TRIzol Reagent kit, the concentration of RNA is detected using a ultra-micro spectrophotometer, and its integrity is confirmed by agarose gel electrophoresis. Take 2 µg of Total RNA, enrich and purify mRNA using magnetic beads with oligo (dT), and then fragment the mRNA to 300 bp. Using the fragmented mRNA as a template, synthesize the first-strand cDNA with a 6 bp random primer, and then add buffer and dNTP (dUTP) to synthesize the second-strand cDNA. Immediately after the second-strand synthesis, perform end repair, add "A" at the 3' end, and connect the universal adapter. After purifying the ligation product, perform PCR amplification enrichment and sequencing adapter ligation. The obtained final library is sequenced on the DNBSEQ-T7 platform.

[0036] 2) After sequencing, reads containing adapters in the original files, reads with a proportion of N greater than 10%, reads consisting entirely of A bases, and low-quality reads (where the number of bases with a quality value Q ≤ 20 accounts for more than 50% of the entire read) were removed respectively. HISAT2 was used to align the valid data of the samples to the reference genome, and Mapping information was statistically analyzed. RSeQC was used to perform analysis such as redundant sequence analysis and insert fragment distribution based on the alignment results. Qualimap was used to perform analysis such as uniformity distribution inspection and genomic structure distribution based on the alignment results. BEDTools was used to perform statistical analysis of gene coverage and analysis of the distribution of sequencing sequences on chromosomes. After reconstructing transcripts using Stringtie, genes that were found in the sequencing results of this time but not included in the reference genome (or reference gene set) were defined as novel genes.

[0037] 3) Correlation analysis of the gene expression levels of worker ants and queens in the treatment group and the control group showed that the correlation between repeated samples within each group was very strong, and the correlation coefficients were between 0.9828 and 0.9939 (Figure A in Figure 1). The gene expression patterns of worker ants and queens showed high stability in repeated experiments. The correlation coefficients of worker ants and queens in the treatment group and the control group were 0.9711 - 0.9777 and 0.9753 - 0.9784 respectively, indicating that flonicamid treatment had a certain degree of influence on the gene expression patterns of worker ants and queens. The correlation coefficient of the gene expression levels of worker ants and queens was 0.8970 - 0.9300, indicating that there were differences in the gene expression patterns of worker ants and queens.

[0038] Principal component analysis (PCA) of the gene expression levels of each sample ( Figure 1 Figure B in) showed that PC1 represented the largest data variance (69.425%), indicating the difference in gene expression levels between the queen group and the worker ant group; PC2 represented 8.975% of the data variance, reflecting the difference in gene expression levels between the flonicamid treatment group and the control group. PCA analysis showed the roles of different functional ants and the influence of flonicamid treatment on the gene expression of worker ants and queens.

[0039] Paired comparisons were made to evaluate the gene expression levels between different groups, and differentially expressed genes were determined with the criteria of P < 0.05 and log2FC ≥ 1. Figure 2). Volcano plot analysis showed that there were significant differences in gene expression between the queen group and the worker group, resulting in a total of 3,955 differentially expressed genes, including 1,912 up-regulated genes and 2,043 down-regulated genes (Figure 2A). These findings emphasized the large differences in gene expression patterns between queens and workers. Compared with the control group, 1,331 differentially expressed genes were found in the worker group treated with flonicamid, among which 442 genes were up-regulated and 889 genes were down-regulated ( Figure 2 Figure 2B). Compared with the control group, 737 DEGs were found in the queen group treated with flonicamid, among which 310 genes were up-regulated and 427 genes were down-regulated ( Figure 2 Figure 2C). These results indicated that flonicamid treatment had obvious effects on the gene expression levels of both queens and workers. According to the differentially expressed genes, significant clustering patterns were observed among the three replicate samples in each group. As shown in Figure 2D, there were obvious clusters in the queen group and the worker group.

[0040] Example 2 qPCR verification of genes involved in the detoxification metabolism of Solenopsis invicta Buren to flonicamid

[0041] 1) Extract the total RNA of Solenopsis invicta Buren from Nanchong population according to the instructions of TRIeasyTM Total RNA Extraction Reagent (Yeasen Biotech Co., Ltd.). Take about 20 mg of frozen Solenopsis invicta Buren workers or queens at -70°C and put them into a homogenizer, add 1 mL of Total RNA Extraction Reagent, and perform homogenization. Vigorously shake the homogenized sample and place it at room temperature for 5 minutes to completely dissociate ribosomes. Centrifuge at 12,000×g for 10 min at 4°C, and take the supernatant; add 0.2 mL of chloroform to the supernatant, tighten the centrifuge tube cap, vortex vigorously for 15 sec, let it stand at room temperature for 3 min, and then centrifuge at 12,000×g for 15 min at 4°C; carefully pipette 500 μL of the upper aqueous phase into a new RNase-free centrifuge tube, add 0.5 mL of cold isopropanol, invert and mix well, and place it at -20°C for 30 min; then centrifuge at 12,000×g for 15 min at 4°C; discard the supernatant, add 0.5 mL of 75% ethanol (prepared with DEPC water) to the precipitate, mix well, and centrifuge at 7,500 r / min at 4°C for 5 min; discard the supernatant, dry the precipitate for 5 - 10 min; dissolve it in 50 μL of sterile RNase-free water and re-dissolve it for 10 min; use a ultra-micro spectrophotometer to measure the sample concentration and quality.

[0042] 2) According to the instructions of the Hifair® Ⅱ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNAdigester plus) reverse transcription kit (Yeasen Biotechnology Co., Ltd.), reverse transcribe the total RNA into cDNA. Prepare a 10-μL system mixture in an RNase-free centrifuge tube, containing 2 μL of 5×gDNAdigester Buffer, 1 μL of gDNA digester, 500 ng of total RNA, and an appropriate amount of RNase-free ddH2O. Gently pipette and mix well, and incubate at 42°C for 2 min to remove residual genomic DNA. Directly add 10 μL of 2×HifairTM Ⅱ SuperMix plus to the reaction tube from the previous step, gently pipette and mix well, and then perform cDNA synthesis according to the reverse transcription program (25°C for 5 min, 42°C for 30 min, 85°C for 5 min).

[0043] 3) According to the instruction manual of Hieff® qPCR SYBR Green MasterMix (High Rox Plus) kit from Yeasen Biotech Co., Ltd. (Shanghai). A 20 μL reaction system was prepared by adding 0.4 μL each of Forward Primer and Reverse Primer (10 μM), 0.5 μL of cDNA, 10 μL of Hieff® qPCR SYBR Green Master Mix, and an appropriate amount of sterile ultrapure water; qPCR was performed using a two-step amplification program (95°C for 5 min, 95°C for 10 s, then 60°C for 30 s, for a total of 40 cycles; finally 60°C for 15 s, and gradually heated to 95°C at 0.2°C / s for 15 s to record the melting curve). The 18S rRNA gene was used as an internal reference gene, and 3 biological replicates were set for each sample; 3 experimental replicates. The primer sequences are shown in Table 1. The relative expression levels of CYP4AA1 (NCBI accession number: XM026133296.2), CYP336A65 (NCBI accession number: XM011173853.3), CYP4BW9 (NCBI accession number: XM026134986.2), and CYP6AS161 (NCBI accession number: NM001319647.1) in worker ants treated with flonicamid were measured (Figure 3), among which, CYP4AA1, CYP336A65, and CYP4BW9 are known P450 enzyme genes. Compared with the control group, the relative expression levels of CYP4AA1 and CYP6AS161 in worker ants treated with flonicamid were significantly up-regulated, increasing by 5.16-fold and 5.17-fold respectively (P < 0.05). After treatment with flonicamid (Figure 4), CYP6AQ83 in the queen ant was significantly up-regulated by 7.09-fold (P < 0.05). Therefore, CYP6AS161 may be involved in the detoxification metabolism of flonicamid in worker ants; CYP6AQ83 may be involved in the detoxification metabolism of flonicamid in queen ants.

[0044] Table 1 Primers used in qPCR in Example 2

[0045]

[0046] Example 3 Cloning of CYP6AS161 and CYP6AQ83 genes and preparation of dsRNA

[0047] 1) Based on the red imported fire ant transcriptome data, the complete CDS sequences of CYP6AS161 and CYP6AQ83 genes were retrieved, and specific primers were designed for cloning (primer Table 2).

[0048] Table 2 Primers used in step 1)

[0049]

[0050] 2) Gene cloning Worker ants and queen ants of the Nanchong red fire ant population were used to collect test insect samples under the conditions of 26 ± 1°C, relative humidity of 65% ± 5%, and a photoperiod of 14 L:10 D. The samples were quick-frozen in liquid nitrogen, and total RNA was extracted after homogenization using the TRIeasyTM Total RNA Extraction Reagent kit (Yisun Biotechnology (Shanghai) Co., Ltd.) and reverse transcribed into cDNA. Using this as a template, cloning was performed to obtain CYP6AS161 and CYP6AQ83 gene fragments, whose CDS sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0051] SEQ ID NO.1 (CYP6AS161):

[0052]

[0053] SEQ ID NO.2 (CYP6AQ83):

[0054]

[0055] 3) Connect the CYP6AS161 and CYP6AQ83 gene fragments to the vector pEASY-Blunt, and obtain the CYP6AS161 and CYP6AQ83 gene plasmids through Escherichia coli transformation and gene sequencing.

[0056] 4) Based on the cloned full-length gene sequences, design primers with T7 promoter (Primer Table 3) respectively. After amplifying the target product, perform gel recovery and purification; prepare a 20 μL in vitro transcription reaction system (8 μL of NTP mix, 2 μL of 10× Transcription Buffer, 2 μL of T7 Enzyme mix, 500 ng of template, and an appropriate amount of RNase-free H2O). After freezing and thawing the reagents on ice, gently pipette to mix. Incubate at 37°C for 2 h or overnight. Then incubate at 72°C for 10 min to allow it to anneal naturally at room temperature. Dilute 100 U / μL RNase T1 to 10 U / μL with RNase T1 Dilution Buffer before preparation, and prepare a digestion system (20 μL of dsRNA, 17 μL of RNase-free H2O, 1 μL of DNase I, 2 μL of RNase), and incubate at 37°C for 30 min to digest and remove DNA and ssRNA. The digested product is purified by magnetic bead method according to the kit recommendation. Its sequences are shown in SEQ ID NO.3 and SEQ ID NO.4. Among them, dsCYP6AS161 acts on worker ants, and dsCYP6AQ83 acts on queen ants.

[0057] SEQ ID NO.3 (dsCYP6AS161):

[0058] CCCATGTCCATGCACCTCTTCAGGCTCGACGCTGTTAGATGGCGACCATTAAGAACGAGGCTCTCGCCCACCTTTACGTCCGGAAAGTTGAAGGACATGTTTCACTTGTTGCTGAACTGTGCCGACTACTTCGAAAAGTATCTCGACGAGAAGGTACCTGAAAACGGTGTTGTCGAGTGCAAGGATCTAACGTCCAAATTCACCGTTGATGTGATCGGATCGTGTGCCTTCGGTCTCGAAATGAACGCGCTGAAGGAGGAGAATAATGAATTTCAGAAAATGGGTCGTTACATATTCCGCTCCAG

[0059] SEQ ID NO.4 (dsCYP6AQ83):

[0060] GTTAGAGGGTGAGGGAAAGACAATAGAAGTAAAAGATTTAAGTGCCAAATTTACCACGGATATAATCGGCAGTACCGCTTACGGGCTCGACGTGAATTCATTCAAAAATCCAGACGCAGAGTTCCGCAAATATGGCAAGATGATGTTTCAGTTTAATATGATTCGCGGCTTGGAGATGCTCGCGATATTTTTTCTTCCAACTATAACTCGTTTGGCACATTTAAAAATGTTCGGCAAACAGCCCACGGACTTTCTGCGAAAAGTCTTTTGGGAGACGCTCACTCAGCGCATAAAATCTGGCATAAAGAGAAACGATCTTATCGACATCCTTATTGAACTTAAAAATAGCAATAATAAGGATCTACCAGATTTCACGTTTGATGGCGATGATCTTCTGGCACAACCAGTTAGTTTCTTTGCAGCTGGTTTTGAAACCTCTTCAACAACTACGGCT

[0061] Table 3 Primers used in step 4)

[0062]

[0063] Note: dsGFP was used as a negative control.

[0064] Example 4 Verification of dsRNA function

[0065] To verify the relationship between the P450 gene and the resistance of worker ants and queens to flonicamid, for worker ants, dsCYP4AA1, dsCYP336A65, dsCYP4BW9, and dsCYP6AS161 were synthesized; for queens, dsCYP336A66, dsCYP18A1, dsCYP302A1, and dsCYP6AQ83 were synthesized. Among them, the synthesis of dsCYP6AS161 and dsCYP6AQ83 was as in Example 3, and the synthesis of other dsRNAs referred to Example 3, with the difference being the primers used (Table 4). Then the following operations were carried out:

[0066] After starving the red imported fire ants for 4 h, the dsRNA was dissolved in 10% sucrose aqueous solution (dsRNA concentration was 400 ng / µL) to feed the red imported fire ants. The dsRNAs corresponding to CYP4AA1, CYP336A65, CYP4BW9, and CYP6AS161 were fed to worker ants, and the dsRNAs corresponding to CYP336A66 (NCBI accession number: XM026133958.2), CYP18A1 (NCBI accession number: XM039454761.1), CYP302A1 (NCBI accession number: XM011157038.3), and CYP6AQ83 were fed to queens (CYP336A66, CYP18A1, and CYP302A1 are known P450 enzyme genes). dsGFP was used as a negative control and water as a blank control. The red imported fire ants were collected 24 h and 48 h after feeding dsRNA respectively. After freezing with liquid nitrogen, RT-qPCR was used to detect the interference efficiency, and each treatment was repeated three times. The red imported fire ants fed dsRNA for 24 h were transferred to a new aeration cup, starved for 4 h, and then fed 10% sucrose aqueous solution containing LC50 flonicamid for bioassay. The mortality was recorded 24 h after treatment. 20 worker ants or 10 queens were used for each single treatment, and each treatment was repeated three times.

[0067] Table 4 Primers for synthesizing other dsRNAs

[0068]

[0069] As Figure 5 shown, the relative expression levels of P450 genes in worker ants were measured 24 h and 48 h after feeding dsRNA. The results showed that 24 h after feeding dsRNA, compared with the dsGFP treatment group, the relative expression levels of CYP4AA1, CYP336A65, CYP4BW9, and CYP6AS161 were significantly reduced by 54.63%, 44.88%, 72.33%, and 52.31% respectively. The inhibitory effects of dsRNA treatment on these 4 P450 genes still persisted 48 h after feeding worker ants, and the relative expression levels were significantly reduced by 50.45%, 46.09%, 45.22%, and 41.43% respectively. In addition, interfering with these four P450 genes significantly reduced the tolerance of worker ants to flonicamid. After feeding dsRNA, the tolerance of worker ants to flonicamid was measured. The results showed that the mortalities of worker ants treated with dsCYP4AA1, dsCYP336A65, dsCYP4BW9, and dsCYP6AS161 increased significantly by 23.33%, 20.00%, 20.00%, and 36.67% respectively. CYP6AS161 may play an important role in the process of worker ants developing tolerance to flonicamid.

[0070] As Figure 6 shown, the results indicate that after 24 h of feeding dsRNA, compared with the dsGFP treatment group, the relative expression levels of CYP336A66 (NCBI accession number: XM026133958.2), CYP18A1 (NCBI accession number: XM039454761.1), CYP302A1 (NCBI accession number: XM011157038.3), and CYP6AQ83 (NCBI accession number: XM039448594.1) were significantly reduced by 89.28%, 88.05%, 84.99%, and 90.49% respectively. After 48 h of feeding the queen ants dsRNA, the expression of its P450 genes was still significantly inhibited. The relative expression levels of CYP336A66, CYP18A1, CYP302A1, and CYP6AQ83 were significantly reduced by 70.79%, 79.66%, 68.94%, and 78.54% respectively. In addition, after feeding dsRNA, the insecticide tolerance of queen ants and worker ants to flonicamid was measured. The results show that the mortality rate of queen ants treated with dsCYP6AQ83 increased significantly by 30.00%. There was no significant difference in the mortality rate of queen ants and worker ants in the remaining interference treatments. CYP6AQ83 was involved in the detoxification metabolism process of queen ants to flonicamid.

[0071] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the appended claims.

Claims

1. dsRNA for knocking down the P450 gene of Solenopsis invicta CYP6AQ83 Expression, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

4.

2. The preparation method of the dsRNA according to claim 1, characterized in that, Comprising the following steps: Step 1, extracting the total RNA of Solenopsis invicta and reverse transcribing it into cDNA; Step 2: Using this cDNA as a template, perform gene cloning to obtain CYP6AQ83 gene fragment; Step 3, ligate the CYP6AQ83 gene fragment to the vector and transform it through competent cells to obtain CYP6AQ83 gene plasmid; Step 4, using CYP6AQ83 the full-length sequence of the gene plasmid as a template, performing PCR amplification, and obtaining the dsRNA after purification of the amplification product.

3. The preparation method according to claim 2, characterized in that, In the said Step 2, the primer sequences used for gene cloning are shown in SEQ ID NO:13 and SEQ ID NO:14 respectively; and / or, In the said Step 3, the vector is pEASY-Blunt; and / or, In the said Step 4, the primer sequences used for PCR amplification are shown in SEQ ID NO:17 and SEQ ID NO:18 respectively.

4. dsRNA for knocking down the P450 gene of Solenopsis invicta CYP6AS161 Application of the dsRNA expressed and the dsRNA described in claim 1 in preparing a kit for controlling Solenopsis invicta, for knocking down the P450 gene of Solenopsis invicta CYP6AS161 The nucleotide sequence of the dsRNA expressed is as shown in SEQ ID NO.

3.

5. A kit for preventing and controlling Solenopsis invicta, characterized in that, Comprising: dsRNA for knocking down the P450 gene of Solenopsis invicta CYP6AS161 The dsRNA expressed and the dsRNA described in claim 1, for knocking down the P450 gene of Solenopsis invicta CYP6AS161 The nucleotide sequence of the dsRNA expressed is as shown in SEQ ID NO.3.

Images