Application of TaLG1 Gene in Regulating Wheat Yield Traits

By studying the TaLG1 gene and knocking out its genes using Crispr-Cas9 technology, the problem of fewer yield regulation genes caused by the complexity of wheat genome is solved, and a significant increase in wheat ear length, ear grain number and single plant yield has been achieved, providing an important genetic resource for high-yield wheat breeding.

CN118956938BActive Publication Date: 2025-06-10SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411075548.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-07
Publication Date
2025-06-10
Estimated Expiration
2044-08-07

AI Technical Summary

Technical Problem

The wheat genome is huge and complex. Currently, there are relatively few genes cloned to regulate wheat production traits, making it difficult to effectively increase wheat yield.

Method used

Through studying the TaLG1 gene, it was found that its knockout can increase the length of wheat ears, number of ear grains and yield of single plants. The gene knockout vector was constructed using Crispr-Cas9 technology, Agrobacterium was introduced and wheat young embryos were transformed through Agrobacterium mediating method, and wheat transgenic plants with TaLG1 knockout were obtained.

Benefits of technology

The ear length and ear grain number of wheat plants with TaLG1 knockout have been significantly improved, and the yield of a single plant has also increased significantly, providing excellent genetic resources for high-yield molecular breeding in wheat and laying the foundation for the precise improvement of wheat agronomic traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118956938B_ABST
    Figure CN118956938B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the TaLG1 gene in regulating wheat yield traits, belonging to the technical field of plant genetic engineering. The present invention has discovered the gene TaLG1 that can increase the number of grains per spike, the main yield factor of wheat. The inventor constructed a gene knockout vector using the Crispr-Cas9 technology, then introduced it into Agrobacterium, and transformed wheat immature embryos by the Agrobacterium-mediated method, and finally obtained transgenic wheat lines. The inventor obtained transgenic wheat plants with TaLG1 gene knockout through identification. Through phenotypic statistics and analysis, it was found that for wheat with TaLG1 knockout, both spike length and the number of grains per spike were significantly increased, and the yield per plant was significantly increased. The present invention provides excellent gene resources for wheat high-yield molecular breeding and also lays a foundation for the precise improvement of wheat agronomic traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to the application of TaLG1 gene in regulating wheat yield traits. Background Art

[0002] Wheat is one of the main food crops and plays an important role in ensuring food security. With the increasing global population, there is still a large gap between the total output of wheat and the demand for wheat. Therefore, on the premise of stabilizing the planting area, increasing the yield per unit area of wheat is one of the important ways to solve these problems.

[0003] The yield of wheat is mainly affected by the three elements of yield (the number of spikes per unit area, the number of grains per spike, and the grain weight). The wheat ear, as the only carrier of wheat grains, is the key place for the formation of wheat yield. The ear traits of wheat are important yield components. As one of the important ear traits, wheat ear length and the number of grains per ear are closely related to the three elements of wheat yield.

[0004] Directionally improving the ear traits of wheat is of great significance for increasing wheat yield. However, due to the large and complex wheat genome, relatively few genes regulating wheat production traits have been cloned so far. Therefore, cloning and studying more genes related to yield regulation in wheat is of great significance for the cultivation of high-yield wheat. Summary of the Invention

[0005] Aiming at the above-mentioned prior art, the purpose of the present invention is to provide the application of TaLG1 gene in regulating wheat yield traits. The present invention finds through research that knocking out the TaLG1 gene can increase wheat ear length, the number of grains per ear, and the yield per plant. Therefore, the TaLG1 gene can be used as a regulatory gene for wheat yield traits, laying a foundation for improving wheat yield and traits.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided the application of TaLG1 gene in the following (1) or (2):

[0008] (1) Regulating wheat yield traits;

[0009] (2) Cultivating high-yield wheat;

[0010] The TaLG1 gene includes: TaLG1-A, TaLG1-B, and TaLG1-D; the nucleotide sequence of TaLG1-A is as shown in SEQ ID No.1, the nucleotide sequence of TaLG1-B is as shown in SEQ ID No.2, and the nucleotide sequence of TaLG1-D is as shown in SEQ ID No.3.

[0011] In the above application, the wheat yield traits include: spike length, grains per spike, 1000-grain weight, and yield per plant.

[0012] In the second aspect of the present invention, there is provided the use of the protein encoded by the TaLG1 gene in regulating wheat yield traits.

[0013] In the above application, the protein encoded by the TaLG1 gene includes: TaLG1-A protein, TaLG1-B protein, and TaLG1-D protein; the amino acid sequence of the TaLG1-A protein is as shown in SEQ ID No. 4, the amino acid sequence of the TaLG1-B protein is as shown in SEQ ID No. 5, and the amino acid sequence of the TaLG1-D protein is as shown in SEQ ID No. 6.

[0014] In the above application, the wheat yield traits include: spike length, grains per spike, 1000-grain weight, and yield per plant.

[0015] In the third aspect of the present invention, there is provided the use of a recombinant expression vector or a genetically engineered bacterium containing the TaLG1 gene in any one of the following (1)-(3):

[0016] (1) Regulating wheat spike traits;

[0017] (2) Regulating wheat yield;

[0018] (3) Wheat breeding.

[0019] In the above application, the wheat spike traits include: spike length and grains per spike.

[0020] In the fourth aspect of the present invention, there is provided a method for increasing wheat yield, comprising the following steps:

[0021] Mutating the TaLG1 gene in a wheat plant or inhibiting the expression of the TaLG1 gene to obtain a wheat transgenic plant with increased spike length, grains per spike, and yield per plant.

[0022] In the above method, mutating the TaLG1 gene in a wheat plant or inhibiting the expression of the TaLG1 gene can be achieved by gene knockout.

[0023] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by changing the DNA sequence. For example: the TaLG1 gene can be knocked out using a Crispr-Cas9 knockout vector.

[0024] In the above method, the mutation of the TaLG1 gene in a wheat plant specifically is:

[0025] Delete the nucleotides at positions 240 - 395 of TaLG1-A shown in SEQ ID No.1, delete the nucleotides at positions 358 - 393 of TaLG1-B shown in SEQ ID No.2, and delete the nucleotides at positions 237 - 370 of TaLG1-D shown in SEQ ID No.3;

[0026] Alternatively, delete the nucleotides at positions 373 - 376 of TaLG1-A shown in SEQ ID No.1, delete the nucleotides at positions 220 - 395 of TaLG1-B shown in SEQ ID No.2, and delete the nucleotides at positions 217 - 232 and 234 - 392 of TaLG1-D shown in SEQ ID No.3.

[0027] In the fifth aspect of the present invention, a method for cultivating high-yield wheat varieties is provided, including the following steps:

[0028] Knock out the TaLG1 gene in the starting wheat plant to inactivate the TaLG1 protein, and obtain a wheat transgenic plant with increased spike length and grain number per spike compared to the starting wheat plant;

[0029] Use the wheat transgenic plant as a parent to cross with wheat plants of other plant types to obtain a wheat variety with high-yield traits.

[0030] Advantages of the present invention:

[0031] Through long-term research and exploration, the present invention has discovered the gene TaLG1 that can increase the grain number per spike, the main yield factor of wheat. The inventor constructed a gene knockout vector using the Crispr-Cas9 technology, then introduced it into Agrobacterium, and transformed wheat immature embryos by the Agrobacterium-mediated method. Finally, transgenic wheat lines were obtained. The inventor obtained transgenic wheat plants with TaLG1 gene knockout through identification. Through phenotypic statistics and analysis, it was found that for wheat with TaLG1 knockout, both the spike length and the grain number per spike were significantly increased, and the yield per plant was also significantly increased. The present invention provides excellent gene resources for wheat high-yield molecular breeding and also lays a foundation for the precise improvement of wheat agronomic traits. Description of the Drawings

[0032] Figure 1 : Process diagram of Agrobacterium-mediated transformation of wheat immature embryos by a wheat gene editing vector; in the figure, (A) Immature embryos are co-cultured with Agrobacterium; (B) CIM induces the regeneration of callus; (C) SIM regenerates seedlings; (D) The rooting medium enables the plant to regenerate roots. CIM: Selection medium B, SIM: Differentiation medium.

[0033] Figure 2: Detection result diagram of gene editing of transgenic positive plants of the TaLG1 knockout vector transformed into the T0 generation of Fielder; Target positions and vector structures of the Crispr-Cas9 knockout vector, genomic editing of the knockout lines, and the PAM region is marked in red.

[0034] Figure 3 : Comparison of spike traits and yield between transgenic edited plants obtained by transforming the TaLG1 knockout vector into Fielder and the Fielder wild type; In the figure, (A) Spike phenotypes of the control and edited lines at the immature stage; (B) Spike phenotypes of the control and edited lines at the mature stage; (C) Number of grains per spike of the control and edited lines; (D-H) Statistical data of spike length, total number of spikelets per spike, number of grains per spike, 1000-grain weight, and yield per plant; Error values represent standard error (SEM), calculated from at least three independent biological replicates. * represents P<0.5, ** represents P<0.01, *** represents P<0.001. Detailed implementation manners

[0035] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present application belongs.

[0036] As mentioned above, due to the large and complex wheat genome, relatively few genes regulating wheat production traits have been cloned so far.

[0037] The present invention for the first time studies and discovers that the TaLG1 gene can be used as a negative regulatory gene for wheat yield traits. The TaLG1 gene is located on chromosome 2 of the wheat genome and includes three sub-genes, A, B, and D. Among them, the nucleotide sequence of TaLG1-A is shown in SEQ ID No.1, and the amino acid sequence of the encoded protein is shown in SEQ ID No.4. The nucleotide sequence of TaLG1-B is shown in SEQ ID No.2, and the amino acid sequence of the encoded protein is shown in SEQ ID No.5. The nucleotide sequence of TaLG1-D is shown in SEQ ID No.3, and the amino acid sequence of the encoded protein is shown in SEQ ID No.6.

[0038] By using the Crispr-Cas9 gene editing method to mutate the TaLG1 gene, two wheat TaLG1 gene mutant plants (talg1#20 and talg1#23) were obtained. Compared with the wild-type Fielder wheat, the TaLG1 gene of the mutant plant talg1#20 has the following mutations:

[0039] (1) Nucleotide deletion at positions 240-395 of TaLG1-A:

[0040]

[0041] Note: The shaded regions in the sequences are the missing nucleotides.

[0042] (2) Nucleotide deletion at positions 358 - 393 of TaLG1 - B:

[0043]

[0044]

[0045] Note: The shaded regions in the sequences are the missing nucleotides.

[0046] (3) Nucleotide deletion at positions 237 - 370 of TaLG1 - D:

[0047]

[0048]

[0049] Note: The shaded regions in the sequences are the missing nucleotides.

[0050] Compared with the wild - type Fielder wheat, the TaLG1 gene of the mutant plant talg1#23 has the following mutations: (1) Nucleotide deletion at positions 373 - 376 of TaLG1 - A:

[0051]

[0052]

[0053] Note: The shaded regions in the sequences are the missing nucleotides.

[0054] (2) Nucleotide deletion at positions 220 - 395 of TaLG1 - B:

[0055]

[0056] Note: The shaded regions in the sequences are the missing nucleotides.

[0057] (3) Nucleotide deletions at positions 217 - 232 and positions 234 - 392 of TaLG1 - D:

[0058]

[0059]

[0060] Note: The shaded regions in the sequences are the missing nucleotides.

[0061] The production traits of wheat plants with TaLG1 gene mutation and Fielder wheat were compared, and the results showed that: wheat plants with TaLG1 gene mutation could increase the spike length, grain number per spike and yield per plant of wheat. Therefore, the TaLG1 gene can be used as a regulatory gene for wheat yield traits, laying a foundation for improving wheat yield and traits.

[0062] In order to enable those skilled in the art to more clearly understand the technical solutions of this application, the technical solutions of this application will be described in detail below in conjunction with specific embodiments.

[0063] The test materials not specifically described in the embodiments of the present invention are all conventional test materials in the art and can be obtained through commercial channels. For those not specified in the embodiments of the present invention for specific experimental conditions and methods, they are usually in accordance with conventional conditions, such as edited by J. Sambrook et al., Science Press, 2002, Molecular Cloning Experiment Guide (Third Edition); edited by D.L. Spector et al., Science Press, 2001, Cell Experiment Guide; or in accordance with the conditions recommended by the manufacturer.

[0064] Among them, the wheat material used in the present invention is Fielder wheat.

[0065] The composition of the culture medium used for wheat genetic transformation is as follows:

[0066] Co-culture medium: 2.12 g of MS powder, 10 g of sucrose, 2 mg of 2,4-D, 5 mg of glutamine, 0.5 g of casein hydrolysate, 4 mg of silver nitrate, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0067] Recovery medium: 2.12 g of MS powder, 10 g of sucrose, 2 mg of 2,4-D, 2 mg of glycine, 4 mg of silver nitrate, vitamin B 5 0.5 mg, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0068] Selection medium A: 2.12 g of MS powder, 10 g of sucrose, 5 mg of zeatin, 2 mg of glycine, 0.5 mg of IAA, 15 mg of hygromycin, 4 mg of silver nitrate, vitamin B 5 0.5 mg, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0069] Selection medium B: 2.12 g of MS powder, 10 g of sucrose, 5 mg of 6-BA, 0.5 mg of IAA, 2 mg of glycine, 30 mg of hygromycin, 4 mg of silver nitrate, vitamin B 5 0.5 mg, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0070] Differentiation medium: 2.12 g of MS powder, 10 g of sucrose, 5 mg of zeatin, 0.5 mg of IAA, 2 mg of glycine, 15 mg of hygromycin, 0.5 mg of vitamin B 5 0.5 mg, 4 mg of silver nitrate, 5 mg of asparagine, 5 mg of glutamine, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0071] Rooting medium: 2.12 g of MS powder, 10 g of sucrose, 0.5 mg of IAA, 0.5 mg of paclobutrazol, 1 mg of glycine, 15 mg of hygromycin, 0.5 mg of vitamin B 5 0.5 mg, 5 mg of asparagine, 5 mg of glutamine, 8 g of agar, made up to 1 L with sterile water; pH = 5.8.

[0072] Example 1: Construction of TaLG1 gene knockout vector

[0073] (1) Design sgRNA on E-CRISP (http: / / www.e-crisp.org / E-CRISP / ), and screen specific targets that only target the A gene locus (TraesCS2A02G502300), B gene locus (TraesCS2B02G530400) and D gene locus (TraesCS2D02G502900) of TaLG1 gene by analyzing the results of blast of the target sites on the wheatomics website.

[0074] Target 1: GGTAGAACTGGAGGATGTCG NGG;

[0075] Target 2: GTCGTACTACCACCAGCAGG NGG.

[0076] "N" in the target sequence represents any nucleotide of A, T, C, G.

[0077] (2) Construction of Crispr-Cas9 gene knockout vector.

[0078] Perform four-primer PCR amplification using pCBC-DT1T2 diluted 100 times as a template. -BsF / -BsR are normal primer concentrations; -F0 / -R0 are diluted 20 times for PCR amplification:

[0079] TaLG1-MT1T2-BsF: AATAATGGTCTCAAGCGGTAGAACTGGAGGATGTCG;

[0080] TaLG1-MT1T2-F0:

[0081] GGTAGAACTGGAGGATGTCGGTTTTAGAGCTAGAAATAGC;

[0082] TaLG1-MT1T2-R0:CCTGCTGGTGGTAGTACGACGCTTCTTGGTGCC;

[0083] TaLG1-MT1T2-BsR:ATTATTGGTCTCTAAACCCTGCTGGTGGTAGTACGA。

[0084] The PCR amplification system was 1 μL of F primer (50 pmol / μL), 1 μL of diluted F0 primer (2.5 pmol / μL), 1 μL of R primer (50 pmol / μL), 1 μL of diluted R0 primer (2.5 pmol / μL), 5 μL of 10×PCR buffer, 2 μL of dNTP mixture (10 mmol / L), 0.5 μL of EVO DNA polymerase (5 U), 1 μL of pCBC-DT1T2 template, and add DEPC·H 2 O to make up the total volume to 25 μL.

[0085] The amplification conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 1 min, for 32 cycles; extension at 72°C for 5 min.

[0086] Recover the PCR amplification product and establish a digestion-ligation system as follows:

[0087]

[0088] The ligation product was transformed into Escherichia coli Top10 and cultured overnight on LB solid medium containing kanamycin (100 mg / L). Single colonies were picked and cultured overnight in LB liquid medium containing kanamycin (100 mg / L). Plasmid DNA was extracted by the alkaline method and sequenced. The amplified product was analyzed by sequencing, and its sequence was as shown by the target, indicating that the target sequence had been ligated to the pUBE413 Vector vector, and the TaLG1 gene knockout vector construction was completed.

[0089] Example 2: Obtaining of wheat TaLG1 gene mutant plants

[0090] Agrobacterium-mediated method was used for wheat genetic transformation, and the process of Agrobacterium-mediated transformation of wheat immature embryos was as Figure 1 shown in A-D. The specific genetic transformation process was as follows:

[0091] (1) Transform the TaLG1 gene knockout vector constructed in Example 1 into Agrobacterium tumefaciens EHA105 to obtain an Agrobacterium infection solution for transformation.

[0092] (2) Aspirate the Agrobacterium infection solution from step (1) into a 2 mL centrifuge tube containing Fielder wheat immature embryos, gently invert and mix for 45 s to immerse the immature embryos in the bacterial solution. If the immature embryos cannot be immersed in the bacterial solution, centrifuge briefly.

[0093] (3) Let it stand for 5 min, then pour the bacterial solution and the immature embryos into a sterile disposable Petri dish and aspirate half of the bacterial solution.

[0094] (4) Use a sterilized and cooled scalpel to pick up the immature embryos and place them on the co-culture medium. During this process, sterilize the scalpel several times to avoid contamination and affecting subsequent experiments.

[0095] (5) Seal the Petri dish with sealing film and place it in a dark incubator at 23 °C for co-culture.

[0096] (6) After 2 days of co-culture, cut off the hypocotyl of the immature embryo and place it on the recovery medium for dark culture at 25 °C.

[0097] (7) After 5 days, the callus of the immature embryo begins to swell and callus starts to form. Transfer the swollen callus to screening medium A, discard the brown and dead immature embryo tissues, and continue dark culture at 25 °C.

[0098] (8) After 14 days, larger callus is formed. Cut the callus in half and transfer it to screening medium B with the cut surface contacting the medium for continuous dark culture at 25 °C.

[0099] (9) After 21 days, transfer the callus to the differentiation medium. The callus begins to differentiate into buds and is cultured in a light incubator at 25 °C with a light intensity of 2000 lx.

[0100] (10) After the callus differentiates into green seedlings, transfer them to the rooting medium until the green seedlings grow 4 - 5 leaves, and then transplant them to the greenhouse or artificial climate chamber for strong seedling culture.

[0101] The detection results of TaLG1 knockout vector-transformed Fielder T0 generation transgenic positive plants are as Figure 2 shown, and two wheat TaLG1 gene mutant plants, talg1#20 and talg1#23, are obtained. Among them: Compared with the wild-type Fielder wheat, nucleotides 240 - 395 of TaLG1-A in talg1#20 are deleted, nucleotides 358 - 393 of TaLG1-B are deleted, and nucleotides 237 - 370 of TaLG1-D are deleted.

[0102] Nucleotides at positions 373-376 of TaLG1-A of talg1#23 are deleted, nucleotides at positions 220-395 of TaLG1-B are deleted, and nucleotides at positions 217-232 and 234-392 of TaLG1-D are deleted.

[0103] Example 3: Investigation of the production traits of wheat plants with TaLG1 gene mutations

[0104] 1. Test method:

[0105] The T1 generation plants (#20, #23) of the wheat plants with TaLG1 gene mutations obtained in Example 2 were cultured in an incubator at 25°C with a 16-hour light / 22°C with an 8-hour dark cycle; the wild-type wheat (Triticum aestivum) variety Fielder was used as a control, and the culture conditions were kept consistent.

[0106] After the spikes of the plants matured, more than 10 spikes of each line were cut with scissors, and the spike length, total number of spikelets per spike, number of grains per spike, 100-grain weight, and yield per plant were counted. The statistical data were subjected to a significance analysis to compare the differences in production traits between the wild-type and transgenic plants.

[0107] 2. Test results:

[0108] The comparison results of the production traits between the wheat plants with TaLG1 gene mutations and the Fielder wild-type are as Figure 3 shown. The results show that the TaLG1 gene mutation can cause an increase in the spike length, number of grains per spike, 100-grain weight, and yield per plant of wheat, which is beneficial to the improvement of wheat yield.

[0109] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, the present application can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. Knockout TaLG1 The use of genes in the following (1) or (2): (1) Improving wheat yield traits, wherein the wheat yield traits include: Ear length, number of grains per ear, 100-grain weight and yield per plant; (2) Cultivate high-yield wheat; Said TaLG1 Gene TaLG1-A , TaLG1-B and TaLG1-D composition; described TaLG1-A The nucleotide sequence is shown in SEQ ID No. 1, TaLG1-B The nucleotide sequence is shown in SEQ ID No.2, TaLG1-D The nucleotide sequence is shown in SEQ ID No.

3.

2. TaLG1 The application of inactivating a gene-encoded protein in improving wheat yield traits is characterized in that: Said TaLG1 The protein encoded by the gene consists of TaLG1-A protein, TaLG1-B protein and TaLG1-D protein; the amino acid sequence of the TaLG1-A protein is shown in SEQ ID No.4, the amino acid sequence of the TaLG1-B protein is shown in SEQ ID No.5, and the amino acid sequence of the TaLG1-D protein is shown in SEQ ID No.6; The wheat yield traits include: ear length, number of grains per ear, 100-grain weight and single-plant yield.

3. Targeting claim 1 TaLG1 Application of Crispr-Cas9 gene knockout vector for gene in the following (1) or (2): (1) Improving wheat yield traits, wherein the wheat yield traits include: Ear length, number of grains per ear, 100-grain weight and yield per plant; (2) Wheat breeding.

4. A method for increasing wheat yield, characterized in that: The following steps are involved: In wheat plants TaLG1 Gene mutation or suppression TaLG1 By regulating the expression of genes, transgenic wheat plants with increased ear length, number of grains per ear and yield per plant were obtained; Said TaLG1 Gene TaLG1-A , TaLG1-B and TaLG1-D composition; described TaLG1-A The nucleotide sequence is shown in SEQ ID No. 1, TaLG1-B The nucleotide sequence is shown in SEQ ID No.2, TaLG1-D The nucleotide sequence is shown in SEQ ID No.

3.

5. The method according to claim 4, characterized in that In wheat plants TaLG1 The specific gene mutations are: The SEQ ID No.1 TaLG1-A The nucleotides 240-395 of SEQ ID No. 2 are deleted. TaLG1-B The nucleotides 358-393 of SEQ ID No. TaLG1-D The nucleotides 237-370 of the nucleotide sequence ... Alternatively, the TaLG1-A The nucleotides 373-376 of SEQ ID No. 2 are deleted. TaLG1-B The nucleotides 220-395 of SEQ ID No.3 are deleted. TaLG1-D Nucleotides 217-232 and 234-392 are missing.

6. A method for breeding high-yield wheat varieties, characterized in that: The following steps are involved: The wheat starts from the plant TaLG1 Gene knockout, inactivating the TaLG1 protein, yields transgenic wheat plants with increased ear length and number of grains per ear compared to the original wheat plants; Using transgenic wheat plants as parents to cross with wheat plants of other plant types to obtain wheat varieties with high-yield traits; Said TaLG1 Gene TaLG1-A , TaLG1-B and TaLG1-D composition; described TaLG1-A The nucleotide sequence is shown in SEQ ID No. 1, TaLG1-B The nucleotide sequence is shown in SEQ ID No.2, TaLG1-D The nucleotide sequence is shown in SEQ ID No.3.

Citation Information

Patent Citations

  • Rice panicle ears gene PAC1 regulation and control sequence and molecular marker application

    CN103210832A

  • Wheat TaLAX1-A gene and application thereof in improving regeneration efficiency of wheat immature embryos

    CN112521475A