A methylation marker for assisting in the detection of lung cancer

By detecting the methylation levels of AHDC1, RASSF1A, SEPTIN9, SDC2 and ZNF304 genes in lung cancer patients, the problem of non-invasive rapid lung cancer screening is solved, and early high sensitivity and high specific lung cancer detection is achieved, improving the accuracy and efficiency of lung cancer diagnosis.

CN118957072BActive Publication Date: 2025-09-02SHENZHEN RAPHA BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411158039.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-21
Publication Date
2025-09-02
Estimated Expiration
2044-08-21

AI Technical Summary

Technical Problem

The lack of non-invasive, fast and accurate lung cancer screening methods in the prior art leads to low early detection of lung cancer, long diagnosis cycle and insufficient accuracy.

Method used

The methylation marker combination of AHDC1, RASSF1A, SEPTIN9, SDC2 and ZNF304 genes was used to detect the CpG island methylation level in the sample by amplification-sequencing, chip detection or methylation fluorescence quantitative PCR, and combined with internal standard primers and probes to improve detection sensitivity and specificity.

Benefits of technology

It has achieved high sensitivity and specific identification of lung cancer patients in the early stages, shortened the detection cycle, improved the accuracy and efficiency of lung cancer diagnosis, and reduced costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118957072B_ABST
    Figure CN118957072B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of molecular biology detection, specifically, to the field of lung cancer detection, and more specifically, to the detection of methylation levels of lung cancer gene markers. The present invention provides a methylation marker combination for auxiliary detection of lung cancer, comprising: a region in the AHDC1 gene as shown in SEQ ID NO: 1. The sensitivity, specificity and AUC of lung cancer detection using the markers of the present invention are 88.49%, 91.43% and 0.936, respectively. The present invention can detect lung cancer clinically with fewer markers, saving both cost and time, and can detect patients who are truly at risk of lung cancer malignancy in the early stages of the carcinogenesis process with high sensitivity and high specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology detection, specifically, to the field of lung cancer detection, and more specifically, to the detection of methylation levels of lung cancer gene markers. Background Art

[0002] Lung cancer is one of the most common cancers worldwide and a leading cause of cancer-related death. The five-year survival rate for lung cancer is less than 20%, reaching only 6% for patients in advanced stages and 85% for stage IA. Therefore, early detection of lung cancer is crucial for improving survival rates.

[0003] Advances in lung cancer epigenetic research have profound implications for the early diagnosis and treatment of lung cancer. Evidence suggests that hypermethylation of CpG islands in tumor suppressor gene promoters is a key mechanism of gene inactivation. Transcriptional inactivation of various genes can affect the cell cycle, DNA repair, apoptosis, and other processes, and is closely linked to the development and progression of cancer. Gene methylation refers to the process by which enzymes selectively add methyl groups to cytosine (C) within CpG dinucleotides on DNA molecules, forming 5'-methylcytosine. Methylation of CpG islands in gene promoter regions is a common phenomenon in lung cancer patients. Clinically, testing for methylated gene markers in tissue cells and body fluids (such as sputum, serum, and plasma) from lung cancer patients is considered an effective adjunctive diagnostic method, potentially increasing lung cancer detection rates. Studies have shown that DNA methylation can be detected in sputum as early as three years before lung cancer diagnosis. Combining this with cytopathological testing can significantly improve the efficiency of lung cancer diagnosis, shorten the testing cycle, and enhance diagnostic accuracy.

[0004] Therefore, this field urgently needs a non-invasive, rapid and more accurate lung cancer screening product to provide technical support for improving the effectiveness of lung cancer screening. Summary of the Invention

[0005] In view of this, the present invention provides a methylation marker combination for assisting in the detection of lung cancer, comprising: a region of the AHDC1 gene as shown in SEQ ID NO: 1.

[0006] The sensitivity, specificity, and AUC for lung cancer detection using the markers of the present invention were 88.49%, 91.43%, and 0.936, respectively. This method enables clinical lung cancer detection with fewer markers, saving both cost and time. Furthermore, it can detect patients at high risk of lung cancer malignancy at an early stage of the cancerous process with high sensitivity and specificity.

[0007] Furthermore, the methylation marker combination further includes at least one of the following regions:

[0008] The region of the RASSF1A gene as shown in SEQ ID NO: 2;

[0009] The region of the SEPTIN9 gene as shown in SEQ ID NO: 3;

[0010] The region of the SDC2 gene as shown in SEQ ID NO: 4; or

[0011] The region of the ZNF304 gene is shown in SEQ ID NO:5.

[0012] In some specific embodiments, the methylation marker combination is:

[0013] the region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the RASSF1A gene as shown in SEQ ID NO: 2;

[0014] the region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the SEPTIN9 gene as shown in SEQ ID NO: 3;

[0015] the region of the AHDC1 gene as shown in SEQ ID NO: 1, the region of the SEPTIN9 gene as shown in SEQ ID NO: 3, and the region of the ZNF304 gene as shown in SEQ ID NO: 5;

[0016] The region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the SDC2 gene as shown in SEQ ID NO: 4; or

[0017] The region of the AHDC1 gene is shown as SEQ ID NO: 1, and the region of the ZNF304 gene is shown as SEQ ID NO: 5.

[0018] Furthermore, a detection composition for assisting in the detection of lung cancer comprises a detection reagent for detecting the methylation level in the following regions:

[0019] The region of the AHDC1 gene is shown in SEQ ID NO: 1.

[0020] Furthermore, the composition may further comprise at least one of the detection reagents for detecting the methylation levels in the following regions:

[0021] The region of the RASSF1A gene as shown in SEQ ID NO: 2;

[0022] The region of the SEPTIN9 gene as shown in SEQ ID NO: 3;

[0023] The region of the SDC2 gene as shown in SEQ ID NO: 4; or

[0024] The region of the ZNF304 gene is shown in SEQ ID NO:5.

[0025] In some specific embodiments, the composition includes a detection reagent for detecting methylation levels in the following regions:

[0026] The region of the AHDC1 gene is shown as SEQ ID NO: 1, and the region of the RASSF1A gene is shown as SEQ ID NO: 2.

[0027] In some specific embodiments, the composition includes a detection reagent for detecting methylation levels in the following regions:

[0028] The region of the AHDC1 gene shown as SEQ ID NO: 1, and the region of the SEPTIN9 gene shown as SEQ ID NO: 3.

[0029] In some specific embodiments, the composition includes a detection reagent for detecting methylation levels in the following regions:

[0030] the region of the AHDC1 gene as shown in SEQ ID NO: 1, the region of the SEPTIN9 gene as shown in SEQ ID NO: 3, and the region of the ZNF304 gene as shown in SEQ ID NO: 5.

[0031] In some specific embodiments, the composition includes a detection reagent for detecting methylation levels in the following regions:

[0032] The region of the AHDC1 gene is shown as SEQ ID NO: 1, and the region of the SDC2 gene is shown as SEQ ID NO: 4.

[0033] In some specific embodiments, the composition includes a detection reagent for detecting methylation levels in the following regions:

[0034] The region of the AHDC1 gene is shown as SEQ ID NO: 1, and the region of the ZNF304 gene is shown as SEQ ID NO: 5.

[0035] The region shown in SEQ ID NO: 1 in the AHDC1 gene, the region shown in SEQ ID NO: 2 in the RASSF1A gene, the region shown in SEQ ID NO: 3 in the gene, the region shown in SEQ ID NO: 4 in the gene, and the region shown in SEQ ID NO: 5 in the gene are sequences of the CpG island in the promoter region of each gene.

[0036] Specifically, the SEQ ID NO: 1 region of the AHDC1 (Genbank accession number: NG_034158.1) gene is shown below:

[0037] GCTCTGCCCCGGCCCGGGGACTGGAGGCGCCCGGCAGCGGTCCGGA CCTGCGCTCTCGGACGCGGCTGAGTGGCGGGGTTATTAATAGCGTGCCTG GCTCGGGCAGTGGCTCCAG.

[0038] The SEQ ID NO: 2 region of the RASSF1A (Genbank accession number: NG_023270.1) gene is shown below:

[0039] CCGGTTGGGGCCCGTGCTTCGCTGGCTTTGGGCGCTAGCAAGCGCGGG CCGGGCGGGGCCACAGGGCGGGCCCCGACTTCAGCGC.

[0040] The region of the SEPTIN9 (Genbank accession number: NM_001113493.2) gene shown in SEQ ID NO: 3 is as follows:

[0041] CAGCGCGCAGGGCCCGGGCCCCGCCGGGGGCGCTTCCTCGCCGCTG CCCTCCGCGCGACCCGCTGCCCACCAGCCATCATGTCGGACCCCGC.

[0042] The region of the SDC2 (Genbank accession number: NM_002998.4) gene shown in SEQ ID NO: 4 is as follows:

[0043] GAGCCCGAGTCCCCGAGCCTGAGCCGCAATCGCTGCGGTACTCTGCTCCGGATTCGTGTGCGCGGGCTGCGCCGAG.

[0044] The region of the ZNF304 (Genbank accession number: NG_051201.1) gene represented by SEQ ID NO: 5 is as follows:

[0045] GCGTTTCCTGCTGCTCTGGGCTGCAGGGGCGAGACTTCTGGCGTCGC CGTCGTGACGTATTTTTCCTATGCCCGGTCCGTGCATTCTGGTT.

[0046] In the present invention, "CpG island" is the abbreviation of cytosine (C)-phosphate (P)-guanine (G), which refers to some regions rich in CpG dinucleotides on the genome, with a length of 300 to 3000 bp.

[0047] In some embodiments, the detection reagent of the present invention can be used to detect the methylation level of a CpG island or a sequence on a CpG island in a corresponding gene region present in a sample.

[0048] In the present invention, a "sample" is a biological sample selected from an individual, specifically, for example, a sample selected from a histological section, a tissue biopsy / paraffin-embedded tissue, and the like.

[0049] In the present invention, "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample, wherein the methylation level is measured by amplification-sequencing, chip detection, or methylation fluorescence quantitative PCR.

[0050] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting the average methylation level of a gene fragment.

[0051] In some specific embodiments, the methylation level detection reagent can also be a detection reagent for detecting one or more methylation sites within a gene segment.

[0052] In some specific embodiments, the detection reagents include but are not limited to nucleic acid primers and sequencing Tag sequences for measuring methylation levels by amplification-sequencing.

[0053] In some specific embodiments, the detection reagent includes but is not limited to a chip, wherein the chip is a methylation chip having probes that specifically bind to methylated regions, and the chip is used to measure methylation levels.

[0054] In some specific embodiments, the detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring methylation levels by methylation fluorescence quantitative PCR.

[0055] Furthermore, the detection reagent also includes an internal standard primer and an internal standard probe.

[0056] In a specific embodiment, the target of the internal standard primer and probe is the ACTB gene.

[0057] When the detection reagent includes nucleic acid primers and nucleic acid probes, the detection reagent detects the methylation level of nucleic acid in the sample through methylation fluorescent quantitative PCR.

[0058] In the present invention, "methylation fluorescence quantitative PCR" refers to converting the region to be detected by sulfite, and then performing fluorescence quantitative PCR detection using primers and probes specifically designed for the detection target, thereby obtaining the methylation level of the region to be detected.

[0059] The above reagent combination may also include other reagents, specifically, for example, various reagents required for sample pre-treatment or pre-processing, such as a sample release agent for extracting sample nucleic acid, a purification agent for purifying sample nucleic acid, bisulfite or bisulfite used for conversion, etc.

[0060] In some specific embodiments, the detection reagents are shown in Table 1. In the following detection reagents, the upstream primer / downstream primer / probe for detecting a target is considered a set. The upstream primer / downstream primer / probe for detecting the targets to be detected is used in this set. Therefore, the detection reagents of the present invention can include any one or more sets of the following primers and probes.

[0061] Table 1

[0062] Primer name serial number Sequence (5'-3') ME-AHDC1-F SEQ ID NO:6 ACTCTACCCCGACCCGAAAAC ME-AHDC1-R SEQ ID NO:7 TTGGAGTTATTGTTCGAGTTAGGTACG ME-AHDC1-P SEQ ID NO:8 CCGACAACGATCCGAACCTACGCTCTC ME-RASSF1A-F SEQ ID NO:9 GCGTTGAAGTCGGGGTTCG ME-RASSF1A-R SEQ ID NO: 10 CCGATTAAACCCGTACTTC ME-RASSF1A-P SEQ ID NO:11 CGCTAACAAACGCGAACCGA ME-SEPTIN9-F SEQ ID NO:15 CAACGCGCAAAACCCGAA ME-SEPTIN9-R SEQ ID NO:16 GCGGGGTTCGATATGATGGT ME-SEPTIN9-P SEQ ID NO: 17 AAACGCTTCCTCGCCGCTACCCTC ME-SDC2-F SEQ ID NO:12 GAACCCGAATCCCCGAACCTA ME-SDC2-R SEQ ID NO:13 TTCGGCGTAGTTCGCGTATAC ME-SDC2-P SEQ ID NO:14 ACCGCAATCGCTACGATACTCTACTCCG ME-ZNF304-F SEQ ID NO: 18 ACGTTTCCTACTACTCTAAACTACAA ME-ZNF304-R SEQ ID NO: 19 AATTAGAATGTACGGATCGGGTATAG ME-ZNF304-P SEQ ID NO:20 AACTTCTAACGTCGCCGTCGTAACG

[0063] In some specific embodiments, the fluorescent channels used in the present invention are FAM, ROX, VIC, and CY5 channels, but in actual application, they are not limited to these and can be any combination of other fluorescent channels. Different targets can also correspond to different fluorescent channels, for example, any fluorescent channel can be used as an internal standard detection channel. Dyes such as SYBR Green can also be used for amplification.

[0064] By using the above primers and probes, a composition with a smaller Ct value, more sensitive detection, and better stability, anti-interference and precision can be obtained.

[0065] In a second aspect, the present invention provides use of the above reagent combination in preparing a kit for detecting lung cancer.

[0066] In a third aspect, the present invention provides a kit for detecting methylation genes in lung cancer, the kit comprising the reagent combination as described above.

[0067] Furthermore, the kit also includes, but is not limited to, at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, and bisulfite.

[0068] Furthermore, the kit also includes a negative sample.

[0069] Specifically, the negative sample is human genomic DNA that has been sequenced to verify that there is no target gene methylation.

[0070] Furthermore, the kit also includes dNTPs, Mg 2+ , at least one of a methylation-sensitive restriction endonuclease, a PCR buffer, and a hot-start enzyme.

[0071] Furthermore, the range of the final concentration of each component is as follows: Mg 2+ 1~6mM, dNTPs 1~80mM, primers 0.1~40μM, probe 0.1~20μM. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 This is an exemplary detection reagent 0.05 ng / reaction detection diagram;

[0073] Figure 2 The figure shows that no nonspecific amplification was detected in 20 ng / reaction of non-methylated DNA. DETAILED DESCRIPTION

[0074] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0075] Example 1: Screening of methylation genes

[0076] In the early stage, a large number of blood samples were collected from cancer patients and non-cancer people. cfDNA was extracted from the plasma and treated with bisulfite before whole-genome methylation sequencing. Gene targets were found from the sequencing data, and target regions with wide differences in methylation levels were selected. The CpG island region of the AHDC1 gene was identified as an optional detection target. A combined model with the AHDC1 gene was further constructed for the detection of lung cancer, and its detection performance was clinically evaluated.

[0077] Example 2: Detection of gene methylation levels of standard products

[0078] Positive sample: Standard methylated human genomic DNA and target gene non-methylated human genomic DNA were mixed, with a concentration of 1 ng / μL containing 10% standard methylated human genomic DNA; a concentration of 1 ng / μL containing 1% standard methylated human genomic DNA; a concentration of 1 ng / μL containing 0.5% standard methylated human genomic DNA;

[0079] Negative samples: human genomic DNA with no target gene methylation verified by sequencing, 3 ng / μL;

[0080] Testing process:

[0081] Cell-free DNA is extracted from biological samples and treated with bisulfite, followed by PCR amplification using methylation-specific primer pairs.

[0082] PCR system configuration: Prepare PCR reaction solution according to the reagent formula in Table 3 below according to different detection targets

[0083] Table 3

[0084] Reagent components Dosage (μL) Primer (50 μM) 0.16 Blocking primer (50 μM) 0.08 Probe (50 μM) 0.04 PCR amplification buffer 11.62 Mg ion (1M) 0.1 dNTPS (80 mM) 1 Hot start enzyme (10U / μL) 1

[0085] The sample was added to the PCR reaction tube at 6 μL / reaction, and then 14 μL of PCR reaction solution was added in sequence. The PCR tube was capped, shaken to mix, and then centrifuged for 5 seconds.

[0086] Fluorescence PCR reaction and result analysis

[0087] 1) Place the PCR reaction tubes into the sample slot of the thermal amplification instrument and set the names of the samples to be tested in the corresponding order.

[0088] 2) Fluorescence detection channel selection: Select the VIC channel (Reportere: VIC, Quencher: None) to detect the corresponding gene; select the CY5 channel (Reportere: CY5, Quencher: None) as the internal standard to detect the housekeeping gene ACTB;

[0089] 3) Fluorescence quantitative PCR reaction conditions are as shown in Table 4:

[0090] Table 4

[0091]

[0092] 4) Result analysis

[0093] After the reaction is completed, the instrument automatically saves the results and can be automatically analyzed using the instrument's own software (you can also manually adjust the baseline start value, end value, and threshold line value for analysis). The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold). Figures 1-2 As shown, the exemplary detection reagent provided by the present invention is 0.05 ng / reaction ( Figure 1 ), no nonspecific amplification in 20 ng / reaction of nonmethylated DNA ( Figure 2 ).

[0094] Example 3: Effect of the Composition of the Present Invention on Detection of High-Grade Pulmonary Lesions and Lung Cancer

[0095] In order to prove the detection effect of the composition of the present invention (which corresponds to the detection of SEQ ID NO.1 to 5 regions respectively), the detection performance of different compositions of the present invention in clinical samples was compared. Marker genes were detected in peripheral blood plasma samples collected from 403 high-risk groups for lung cancer and patients with pathologically confirmed lung nodules or benign lung diseases or lung cancer. Different lung lesion subtypes in China were covered, including 101 patients with lung adenocarcinoma (66.01%), 37 patients with lung squamous cell carcinoma (24.18%), and 15 patients with small cell lung cancer (9.80%); 100 patients with benign lung diseases, including pneumonia, nodules, cysts, etc.; 150 normal high-risk people with an average age of 61 years old, with a history of smoking or passive smoking, or a family history of lung cancer, a history of occupational exposure, etc.; used to detect the composition of the present invention.

[0096] In addition to the combination of the present invention (AHDC1 gene), a multi-target joint detection system was constructed for multiple targets, including those potentially linked to the effects of methylation on cancer, particularly lung cancer. Using the aforementioned samples, sensitivity and specificity tests were conducted for each combination, as well as for the single target combination of the present invention. The results showed that the combination of the present invention demonstrated the best clinical performance, as shown in Table 4.

[0097] Table 4

[0098] Sensitivity Specificity AUC RASSF1A 85.71% 80.00% 0.857 AHDC1 88.89% 91.43% 0.936 RASSF1A+AHDC1 90.00% 93.94% 0.908 AHDC1+SEPTIN9 90.91% 91.43% 0.94 AHDC1+SEPTIN9+ZNF304 90.91% 94.29% 0.948 AHDC1+SDC2 88.89% 80.00% 0.84 AHDC1+ZNF304 85.00% 82.86% 0.84

[0099] Example 4: Stability of the composition of the present invention

[0100] The reagents (dNTPs, primers, probes (nucleic acid primers and probes set forth in SEQ ID NOs: 6-20), solvent, and polymerase) were frozen and thawed at room temperature. The vial was opened, mixed, capped, and stored at -20°C. Reagent performance was tested after 2, 4, and 6 weeks. The results are shown in Table 5, with a CV value of <5%, indicating good stability after opening the vial.

[0101] Table 5

[0102] Ct value of sample 1 Sample 2Ct value Sample 3Ct value Sample 4Ct value Sample 5Ct value 2 weeks 29.23 29.41 29.08 29.04 29.43 4 weeks 28.97 30.33 29.07 29.12 28.58 6 weeks 28.99 29.21 28.82 28.93 28.9

[0103] The reagent was placed at -20°C for 1 hour to completely freeze, then removed and placed at room temperature for 0.5 hour. After complete freeze-thaw, the mixture was mixed and centrifuged. The reagent performance was tested after 0, 3, and 6 freeze-thaw cycles. The results are shown in Table 6, with a CV value of <5%, indicating good freeze-thaw stability.

[0104] Table 6

[0105] Ct value of sample 1 Sample 2Ct value Sample 3Ct value Sample 4Ct value Sample 5Ct value 0 times 29.23 28.96 28.44 29.27 28.89 3 times 28.84 29.35 28.56 29.19 28.95 6 times 28.72 28.88 28.95 29.13 29.06

[0106] The reagent was placed at 37°C for 24, 48, and 72 hours, and then tested on samples after being placed at -20°C. The results are shown in Table 7, with a CV value of <5%, indicating good thermal stability.

[0107] Table 7

[0108] Ct value of sample 1 Sample 2Ct value Sample 3Ct value Sample 4Ct value Sample 5Ct value -20℃24h 29.07 28.99 29.07 29.04 29.01 37℃24h 29.31 29.37 29.25 29.04 29.25 -20℃48h 28.55 29.3 29.13 28.89 29.05 37℃48h 28.97 30.33 29.07 29.12 28.58 -20℃72h 28.96 29.13 28.85 29.43 29.31 37℃72h 28.98 28.99 29.48 29.16 28.82

[0109] Example 5: Anti-interference properties of the composition of the present invention

[0110] In order to verify the anti-interference property of the composition of the present invention, experiments were conducted by adding interfering substances to blood samples of healthy subjects, including unmethylated DNA, bilirubin, hemoglobin, triglycerides, proteins, red blood cells, K2EDTA, cholesterol, uric acid and glucose, as well as common drugs. The experimental results are shown in Tables 8 to 10. It can be seen from the table that common interfering substances do not interfere with the composition of the present invention.

[0111] Table 8

[0112]

[0113] Table 9

[0114]

[0115]

[0116] Table 10

[0117]

Claims

1. Use of the composition in preparing a kit for assisting in the detection of lung cancer, wherein: The composition includes a detection reagent for detecting the methylation level of at least one of the following methylation marker combinations: 1) the region of the AHDC1 gene as shown in SEQ ID NO: 1; 2) the region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the RASSF1A gene as shown in SEQ ID NO: 2; 3) the region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the SEPTIN9 gene as shown in SEQ ID NO: 3; 4) the region of the AHDC1 gene as shown in SEQ ID NO: 1, the region of the SEPTIN9 gene as shown in SEQ ID NO: 3, and the region of the ZNF304 gene as shown in SEQ ID NO: 5; 5) the region of the AHDC1 gene as shown in SEQ ID NO: 1, and the region of the SDC2 gene as shown in SEQ ID NO: 4; or 6) The region of the AHDC1 gene shown as SEQ ID NO: 1, and the region of the ZNF304 gene shown as SEQ ID NO:

5.

2. The use according to claim 1, characterized in that The detection reagent is: Nucleic acid primers and probes shown in SEQ ID NOs: 6 to 20.

3. The use according to claim 1, characterized in that The composition further comprises an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for monitoring.

4. The use according to any one of claims 1 to 3, characterized in that The kit further comprises at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, or bisulfite.

5. The use according to claim 4, characterized in that The kit also includes dNTPs, Mg 2+ , methylation-sensitive restriction endonuclease, PCR buffer, or at least one of a hot start enzyme.