A snp molecular marker related to multiple growth traits of chicken and application thereof
The SNP molecular marker at the rs14491022 locus in the chicken genome was identified by GWAS analysis, which solved the problem of the lack of clear molecular markers in broiler breeding. This enabled early, rapid, and low-cost improvement of chicken weight, and has significant breeding application prospects and economic benefits.
Patent Information
- Application Number
- CN202410839768.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-26
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-06-26
AI Technical Summary
There is a lack of clear and significant molecular markers in current broiler breeding, making it difficult to effectively improve the body weight and slaughter weight traits of chickens.
GWAS analysis revealed a SNP marker at the rs14491022 locus in the chicken genome. Resequencing was used to sequence a hybrid population of 845 chickens, and the results showed that this SNP locus was significantly associated with the body weight at six, eight, ten, and twelve weeks of age, carcass weight, left leg muscle weight, and liver weight. T was the dominant allele in high-weight chickens, while C was the dominant allele in low-weight chickens. Individuals with allele T were selected for breeding.
It enables early, rapid, and low-cost prediction of chicken weight, thereby improving the weight of chicken flocks and has broad breeding application prospects and economic value.
Smart Images

Figure CN118957083B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, in particular to a SNP molecular marker related to chicken body weight and carcass weight traits and application thereof, and more particularly to a SNP molecular marker related to chicken six-week-old body weight, eight-week-old body weight, ten-week-old body weight, twelve-week-old body weight, carcass weight, left leg muscle weight and liver weight and application thereof. BACKGROUND
[0002] In recent years, the output of chicken meat in China has been continuously increasing, and improving muscle output and chicken meat quality has been a long-term exploration of breeding scientists. The classical breeding method has made a great contribution to the improvement of agricultural animal production traits, and with the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers, so as to gradually improve the yield and quality level of the whole chicken population.
[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variation forms in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and high accuracy. Further, if the SNP molecular marker related to the target traits of chicken can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chicken and bring breakthrough progress to the field of poultry breeding. SUMMARY
[0004] In view of the deficiencies in the prior art, the present application aims to provide a SNP molecular marker related to chicken carcass weight traits and its application, and particularly relates to a SNP molecular marker related to chicken six-week-old weight, eight-week-old weight, ten-week-old weight, twelve-week-old weight, carcass weight, left leg muscle weight and liver weight and its application, wherein 845 chicken crossbreeding individuals are sequenced by using resequencing technology, GWAS analysis is performed, a SNP site significantly related to chicken six-week-old weight, eight-week-old weight, ten-week-old weight, twelve-week-old weight, carcass weight, left leg muscle weight and liver weight is obtained, the SNP is rs14491022 (chr4:75892495) located in the genomic version GRCg6a 104, the polymorphism of the SNP molecular marker is T and C, and the SNP molecular marker contains three genotypes of TT, CC and TC, the SNP frequency of the SNP in other low-weight chicken species and high-weight chicken species in resequencing is counted, and it is found that the SNP frequency of the SNP in the low-weight chicken species and the high-weight chicken species is significantly different, the T is the dominant allele in the high-weight chicken, and the C is the dominant allele in the low-weight chicken, and in the population with low body weight gain, the body weight gain of the chicken can be improved by selecting the individuals with the allele T.
[0005] To solve the above technical problems, the technical scheme provided by the present application is:
[0006] A SNP molecular marker related to multiple growth traits of chickens,
[0007] The SNP molecular marker is located at chr4:75892495 of the genomic GRCg6a 104, and the alleles of the SNP site are T and C; the SNP site contains three genotypes of TT, CC and TC.
[0008] The economic traits are chicken six-week-old weight, eight-week-old weight, ten-week-old weight, twelve-week-old weight, carcass weight, left leg muscle weight and liver weight.
[0009] The T is the dominant allele in the high-weight chicken, and the C is the dominant allele in the low-weight chicken.
[0010] Preferably,
[0011] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO. 1. SEQ ID NO. 1 (chr4:75892395-75892595)
[0012] gtacaacaaagttaattctatggttacataatcagtaactataactgcagtgaacactgtatgctgctgcacattcaatccttgat
[0013] aatctgcact taagctctgc agtagacctg gcttcctgaa atgcagcagg tggggtattc tgctgcttaa agtttccttt aatag
[0014] gagcaagggg gtgcaggtac ttactgcct
[0015] The SNP molecular marker is applied to the detection of the traits of six-week-old weight, eight-week-old weight, ten-week-old weight, twelve-week-old weight, carcass weight, left leg muscle weight and liver weight of chicken.
[0016] The application comprises the following steps:
[0017] (1) detecting the genotype of the sample chicken at the SNP site;
[0018] (2) selecting the sample chicken with T / T genotype for the selection of dominant line.
[0019] Preferably,
[0020] The step (1) can adopt direct sequencing or first amplifying the gene fragment containing the SNP molecular marker and then detecting.
[0021] The specific steps of amplification are as follows: the blood tissue of the hybrid population sample is used to extract DNA by using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd., the OD value of the extracted DNA is detected by using NanoDrop 2000 spectrophotometer to determine the concentration and purity of the DNA, and the integrity of the DNA is detected by using agarose gel electrophoresis. The sequence of the hybrid population sample is designed by using Oligo7 software, the sequence is amplified by using Novozyme 2×Taq Master Mix, the reaction system is as follows: 95℃, pre-denaturation for 3min; 95℃, denaturation for 15s, 60℃, annealing for 15s, 72℃, extension for 15s, 30 cycles; 72℃, complete extension for 5min. Finally, the product fragment size is detected by using agarose gel electrophoresis.
[0022] The primer pair for amplifying the fragment containing the SNP site is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0023] The primer pair sequence is as follows:
[0024] F: GTACAACAAAGTTAATTCTA (SEQ ID NO. 2)
[0025] R: AGGCAGTAAAGTACCTGCA (SEQ ID NO. 3)
[0026] application of the SNP molecular marker in marker-assisted selection breeding,
[0027] The chicken breed with genotype T / T is selected for breeding.
[0028] The beneficial effects of the present application are:
[0029] The present application provides a SNP molecular marker related to multiple growth traits of chicken and application thereof, by genotyping SNP site chr4: 75892495 of 845 chickens, SNP frequency analysis of the site in low weight chicken breed and high weight chicken breed is carried out, it is found that T is the dominant allele in high weight chicken, C is the dominant allele in low weight chicken, in the population with lower weight, by selecting individuals with allele T, the weight of the population can be improved, the site is used as a SNP molecular marker for breeding of excellent chicken breed, which can early, quickly, low-cost and effectively predict whether the weight is high or not, has wide application prospect in chicken breed improvement and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS
[0030] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, illustrate the present application together with the embodiments thereof, and explain the present application, and do not constitute a limitation of the present application. In the drawings:
[0031] FIG. 1A is a Manhattan plot of six-week-old weight GWAS results, FIG. 1B is a Manhattan plot of eight-week-old weight GWAS results, FIG. 1C is a Manhattan plot of ten-week-old weight GWAS results, FIG. 1D is a Manhattan plot of twelve-week-old weight GWAS results, FIG. 1E is a Manhattan plot of carcass weight GWAS results, FIG. 1F is a Manhattan plot of left leg muscle weight GWAS results, FIG. 1G is a Manhattan plot of liver weight GWAS results DETAILED DESCRIPTION
[0032] The preferred examples of the present application are described below in conjunction with the drawings, and it should be understood that the following examples are given only for the purpose of illustration, and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application.
[0033] The application provides a SNP molecular marker related to multiple growth traits of chickens and an application thereof. The SNP molecular marker is located in an intron region of an NCAPG gene, a genome GRCg6a 104 chr4:75892495, and is located at the 101th base in a nucleotide sequence shown in SEQ ID NO. 1. Alleles of the SNP site are T and C. The SNP marker has three genotypes, TT, CC and TC, and economic traits are six-week-old body weight, eight-week-old body weight, ten-week-old body weight, twelve-week-old body weight, carcass weight, left leg muscle weight and liver weight. In high body weight chickens, T is the dominant allele, and in low body weight chickens, C is the dominant allele. In the population with lower body weight, individuals with the allele T can be selected to improve the body weight of the chickens.
[0034] Example 1: Whole genome association analysis of chicken body weight and carcass weight phenotype
[0035] 1. Test materials
[0036] For 845 chicken hybrid population individuals, the body weight of 1242 individuals was measured at six weeks, eight weeks, ten weeks and twelve weeks, respectively; and at thirteen weeks, the chickens were slaughtered to measure the carcass weight, left leg muscle weight and liver weight. The measurement was strictly performed according to the internal specifications of the chicken farm.
[0037] 2. Test method
[0038] 2.1 Phenotype measurement
[0039] When the chickens reached the corresponding age, each chicken was placed on a weighing device, and the chicken was allowed to remain relatively calm and balanced, then the displayed body weight value was recorded, and the gender was recorded.
[0040] For the chickens in the population at thirteen weeks, the chickens were slaughtered, each chicken was placed on a weighing device after removing the chicken feathers and internal organs, the carcass weight was measured, and the left leg muscle weight and liver weight were measured.
[0041] 2.2 Whole genome SNP typing method of chickens based on resequencing technology
[0042] The sequencing data is aligned to the GRCg6a 104 reference genome by gtx align, SNP site detection is performed by Basevar, and the genotype probability of all individuals is estimated by STITCH. For the SNP sites obtained by typing, filtering is performed according to MAF<0.05, site call rate<0.95 and info score<0.4, and a total of 7,901,521 high-quality sites are reserved.
[0043] 2.3 Whole genome association analysis
[0044] The fastGWA was used to perform whole genome association analysis on the body weight of 845 chickens at the age of six weeks, eight weeks, ten weeks, twelve weeks, slaughter weight, left leg muscle weight and liver weight.
[0045] 2.4 SNP sites significantly related to body weight and slaughter traits
[0046] The detection of significant sites at the genome level was performed, and the identification of significant sites was performed according to FDR < 0.05.
[0047] 3. Results and analysis
[0048] The present application takes 845 chickens of a crossbreed population as the object, uses 7,901,521 SNPs obtained by resequencing technology to perform GWAS analysis on the body weight and slaughter weight of chickens, determines a SNP (chr4: 75892495) site significantly related to the body weight and slaughter weight of chickens, and the site is shown in FIG. 1.
[0049] Example 2: Frequency distribution of SNP (chr4: 75892495) in different chicken breeds
[0050] 1. Test material
[0051] Low-weight chicken breeds: tea flower chicken (n = 30), Dawei mountain miniature chicken (n = 33) and silk feather chicken (n = 57).
[0052] High-weight chicken breeds: Lingnan yellow-feather broiler (n = 15), white-feather broiler (n = 20), Kebao chicken (n = 33) and recessive white-feather chicken (n = 112).
[0053] 2. Test method
[0054] 2.1 Data collection
[0055] The whole genome resequencing data from the above-mentioned three low-weight chicken breeds and four high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).
[0056] 2.2 SNP typing using GATK
[0057] The gVCF of the above-mentioned resequencing samples was constructed based on the GRCg6a 104 reference genome using the GTX server gtx wgs command, and then the joint variant detection was performed on all gVCF samples using the gtx gi and gtx joint commands, and the genotype VCF file was obtained.
[0058] 2.3 Filtering and quality control of SNPs
[0059] After joint variant calling, SNPs sites were extracted using the SelectVariants tool of the GATK software package, and then the whole genome resequencing data was quality controlled according to the following hard filtering parameters using the VariantFiltration tool of the GATK software package: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30. Finally, after the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.
[0060] 2.4 Calculation of allele frequency of chr4:75892495 in different chicken breeds
[0061] The allele frequency of chr4:75892495 in different chicken breeds was calculated using vcftools--freq2.
[0062] 3. Results and analysis
[0063] The SNP frequency distribution results of SNP (chr4:75892495) in different low-weight chicken breeds and high-weight chicken breeds are shown in Table 1, and there is a significant difference between low-weight chicken breeds and high-weight chicken breeds. In high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele.
[0064] Table 1 SNP frequency of SNP (chr4:75892495) in different low-weight chicken breeds and high-weight chicken breeds
[0065]
[0066] Thus, a SNP molecular marker related to chicken six-week-old weight, eight-week-old weight, ten-week-old weight, twelve-week-old weight, carcass weight, left leg muscle weight, and liver weight traits is obtained. In a population with low body weight and carcass weight, breeding individuals with the T / T allele at this site can improve the body weight of the breeding population.
[0067] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.
[0068] Finally, it should be noted that the above description is only a preferred example of the present application and is not intended to limit the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. The application of an SNP molecular marker in the detection of body weight at six weeks, eight weeks, ten weeks, twelve weeks, and thirteen weeks of age in chickens, characterized in that... The SNP molecular marker is located at chr4:75892495 of the GRCg6a genome, and the alleles of the SNP locus are T and C; it includes three genotypes: TT, CC and TC.
2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select T / T genotype sample chickens for breeding superior strains.
3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.
Citation Information
Patent Citations
Chicken NCAPG gene SNP molecular marker, detection primer, kit, breeding method and application
CN115851987A
Application of genetic marker related to egg short diameter in chicken genetic breeding
CN118166112A