A method for rapid detection of bovine rotavirus

Abstract

The present invention provides a method for rapid detection of bovine rotavirus, which uses a primer pair and a probe for recombinase isothermal amplification fluorescence method for detecting bovine rotavirus. The primer pair is used to amplify all or part of the fragment with the sequence of SEQ ID NO:1, and the probe is used to detect the product amplified by the primer. The primers and probes provided by the present invention are applicable to the detection based on the recombinase isothermal amplification fluorescence method, and can accurately and rapidly detect bovine rotavirus with strong specificity.

Description

Technical Field

[0001] The invention belongs to the technical field of virus molecular biological gene detection, and particularly relates to a method for rapidly detecting bovine rotavirus. Background Art

[0002] Bovine rotavirus (BRV), a member of the genus Rotavirus in the family Reoviridae, can be vertically transmitted through the placenta and is a major cause of calf diarrhea. BRV infection in calves often presents with clinical symptoms such as lethargy, loss of appetite, diarrhea, vomiting, and dehydration, and most cases are latent. BRV has diverse transmission routes, primarily fecal-oral and respiratory. When environmental conditions are favorable, outbreaks and epidemics can occur. International reports indicate that BRV morbidity in newborn calves ranges from 60% to 80%, with a mortality rate as high as 30%, causing significant economic losses to the cattle industry. BRV was first observed in cattle diarrhea specimens in my country in 1981 using electron microscopy. Subsequently, researchers developed methods for virus isolation and culture, RT-PCR, and fluorescent RT-PCR, and conducted epidemiological surveys. Serological surveys have shown a BRV antibody positivity rate of up to 99%. Etiological investigations have shown that the average BRV positivity rate in affected farms in my country is 15.3%, reaching 95.4% in some areas. A higher infection rate will accelerate the genetic evolution of BRV and genetic reassortment between different strains, further complicating its epidemic. Furthermore, recombination between BRV and other rotavirus strains could pose a threat to human health. Therefore, strengthening research on bovine rotavirus detection technology is crucial for disease control and prevention, animal health, and public health safety.

[0003] Currently, there are several diagnostic methods for bovine rotavirus:

[0004] 1) Clinical diagnosis

[0005] The onset of illness is sudden, with symptoms initially including depression, decreased or no feeding, normal or slightly elevated body temperature, anorexia, diarrhea, and thick, yellowish-white or milky-white feces. Subsequently, the diarrhea becomes pronounced, with the calf passing large amounts of watery, yellowish-white or off-white feces. The area around the anus, the inner sides of the hind legs, and the tail are often soiled with feces, and large amounts of off-white feces can be found in the pens of sick calves. Some calves pass feces laced with mucus and blood. Some calves also experience laxity of the anal sphincter, resulting in fecal incontinence and a continuous flow of loose feces from the anus.

[0006] Severe diarrhea can cause calves to become significantly dehydrated, with sunken eyeballs, dry skin, matted fur, and inability to stand. They may eventually die from heart failure and metabolic acidosis, with body temperatures dropping below normal.

[0007] 2) Laboratory diagnosis

[0008] Laboratory diagnosis of BRV involves virus isolation, electron microscopy, immunological methods, and molecular biology. Virus isolation and electron microscopy are considered the simplest and most intuitive methods. In 1969, Mebus et al. successfully isolated and diagnosed the world's first bovine rotavirus through electron microscopic observation. However, this technique is susceptible to technical limitations and virus particle morphology, making it unsuitable for large-scale clinical sample testing. Immunological detection methods are further divided into latex agglutination (LAT) and enzyme-linked immunosorbent assay (ELISA). Latex agglutination testing is suitable for rapid testing in primary care settings due to its simplicity and time efficiency. However, it is also susceptible to sample limitations, which can affect the accuracy of test results. In 1985, the WHO designated ELISA as the standard method for rotavirus diagnosis. This method offers excellent specificity, high sensitivity, and is free of radioactive contamination. However, it places high demands on both the operator and the equipment. Molecular biology-based techniques such as conventional / multiplex reverse transcription-polymerase chain reaction (RT-PCR) and real-time quantitative RT-PCR (RT-qPCR) have been widely used for BRV detection. Although PCR is widely used in production practice, it also has limitations. First, agarose gel electrophoresis (AGE) is time-consuming and cumbersome, and visualization of results requires specialized equipment such as nucleic acid dyes, PCR instruments, and electrophoresis apparatuses, making it unsuitable for on-site testing. RT-qPCR offers greater sensitivity, is less time-consuming than conventional RT-PCR, and does not require AGE, making it a commonly used diagnostic method in laboratories. However, like RT-PCR, RT-qPCR requires a fluorescence signal collection instrument, often expensive reagents, and requires high-level expertise, making it a disadvantage for on-site BRV detection.

[0009] Diagnostic technology is constantly developing and updating, and more and more detection technologies can be applied. However, BRV monitoring is still mainly based on detection technologies such as fluorescent quantitative PCR and ELISA. These methods require the construction of a good laboratory and expensive laboratory equipment as support, and require well-trained personnel to operate and complete. Small and medium-sized farms with poor conditions find it difficult to bear the relevant expenses. Some large-scale farms also have problems such as shared laboratories and untimely inspections. Therefore, under the premise of ensuring specificity, sensitivity, and repeatability, the development of portable and rapid bovine rotavirus detection methods suitable for use by grassroots veterinarians, breeders, etc. is the research direction of technical personnel in this field. Summary of the Invention

[0010] The present invention provides a method for rapid detection of bovine rotavirus, namely, a primer, probe and detection method for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence method (RAA fluorescence method). The method can complete the detection of bovine rotavirus within 20 minutes at 40°C. The method is fast, sensitive, easy to operate and suitable for on-site rapid detection.

[0011] The present invention first provides a primer pair and a probe for detecting bovine rotavirus based on recombinase isothermal amplification and fluorescence method, wherein the primer pair is used to amplify all or part of a fragment of SEQ ID NO: 1, and the probe is used to detect the product amplified by the primers;

[0012] As a specific record of the embodiment, the sequence information of the primer pair is as follows:

[0013] Upstream primer: 5′- TTCAGGTCGCTGGATTTGACTATTCGTGTG -3′ (SEQ ID NO: 2);

[0014] Downstream primer: 5′- GCCCGTTTAGTAAAAACTCTACTTCAACGT-3′ (SEQ ID NO: 3);

[0015] The present invention also provides a probe for detecting the amplification product of the above primers, and the sequence of the probe is as follows:

[0016] 5′-TGGGAGGGTGTTGACTACAGCTACAATAACTCTTTACCAGATGCAGA-3′ (SEQ ID NO: 4).

[0017] The probe is modified with a fluorescent reporter group and a fluorescent quencher group. The fluorescent reporter group is modified at a position 31 bp from the 5' end of the probe sequence; the fluorescent quencher group is modified at a position 16 bp from the 3' end of the probe sequence. There is one base C between the fluorescent reporter group and the quencher group, which is replaced with a tetrahydrofuran residue.

[0018] The modified probes are as follows:

[0019] 5′-TGGGAGGGTGTTGACTACAGCTACAATAAC / i6FAMdT / / iTHF / / iBHQ1dT / TTTACCAGATGCAGA (C3 spacer)-3′.

[0020] Furthermore, the fluorescent reporter group is FAM, HEX, TET, JOE or VIC; and the fluorescent quencher group is BHQ1, BHQ2 or BHQ3.

[0021] Preferably, the fluorescent reporter group is FAM; the fluorescent quencher group is BHQ1.

[0022] The above primers and probes are used to prepare a RAA fluorescence detection kit.

[0023] Furthermore, the present invention also provides a method for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence method, the specific steps of which are as follows:

[0024] 1) Extracting nucleic acid samples from the subjects to be tested;

[0025] 2) Preheat the thermostatic oscillator and set the reaction parameters to 39°C and 4 minutes. Preheat the thermostatic fluorescent gene detector and set the reaction parameters to 40°C and 20 minutes.

[0026] 3) Add 13.7 μL of water, 2.1 μL of 15 μM upstream and downstream primers, and 0.6 μL of probe to 25 μL of reaction buffer, mix thoroughly, and then add to the RAA fluorescent basic reaction reagent to prepare the reaction premix.

[0027] 4) Add 2.5 μL of MgCl2 to the reaction tube cap. 2+ 4 μL of the nucleic acid sample obtained in step 1) and the reaction premix obtained in step 3) were thoroughly mixed in a constant temperature oscillating mixer, and the resulting reaction system was placed in a constant temperature fluorescence gene detector to detect the fluorescence signal;

[0028] 5) Based on the positive determination method in the constant-temperature fluorescence gene detection instrument, select a threshold method to determine the positive / negative nature of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 200, then within 20 minutes, wells with a fluorescence value greater than 300 will be determined as positive, and all others will be determined as negative.

[0029] Furthermore, the upstream primer and the downstream primer are used at a concentration of 1 to 50 μM.

[0030] Preferably, the upstream primer and the downstream primer are used at a concentration of 10 μM.

[0031] Furthermore, the concentration of the probe is 1 to 50 μM.

[0032] Preferably, the concentration of the probe is 10 μM.

[0033] Compared with the prior art, the present invention has the following advantages:

[0034] 1) The primers and probes provided by the present invention are suitable for detection based on recombinase isothermal amplification fluorescence, and can accurately and rapidly detect bovine rotavirus. They have no cross-reaction with bovine respiratory syncytial virus (BRSV), bovine infectious rhinotracheitis virus (IBRV), bovine viral diarrhea (BVDV), and bovine coronavirus (BCoV), with a specificity of 100%;

[0035] 2) The detection method provided by the present invention is rapid and easy to achieve high throughput, while reducing detection time and detection costs. The method provided by the present invention for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence method has high sensitivity, with the reaction detection sensitivity reaching 1 copies / μL;

[0036] 3) The present invention provides a method for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence. This method can conveniently, quickly and accurately identify bovine rotavirus. It is simple to operate and has a short detection time, with detection completed within 20 minutes. Unlike PCR, it does not require high-temperature denaturation to unwind the DNA, anneal it, and then extend it. Instead, it only requires isothermal amplification at 40°C to complete the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 : Screening results of primer-probe combination of the present invention;

[0038] Figure 2 : Graph showing the results of sensitivity detection of bovine rotavirus after a single serial dilution of the plasmid of the present invention;

[0039] Figure 3 : Graph showing the results of repeatability testing of the BRV VP6 gene plasmid of the present invention;

[0040] Figure 4 : Specific detection result diagram of the BRV VP6 gene plasmid of the present invention;

[0041] Figure 5 : Bovine rotavirus clinical sample detection result diagram of the present invention. DETAILED DESCRIPTION

[0042] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0043] Example 1: Primer and probe design and screening

[0044] The most conserved VP6 gene of BRV was selected, and the gene sequence is as follows:

[0045]

[0046] A DNA plasmid was constructed based on the BRV VP6 gene sequence. The recombinant plasmid was 3940 bp in size. The highly conserved BRV VP6 gene sequence was used as the target gene fragment for detection, and primers and probes were designed for screening and detection.

[0047] 1. Primer design

[0048] Primers for RAA detection are designed. The length of RAA primers is generally 18-25 bp. However, primers that are too short are prone to nonspecific amplification. Therefore, the primer length is increased to 30-35 bp to reduce nonspecific amplification. Based on the BRV VP6 gene sequence, the primer design includes upstream and downstream primers. The design sequences of the upstream and downstream primers are as follows:

[0049] RAA-F1: 5′-TTCAGGTCGCTGGATTTGACTATTCGTGTG-3′;

[0050] RAA-F2: 5′-TTTGACTATTCGTGTGCAATAAATGCGCCAG-3′;

[0051] RAA-F3: 5′- TGCGCCAGCTAATACACAACAATTTGAGCAT-3′;

[0052] RAA-R1: 5′- CTTCAACGTTATTCGGTCTAAGAATCACTGGA-3′;

[0053] RAA-R2: 5′-GCCCGTTTAGTAAAAACTCTACTTCAACGT-3′;

[0054] RAA-R3: 5′-CTTGCTTGGTAAGTATTTATTATCTGCCCGTT-3′;

[0055] RAA-Probe: 5′- TGGGAGGGTGTTGACTACAGCTACAATAACTCTTTTAC CAGATGCAGA -3′;

[0056] The above primers were combined into 9 primer combinations, namely combination 1, F1R1; combination 2, F2R1;

[0057] Combination 3, F3R1; Combination 4: F1R2; Combination 5, F2R2; Combination 6: F3R3; Combination 7: F1R3; Combination 8: F2R3; Combination 9, F3R3. Among the 9 primer-probe combinations, combination 4 had the highest expression of BRV VP6 at the same concentration (106 copies / μL), the peak time is shorter and the fluorescence value is relatively higher ( Figure 1 ). Therefore, the primer pair of combination 4 was selected, and its specific sequence information is as follows:

[0058] RAA-F1: 5'-TTCAGGTCGCTGGATTTGACTATTCGTGTG-3' (SEQ ID NO. 2);

[0059] RAA-R2: 5'-GCCCGTTTAGTAAAAACTCTACTTCAACGT-3' (SEQ ID NO. 3).

[0060] (2) Probe design

[0061] 1) The probe was designed using the RAA probe design principle. Based on the conserved sequence of the BRV VP6 gene, the designed probe sequence was:

[0062] 5'-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3' (SEQ ID NO. 4).

[0063] 2) Select fluorescent modifiers and fluorescence quenchers

[0064] The experimental instrument used was the RAA-F1620 fluorescent gene detector produced by Jiangsu Qitian Biological Science Instrument Co., Ltd., and the fluorescence detected was FAM fluorescence, so the fluorescent modification group was selected as FAM and the fluorescence quenching group was selected as BHQ1.

[0065] 3) The probe modification method includes: modifying the fluorescent reporter group at a position 31 bp from the 5' end of the probe sequence; modifying the fluorescent quencher group at a position 16 bp from the 3' end of the probe sequence, and replacing the fluorescent reporter group and the quencher group with a tetrahydrofuran residue with one base C between the fluorescent reporter group and the quencher group;

[0066] 5'-TGGGAGGGTGTTGACTACAGCTACAATAAC / i6FAMdT / / iTHF / / iBHQ1dT / TTTACCAGATGCAGA (C3 spacer)-3'.

[0067] (3) Primers, probes, and plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0068] (4) Detection reagents for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence method, including RAA fluorescence basic reaction reagent, reaction buffer, purified water, magnesium acetate, positive quality control, negative quality control, primers and probes; RAA fluorescence basic reaction reagent is a freeze-dried powder that has been freeze-dried at low temperature and purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd. with the product number F00R01A. The reaction specification is 50 μL and is re-dissolved with reaction buffer before use. The reaction buffer is the supporting reagent for RAA fluorescence basic reaction reagent. The concentration of the synthesized BRV VP6 gene plasmid was measured using an ultra-micro UV spectrophotometer and the copy number was calculated. 10 7 copies / μL~10 0 10 copies / μL of standard solution are reserved. Negative control is ddH2O or purified water. The concentrations of upstream and downstream primers are 10 μM; the concentration of the probe is 10 μM.

[0069] Example 2

[0070] The method for detecting bovine rotavirus based on recombinase isothermal amplification fluorescence method comprises the following steps:

[0071] 1) Homogenize the tissue sample to be tested, extract nucleic acid according to the tissue DNA / RNA extraction method, and store at -20°C until needed. If the sample is tissue, milk sample, or viral culture, extract nucleic acid using lysis, magnetic bead enrichment, washing, and elution steps;

[0072] 2) Preheat the RAA-B6100 constant temperature shaker and set the reaction parameters to 39°C for 4 minutes. Preheat the RAA-F1620 constant temperature fluorescent gene detector and set the reaction parameters to 40°C for 20 minutes.

[0073] 3) To 25 μL of reaction buffer, add 13.7 μL of water, 2.1 μL of 10 μM upstream and downstream primers, and 0.6 μL of probe. Mix thoroughly, then add to the RAA fluorescent basic reaction reagent to prepare a reaction premix.

[0074] 4) Add 2.5 μL of MgCl2 to the reaction tube cap. 2+ , 4 μL of the nucleic acid extract obtained in step (1) and the reaction premix obtained in step (3) were fully mixed in a constant temperature oscillating mixer RAA-B6100, and the resulting reaction system was placed in a constant temperature fluorescence gene detector RAA-F1620 to detect the fluorescence signal;

[0075] 5) Based on the positive determination method in the RAA-F1620 instrument, select a threshold method to determine the positive / negative nature of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, then within 20 minutes, wells with fluorescence values ​​greater than 300 will be considered positive, and all others will be considered negative.

[0076] Next, the sensitivity, repeatability and specificity of the primers of the present invention to the probe were tested.

[0077] 1. Sensitivity test

[0078] (1) Primers

[0079] Upstream primer: 5′- TTCAGGTCGCTGGATTTGACTATTCGTGTG-3′.

[0080] Downstream primer: 5′- GCCCGTTTAGTAAAAACTCTACTTCAACGT-3′;

[0081] (2) Probe

[0082] The probe sequences are:

[0083] 5′-CACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTGCCCAATATGATCG-3′;

[0084] The probe was modified with a fluorescent reporter group (FAM) and a fluorescent quencher group (BHQ1);

[0085] The modified probes are:

[0086] 5′-TGGGAGGGTGTTGACTACAGCTACAATAAC / i6FAMdT / / iTHF / / iBHQ1dT / TTTACCAGATGCAGA (C3 spacer)-3′.

[0087] (3) Prepare plasmid working standards, which are:

[0088] Working standard 1, containing 10 7 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0089] Working standard 2, containing 10 6 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0090] Working standard 3, containing 10 5 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0091] Working standard 4, containing 10 4 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0092] Working standard 5, containing 10 3 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0093] Working standard 6, containing 10 2 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0094] Working standard 7, containing 10 1 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0095] Working standard 8, containing 10 0 copies / μL BRV VP6 plasmid non-infectious DNA fragment.

[0096] (4) Sensitivity implementation method:

[0097] Step 1. Prepare the reaction solution (prepare according to 10 reactions):

[0098] To 250 μL of reaction buffer, add 137 μL of water, 21 μL of 10 μM upstream and downstream primers, and 6 μL of probe. Mix thoroughly and then add to the RAA fluorescent basic reaction reagent to obtain a reaction premix.

[0099] Step 2: Redissolve the RAA fluorescent basic reaction reagent

[0100] Prepare 9 RAA fluorescence basic reaction reagents. Pipette 43.5 μL of the reaction buffer mixed in step 1 and add it to the 9 prepared RAA fluorescence basic reaction tubes to fully dissolve and mix the lyophilized powder to form the RAA reaction system. Then mark it.

[0101] Step 3, sample addition reaction

[0102] Add 2.5 μL MgCl2 to the caps of the 9 prepared RAA fluorescence-based reaction tubes. 2+ Then, 4 μL of standard working product 1, 4 μL of standard working product 2, 4 μL of standard working product 3, 4 μL of standard working product 4, 4 μL of standard working product 5, 4 μL of standard working product 6, 4 μL of standard working product 7, 4 μL of standard working product 8, and 4 μL of negative control as template were added to the tubes respectively, and the total volume of each reaction tube was 50 μL.

[0103] Step 4: Testing and results

[0104] The 9 reaction tubes were placed in a constant temperature oscillating mixer RAA-B6100 and mixed thoroughly. The mixed 9 reaction tubes were placed in a constant temperature fluorescent gene detector RAA-F1620, and the reaction temperature was set to 40°C and the reaction time was 20 min.

[0105] Based on the positive determination method in the RAA-F1620 test instrument, select the threshold method to determine the positive and negative of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, then within 20 minutes, wells with fluorescence values ​​greater than 300 will be judged as positive, and the rest will be judged as negative.

[0106] Test results such as Figure 2 The figure shows the results of a single RAA sensitivity experiment. In order to confirm the detection limit of this method, the above sensitivity experiment was repeated 3 times. The results showed that the detection limit within 20 minutes was 1 copy / reaction, achieving rapid and sensitive detection results.

[0107] Table 1: RAA sensitivity test table

[0108] Working Standards copies / μL RAA 1 <![CDATA[10 7 ]]> 3 / 3 2 <![CDATA[10 6 ]]> 3 / 3 3 <![CDATA[10 5 ]]> 3 / 3 4 <![CDATA[10 4 ]]> 3 / 3 5 <![CDATA[10 3 ]]> 3 / 3 6 <![CDATA[10 2 ]]> 3 / 3 7 <![CDATA[10 1 ]]> 3 / 3 8 <![CDATA[10 0 ]]> 3 / 3

[0109] 2. Repeatability Experiment

[0110] (1) The sequences of primers, probes and negative control samples were the same as those in Example 1.

[0111] (2) Using working standard 2 and working standard 3 (containing 10 6 copies / μL and 10 5 Verify the repeatability by 3 copies / μL of each of BRVVP6 gene plasmid and non-infectious DNA fragment:

[0112] (3) Repeatable implementation method:

[0113] Step 1. Prepare the reaction solution (prepare according to 10 reactions):

[0114] To 250 μL of reaction buffer, add 137 μL of water, 21 μL of 10 μM upstream and downstream primers, and 6 μL of probe. Mix thoroughly and then add to the RAA fluorescent basic reaction reagent to obtain a reaction premix.

[0115] Step 2: Redissolve the RAA fluorescent basic reaction reagent

[0116] Prepare 7 RAA fluorescence basic reaction reagents. Pipette 43.5 μL of the reaction buffer mixed in step 1 and add it to the 7 prepared RAA fluorescence basic reaction tubes to fully dissolve and mix the lyophilized powder to form the RAA reaction system. Then mark the reagents.

[0117] Step 3: Add sample and react

[0118] Add 2.5 μL MgCl2 to the caps of the 7 prepared RAA fluorescence-based reaction tubes. 2+ Then, add 4 μL of negative control to one of the 7 prepared RAA fluorescence-based reaction tubes, add 4 μL of standard working product 2 as template to 3 of the reaction tubes, and add 4 μL of standard working product 3 as template to the other 3 reaction tubes. The total volume of each reaction tube is 50 μL.

[0119] Step 4: Testing and results

[0120] The 7 reaction tubes were placed in a constant temperature oscillating mixer RAA-B6100 and mixed thoroughly. The mixed 7 reaction tubes were placed in a constant temperature fluorescent gene detector RAA-F1620, and the reaction temperature was set to 40 °C and the reaction time was 20 min.

[0121] Based on the positive determination method in the RAA-F1620 test instrument, select the threshold method to determine the positive and negative of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, then within 20 minutes, wells with fluorescence values ​​greater than 300 will be judged as positive, and the rest will be judged as negative.

[0122] Test results such as Figure 3 As shown: The results show that except for the negative quality control, working standard 2 and working standard 3 were amplified within 20 minutes, with good reproducibility.

[0123] 3. Specificity experiments

[0124] (1) The sequences of primers, probes and negative control samples were the same as those in Example 1.

[0125] (2) The nucleic acid-positive samples of bovine rotavirus (BRV), bovine respiratory syncytial virus (BRSV), bovine infectious rhinotracheitis virus (IBRV), bovine viral diarrhea (BVDV), and bovine coronavirus (BCoV) in the specific experiments were provided by the Animal Disease Monitoring Office of the China Animal Health and Epidemiology Center.

[0126] (3) Sample extraction method:

[0127] The samples were pretreated (homogenized) and then nucleic acid was extracted using the Tianlong virus automated DNA / RNA extraction method; the samples were stored at -20°C until use.

[0128] (4) Specific experimental implementation methods:

[0129] Step 1. Prepare the reaction solution (prepare according to 10 reactions):

[0130] To 250 μL of reaction buffer, add 137 μL of water, 21 μL of 10 μM upstream and downstream primers, and 6 μL of probe. Mix thoroughly and then add to the RAA fluorescent basic reaction reagent to obtain a reaction premix.

[0131] Step 2: Redissolve the RAA fluorescent basic reaction reagent

[0132] Prepare 7 RAA fluorescence basic reaction reagents. Pipette 43.5 μL of the reaction buffer mixed in step 1 and add it to the 7 prepared RAA fluorescence basic reaction tubes to fully dissolve and mix the lyophilized powder to form the RAA reaction system. Then mark the reagents.

[0133] Step 3, sample addition reaction

[0134] Add 2.5 μL MgCl2 to the caps of the 7 prepared RAA fluorescence-based reaction tubes. 2+ Then, 4 μL of bovine respiratory syncytial virus (BRSV)-positive nucleic acid, 4 μL of bovine infectious rhinotracheitis virus (IBRV)-positive nucleic acid, 4 μL of bovine viral diarrhea (BVDV)-positive nucleic acid, 4 μL of bovine coronavirus (BCoV)-positive nucleic acid, 4 μL of bovine rotavirus (BRV)-positive nucleic acid, 4 μL of positive quality control, and 4 μL of negative quality control were added to the tubes as templates, respectively. The total volume of each reaction tube was 50 μL.

[0135] Step 4: Testing and results

[0136] The seven reaction tubes were placed in a constant temperature oscillating mixer RAA-B6100 and mixed thoroughly. The mixed seven reaction tubes were placed in a constant temperature fluorescent gene detector RAA-F1620, and the reaction temperature was set to 40°C and the reaction time was 20 min.

[0137] Based on the positive determination method in the RAA-F1620 test instrument, select the threshold method to determine the positive and negative of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, then within 20 minutes, wells with fluorescence values ​​greater than 300 will be judged as positive, and the rest will be judged as negative.

[0138] Test results such as Figure 4 As shown: The results showed that only the bovine rotavirus positive samples and positive quality control products had obvious amplification, and the positive nucleic acids of bovine respiratory syncytial virus (BRSV), bovine infectious rhinotracheitis virus (IBRV), bovine viral diarrhea (BVDV), and bovine coronavirus (BCoV) had no obvious amplification, showing good specificity.

[0139] Example 3 Actual sample detection

[0140] (1) The sequences of primers, probes and negative control samples were the same as those in Example 1.

[0141] (2) A total of 8 clinical samples (1 to 8) were provided by the Animal Disease Surveillance Office of the Chinese Academy of Animal Health and Epidemiology;

[0142] (3) Sample extraction method:

[0143] The samples were pretreated (homogenized) and then nucleic acid was extracted using the Tianlong virus automated DNA / RNA extraction method; the samples were stored at -20°C until use.

[0144] (4) Implementation methods

[0145] Step 1. Prepare the reaction solution (prepare according to 10 reactions):

[0146] To 250 μL of reaction buffer, add 137 μL of water, 21 μL of 10 μM upstream and downstream primers, and 6 μL of probe. Mix thoroughly and then add to the RAA fluorescent basic reaction reagent to obtain a reaction premix.

[0147] Step 2: Redissolve the RAA fluorescent basic reaction reagent

[0148] Prepare 10 RAA fluorescence basic reaction reagents. Pipette 43.5 μL of the reaction buffer mixed in step 1 and add them to the 10 prepared RAA fluorescence basic reaction tubes to fully dissolve and mix the lyophilized powder to form the RAA reaction system. Then mark the tubes.

[0149] Step 3, sample addition reaction

[0150] Add 2.5 μL MgCl2 to the caps of the 10 prepared RAA fluorescence-based reaction tubes. 2+ Then, 4 μL of negative control material was added to one of the 10 prepared RAA fluorescence-based reaction tubes, and 4 μL of clinical sample nucleic acid was added to each of the other 8 reaction tubes. The total volume of each reaction tube was 50 μL.

[0151] Step 4: Testing and results

[0152] Place 10 reaction tubes in a constant temperature oscillating mixer RAA-B6100 and mix thoroughly. Place the 10 mixed reaction tubes in a constant temperature fluorescent gene detector RAA-F1620, set the reaction temperature to 40°C, and the reaction time to 20 min.

[0153] Based on the positive determination method in the RAA-F1620 test instrument, select the threshold method to determine the positive and negative of the curve. If the automatic threshold is set to 300 and the qualitative threshold is set to 20, then within 20 minutes, wells with fluorescence values ​​greater than 300 will be judged as positive, and the rest will be judged as negative.

[0154] Test results such as Figure 5 As shown: The results showed that the nucleic acid of 8 clinical samples had a 100% coincidence rate through the RAA detection method and the qPCR detection method, and all were positive; the negative quality control product had no amplification, while the positive quality control product showed the target curve.

[0155] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer pair and probe combination for detecting bovine rotavirus based on recombinase isothermal amplification fluorescence method, wherein the primer pair is used to amplify a partial fragment of a fragment having a sequence of SEQ ID NO: 1, and the probe is used to detect the product amplified by the primers; The sequence of the upstream primer of the primer pair is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO: 3; The sequence of the probe is SEQ ID NO: 4; The probe is modified with a fluorescent reporter group and a fluorescent quencher group. The fluorescent reporter group is modified at a position 31 bp away from the 5' end base of the probe sequence; the fluorescent quencher group is modified at a position 16 bp away from the 3' end base of the probe sequence. There is one base C between the fluorescent reporter group and the quencher group, which is replaced by a tetrahydrofuran residue. The fluorescent reporter group is FAM, and the fluorescent quencher group is BHQ1.

2. Use of the primer pair and probe combination as claimed in claim 1 in preparing a RAA fluorescence detection kit.

3. A RAA fluorescence detection kit for detecting bovine rotavirus, characterized in that: The kit comprises the primer pair and probe combination according to claim 1.

4. A method for rapid detection of bovine rotavirus based on recombinase isothermal amplification fluorescence method for non-disease diagnosis and treatment purposes, characterized in that: The method is to use the RAA fluorescence detection kit according to claim 3 for detection, comprising the following steps: 1) Extracting nucleic acid samples from the subject to be tested; 2) Connect the constant temperature oscillating mixer to the power supply for preheating and set the reaction parameters; the reaction parameters are set to 39°C and the reaction time is 4 minutes; Connect the constant temperature fluorescent gene detector to the power supply for preheating and set the reaction parameters; the reaction parameters are set to 40 °C and the reaction time is 20 minutes; 3) Add 13.7 μL of water, 2.1 μL of upstream and downstream primers at a concentration of 10 μM, and 0.6 μL of probe at a concentration of 10 μM to 25 μL of reaction buffer, mix thoroughly, and add to the RAA fluorescent basic reaction reagent to obtain a reaction premix; 4) Add 2.5 μL of Mg to the reaction tube cap. 2+ , 4 μL of the nucleic acid sample obtained in step 1) and the reaction premix obtained in step 3) are fully mixed in a constant temperature oscillating mixer, and the obtained reaction system is placed in a constant temperature fluorescent gene detector to detect the fluorescent signal; 5) According to the positive determination method in the constant temperature fluorescence gene detection instrument, select the threshold method to determine the positivity of the curve; when the automatic threshold is set to 300 and the qualitative threshold is set to 200, within 20 minutes, the wells with fluorescence values ​​greater than 300 will be judged as positive, and the rest will be judged as negative.

Images