A recombinant bovine rotavirus strain and a preparation method and application thereof
By constructing a combination of attenuated bovine rotavirus rescue plasmids and fusing exogenous proteins at the NSP3 protein terminus, the problem of multivalent vaccines for diarrhea in newborn calves and piglets was solved, achieving effective prevention against multiple pathogens and improving virus stability and rescue efficiency.
Patent Information
- Application Number
- CN202510990116.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2045-07-18
AI Technical Summary
Existing technologies are insufficient to effectively prevent diarrhea in newborn calves and piglets, and the development of multivalent vaccines has not yet solved the problem of diarrhea caused by multiple pathogens.
Using a combination of attenuated bovine rotavirus rescue plasmids, attenuated bovine rotavirus strains were obtained by transfection into BHK-21-T7 cells and proliferation in Marc-145 cells. Recombinant bovine rotavirus strains were then constructed to prepare multivalent vaccines by fusing bovine coronavirus, porcine epidemic diarrhea virus, or Clostridium perfringens proteins to the NSP3 protein terminus.
It has achieved effective prevention of diarrhea in newborn calves and piglets, provided a multivalent vaccine solution, improved virus stability and rescue efficiency, and ensured vaccine safety and immunization efficacy.
Smart Images

Figure CN120485280B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of bovine rotavirus vaccine, and particularly relates to a recombinant bovine rotavirus strain and a preparation method and application thereof. BACKGROUND
[0002] Newborn calf diarrhea is one of the main causes of calf death, accounting for more than 50% of the total number of calf deaths, and the calves that have diarrhea but do not die have reduced growth performance and milk yield, which brings serious economic losses and potential threats to the breeding industry. There are many pathogenic agents that cause newborn calf diarrhea, such as viruses, bacteria and protozoa, and multiple pathogenic agents can also participate simultaneously. Among the many pathogenic agents that cause newborn calf diarrhea, bovine rotavirus (BRV), bovine coronavirus (BCoV) and Clostridium perfringens (Cp) are the most common pathogenic agents that cause newborn calf diarrhea.
[0003] Rotavirus (RV) belongs to the Rotavirus genus of the Reoviridae family, and is one of the main pathogenic agents that cause acute gastrointestinal infectious diseases in infants and young animals. BCoV is a single-stranded RNA virus with a capsid, belongs to the order of the sleeve virus, the family of the coronavirus, the subfamily of the positive coronavirus, and the genus of the beta coronavirus, and is one of the pathogenic agents that cause newborn calf diarrhea, adult cattle winter dysentery, and respiratory diseases in cows and calves. Clostridium perfringens is a common environmental bacterium, and when the body's resistance decreases due to stress, the bacteria multiply in the body, produce toxins (the most important is alpha toxin), and cause diarrhea in calves and sudden death in adult cattle. Porcine Epidemic Diarrhea Virus (PEDV) is one of the main pathogenic agents that cause diarrhea in piglets. Therefore, for the prevention and control of diarrhea in newborn calves and piglets, it is a technical problem to be solved to construct a multi-vaccine. SUMMARY
[0004] The application aims to provide a multi-vaccine that can prevent diarrhea in calves and piglets and uses bovine rotavirus as a carrier.
[0005] The application provides a combination of attenuated bovine rotavirus rescue plasmids, wherein the bovine rotavirus rescue plasmid is pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3BLR, pT7 / NSP4BLR and pT7 / NSP5BLR 11 plasmids obtained by connecting the sequences shown in SEQ ID NO. 2-12 respectively and taking pT7 vector as a starting vector.
[0006] The present application provides a live attenuated bovine rotavirus rescue system, comprising a live attenuated bovine rotavirus strain rescued by the rescue plasmid combination.
[0007] Further limited, the live attenuated bovine rotavirus rescue system is to transfect the rescue plasmid combination into BHK-21-T7 cells, harvest the culture to proliferate the virus on Marc-145 cells, and rescue to obtain the live attenuated bovine rotavirus strain.
[0008] The present application provides the use of the above-mentioned rescue plasmid or the above-mentioned rescue system in the preparation of a live attenuated bovine rotavirus vaccine or a drug.
[0009] The present application provides a recombinant bovine rotavirus strain, wherein the coding gene end of the sequence shown as SEQ ID NO. 10 in the pT7 / NSP3BLR plasmid in the above-mentioned live attenuated bovine rotavirus strain is connected to the sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14, and then connected to the sequences shown as SEQ ID NO. 15, SEQ ID NO. 16 or SEQ ID NO. 17, respectively, to obtain the recombinant bovine rotavirus strain.
[0010] The present application provides the use of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and bovine coronavirus dual vaccine or a drug.
[0011] The present application provides a recombinant bovine rotavirus strain, wherein the coding gene end of the sequence shown as SEQ ID NO. 10 in the pT7 / NSP3BLR plasmid in the above-mentioned live attenuated bovine rotavirus strain is connected to the sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14, and then connected to the sequence shown as SEQ ID NO. 18, to obtain the recombinant bovine rotavirus strain.
[0012] The present application provides the use of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and porcine epidemic diarrhea virus dual vaccine or a drug.
[0013] The present application provides a recombinant bovine rotavirus strain, wherein the coding gene end of the sequence shown as SEQ ID NO. 10 in the pT7 / NSP3BLR plasmid in the above-mentioned live attenuated bovine rotavirus strain is connected to the sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14, and then connected to the sequence shown as SEQ ID NO. 19, to obtain the recombinant bovine rotavirus strain.
[0014] The present application provides the use of the above-mentioned recombinant bovine rotavirus strain in the preparation of a bovine rotavirus and Clostridium perfringens dual vaccine or a drug.
[0015] Beneficial effects: After the rescue of rotavirus, attenuated rescued rotavirus is obtained, based on the attenuated rotavirus after rescue, modification is carried out, and through fusion expression of the protein of bovine coronavirus, the protein of porcine epidemic diarrhea virus or the protein of Clostridium perfringens at the end of NSP3 protein, a recombinant virus strain is obtained, which plays a role in preventing two diseases as a double vaccine. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 Figure for identification of rescued virus rBLR;
[0017] Figure 2 Figure for rBLR calf pathogenicity test results;
[0018] Figure 3 Figure for screening test results of flexible Linker that can increase the efficiency of foreign protein cleavage;
[0019] Figure 4 Figure for BCoV protective antigen design and recombinant plasmid construction strategy results;
[0020] Figure 5 Figure for identification results of recombinant rotavirus rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD;
[0021] Figure 6 Figure for in vivo characteristics results of rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD;
[0022] Figure 7 Figure for immunogenicity evaluation results of rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD;
[0023] Figure 8 Figure for detection results of anti-BRV and BCoV IgG in serum;
[0024] Figure 9 Figure for construction strategy results of BLR as a broad-spectrum carrier to express foreign proteins;
[0025] Figure 10 Figure for identification results of recombinant viruses of BLR as a broad-spectrum carrier to express foreign proteins;
[0026] Figure 11 Figure for in vivo characteristics results of rBLR-PEDV-CTD, rBLR-Cp-α;
[0027] Figure 12 Figure for immunogenicity evaluation results of rBLR-PEDV-CTD, rBLR-Cp-α. DETAILED DESCRIPTION
[0028] The original vector of the 11 gene segments is the same, namely pT7 sequence is: (SEQ ID NO. 1);
[0029] The sequences of the following different gene segments are cloned into the pT7 vector, that is, 11 recombinant plasmids are constructed.
[0030] The sequences of the 11 gene segments are: VP1 (SEQ ID NO. 2); VP2 (SEQ ID NO. 3); VP3 (SEQ ID NO. 4); VP4 (SEQ ID NO. 5); VP6 (SEQ ID NO. 6): VP7 (SEQ ID NO. 7): NSP1 (SEQ ID NO. 8):
[0031] NSP2 (SEQ ID NO. 9); NSP3 (SEQ ID NO. 10): NSP4 (SEQ ID NO. 11): NSP5 (SEQ ID NO. 12)
[0032] Flexible Linker (SEQ ID NO. 13); AGAAAGAGAAGGGGAAGCGGC; P2A (SEQ ID NO. 14):
[0033] GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCT;
[0034] BCoV S1 CTD (SEQ ID NO. 15); BCoV S1 NTD (SEQ ID NO. 16); BCoV S1 RBD (SEQ ID NO. 17); PEDV S1 CTD (SEQ ID NO. 18); Cp-α (SEQ ID NO. 19).
[0035] Example 1. Screening of high-efficiency cleavage 2A peptides for efficient expression of foreign proteins in recombinant bovine rotavirus
[0036] I. Bovine rotavirus rescue plasmid
[0037] The original vector was pT7, purchased from Addgene (https: / / www.addgene.org / ), and the sequence is shown in SEQ ID NO. 1. The pT7 / VP1 BLR vector: VP1 (SEQ ID NO. 2) was inserted into the original vector pT7; the pT7 / VP2 BLR vector: VP2 (SEQ ID NO. 3) was inserted into the original vector pT7; the pT7 / VP3 BLR vector: VP3 (SEQ ID NO. 4) was inserted into the original vector pT7; the pT7 / VP4 BLR vector: VP4 (SEQ ID NO. 5) was inserted into the original vector pT7; the pT7 / VP6 BLR vector: VP6 (SEQ ID NO. 6) was inserted into the original vector pT7; the pT7 / VP7 BLR vector: VP7 (SEQ ID NO. 7) was inserted into the original vector pT7; the pT7 / NSP1 BLR vector: NSP1 (SEQ ID NO. 8) was inserted into the original vector pT7; the pT7 / NSP2 BLR vector: NSP2 (SEQ ID NO. 9) was inserted into the original vector pT7; the pT7 / NSP3 BLR vector: NSP3 (SEQ ID NO. 10) was inserted into the original vector pT7; the pT7 / NSP4 BLR vector: NSP4 (SEQ ID NO. 11) was inserted into the original vector pT7; the pT7 / NSP5 BLR vector: NSP5 (SEQ ID NO. 12) was inserted into the original vector pT7. The BLR strain is a further attenuated strain of the attenuated vaccine strain LLR (Patent: ZL200910161345.4) after 10 passages of continuous adaptation in suspension MDBK cells, and is named BLR. The nucleotide sequences of SEQ ID NO. 2-10 are from the BLR strain.
[0038] II. Bovine rotavirus rescue system
[0039] The 11 plasmids pT7 / VP1 BLR, pT7 / VP2 BLR, pT7 / VP3 BLR, pT7 / VP4 BLR, pT7 / VP6 BLR, pT7 / VP7 BLR, pT7 / NSP1 BLR, pT7 / NSP2 BLR, pT7 / NSP3 BLR, pT7 / NSP4 BLR and pT7 / NSP5 BLR obtained in Example 1 were mixed. The 11 plasmids were each transfected into BHK-21-T7 cells using Lipo3000 transfection reagent at 0.6 μg per plasmid, and the transfected cells were cultured for 2 days, after which Marc-145 cells were added to the cell wells for co-culture for 2 days, and the culture was harvested for virus propagation on Marc-145 cells to obtain the rescued virus rBLR.
[0040] The results show that the transfection complex can produce typical CPE of rotavirus on Marc-145 cells in successive passages Figure 1 A), IFA shows that the infected cells can effectively bind with rotavirus specific antibodies Figure 1 C), the RNA electrophoresis band of the rescued virus rBLR is consistent with the parent BLR Figure 1 E), the molecular tag shows that the A base at position 334 of the NSP3 gene of the rescued virus rBLR is mutated to G Figure 1 F). These results show that the obtained virus rBLR is rescued, not wild virus pollution.
[0041] The pathogenicity of the rescued rBLR strain is studied by orally inoculating the new-born calves which do not eat colostrum, and the results show that the rBLR inoculated calves do not cause clinical diarrhea Figure 2 Aa), RT-PCR method cannot detect virus in the feces and intestinal tissues of the rBLR inoculated calves Figure 2 Ba), while the control virulent strain inoculated calves can cause clinical diarrhea Figure 1 Ab), and can detect virus in the feces and intestinal tissues Figure 2 Bb). Figure 1 to prove that the rBLR is successfully rescued, Figure 2 to prove that the rBLR is not pathogenic to the calves, and the results show that the rBLR is an attenuated strain.
[0042] III. The coding genes of VP1-VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5 proteins of rotavirus are recombined, and the rescued virus is either not rescued or the rescued virus is unstable. The construction of the recombinant plasmid of the embodiment is to insert the exogenous gene in the coding gene of the NSP3 protein, and the innovation lies in adding the PKRRGSG flexible Linker and the P2A coding sequence between the exogenous protein coding sequence and the NSP3 protein coding sequence, and after adding the flexible linker sequence, the cutting efficiency of P2A is significantly improved Figure 3 , thereby improving the rescue efficiency of the virus and improving the stability of the virus, as shown in Figure 5 E and Figure 10 Eb, the recombined NSP3 gene still exists stably (the recombined NSP3 gene is migrated from the original 8th segment to the 4th and 5th and the 5th and 6th segments after the exogenous gene is inserted) after the rescued virus is continuously passed for 10 generations. The exogenous gene is lost after the previous related research virus is passed for 10 generations, which is a fatal disadvantage for vaccine research, and the problem is solved by introducing the flexible Linker and the P2A sequence in the embodiment.
[0043] To screen for the 2A self-cleaving peptide with the highest cleavage efficiency and shortest amino acid length, the amino acid sequences of four self-cleaving 2A peptides (P2A derived from porcine cyclovir type 1, T2A derived from tussock moth virus, E2A derived from equine rhinitis virus, and F2A derived from foot-and-mouth disease virus) were first compared and analyzed. A highly conserved region was identified at the C-terminus of the selected four 2A peptides, and this region participates in the self-cleavage process. Figure 3 A). Subsequently, the encoding genes for BLRNSP3 protein and the model protein eGFP protein were amplified, and the amplified products were sequentially inserted into the eukaryotic expression vector pCAGGS using the Takara In-Fusion cloning kit. Simultaneously, four different 2A sequences were fused to the C-terminus of the BLR NSP3 protein, linking the BLR NSP3 ORF and eGFP via different 2A peptides, resulting in recombinant plasmids with four different 2A peptides: pCAGGS-BLR NSP3-X2A-eGFP. In each recombinant plasmid, the rotavirus NSP3 gene and the eGFP protein gene are linked in an open reading frame via a 2A peptide, where X represents P, T, E, and F. Furthermore, to facilitate the cleavage of the exogenous protein fused to the NSP3 C-terminus, a flexible linker encoding the nucleotide sequence "arginine-lysine-arginine-arginine-glycine-serine-glycine (RKRRGSG)" was added to the 5' end of the 2A sequence. Figure 3 A) 2A peptides with flexible linkers are named GX2A. For example, F2A is a 2A peptide from foot-and-mouth disease virus, while GF2A is an F2A with a flexible linker. These recombinant plasmids were then transfected into HEK 293T cells using PEI transfection reagent. Cell samples were collected 48 hours after transfection, and Western blotting was used to compare the expression and cleavage efficiency of exogenous protein eGFP mediated by F2A, P2A, E2A, and T2A.
[0044] When the four types of 2A function, cleavage occurs at the 2A recognition site (between glycine G and proline P), producing eGFP protein. Incomplete cleavage results in NSP3-eGFP fusion protein. A higher ratio of expressed eGFP protein to total expressed protein (eGFP protein + NSP3-eGFP fusion protein) indicates higher cleavage efficiency. Western blotting analysis showed that the cleavage efficiency and eGFP expression levels varied among the four types of 2A. Furthermore, the native 2A cleavage function was inefficient, failing to effectively cleave the BLR NSP3-eGFP fusion protein, resulting in a large amount of fusion protein (NSP3-eGFP) and no separately expressed eGFP protein. Figure 3 B). The cleavage efficiency of P2A was significantly improved after the addition of the flexible linker, resulting in the formation of a separately expressed eGFP protein (B).Figure 3 Ca). Further, the WB images were analyzed by gray value analysis using a thin layer scanning imaging system, and the gray value of each band was used to calculate the cleavage efficiency formula (cleavage efficiency = gray value of eGFP protein band / (gray value of NSP3-eGFP fusion protein band + gray value of eGFP protein band) * 100%). The ratio of the amount of eGFP protein and total protein formed after cleavage was compared, and the results showed that the ratio of GP2A was the highest, followed by GT2A, GE2A and GF2A, which were 97%, 62%, 45% and 34%, respectively. Figure 3 Cb). It is shown that the cleavage efficiency of GP2A is the highest, followed by GT2A, GE2A and GF2A. The above research results show that RKRRGSG-P2A with the highest cleavage efficiency and the shortest length is the ideal choice of high-efficiency cleavage 2A peptide for high-efficiency expression of foreign proteins in recombinant bovine rotavirus.
[0045] Example 2. Recombinant rotavirus containing BCoV antigens
[0046] 1. Design and synthesis of primers:
[0047] The recombinant plasmids expressing BCoV protective antigen proteins S1 NTD, CTD and RBD were constructed using rotavirus BLR strain as a backbone vector. The primers were designed according to the accurate sequences of S1 NTD, S1 CTD and S1 RBD genes of BCoV strains isolated in the laboratory in the early stage, and the primers were synthesized by Riboer Biotechnology Co., Ltd. (the primer sequences are shown in Table 1).
[0048] 2. Construction of recombinant plasmids:
[0049] pT7 / NSP3-2A-BCoV CTD vector construction: the end of the NSP3 coding sequence in the vector pT7 / NSP3BLR is connected with the flexible linker coding sequence (SEQ ID NO. 13) and P2A coding sequence (SEQ ID NO. 14) and CTD coding sequence (SEQ ID NO. 15) sequence. According to the virus RNA extraction kit instructions for BCoV extraction nucleic acid, using reverse transcription kit BCoV RNA reverse transcription into cDNA, with synthetic cDNA as template, using the primer designed in step 1 for amplification of BCoV S1-CTD gene segment and vector fragment pT7-BLR-NSP3, in order to realize the "self-cleavage" expression of NSP3 and foreign protein, and improve the self-cleavage efficiency, the end of the NSP3 protein coding sequence in the vector pT7-BLR-NSP3 is introduced with flexible linker and P2A coding sequence, so that the flexible linker, P2A and CTD are fused with the C terminal of NSP3 protein. Using Takara In-Fusion cloning kit for homologous recombination of amplified BCoV S1-CTD gene segment and vector fragment pT7-BLR-NSP3, finally get pT7 / NSP3-2A-BCoV CTD reverse genetic recombination plasmid, for expressing BCoV CTD recombinant rotavirus rescue ( Figure 4 ).
[0050] pT7 / NSP3-2A-BCoV NTD vector construction: the end of the NSP3 coding sequence in the vector pT7 / NSP3BLR is connected with the flexible linker coding sequence (SEQ ID NO. 13) and P2A coding sequence (SEQ ID NO. 14) and NTD coding sequence (SEQ ID NO. 16) sequence. According to the virus RNA extraction kit instructions for BCoV extraction nucleic acid, using reverse transcription kit BCoV RNA reverse transcription into cDNA, with synthetic cDNA as template, using the primer designed in step 1 for amplification of BCoV S1-NTD gene segment and vector fragment pT7-BLR-NSP3, in order to realize the "self-cleavage" expression of NSP3 and foreign protein, and improve the self-cleavage efficiency, the end of the NSP3 protein coding sequence in the vector pT7-BLR-NSP3 is introduced with flexible linker and P2A coding sequence, so that the flexible linker, P2A and NTD are fused with the C terminal of NSP3 protein. Using Takara In-Fusion cloning kit for homologous recombination of amplified BCoV S1-NTD gene segment and vector fragment pT7-BLR-NSP3, finally get pT7 / NSP3-2A-BCoV NTD reverse genetic recombination plasmid, for expressing BCoV NTD recombinant rotavirus rescueFigure 4 ).
[0051] pT7 / NSP3-2A-BCoV RBD vector construction: the end of the NSP3 coding sequence in the vector pT7 / NSP3BLR is connected with the flexible linker coding sequence (SEQ ID NO. 13) and P2A coding sequence (SEQ ID NO. 14) and RBD coding sequence (SEQ ID NO. 17) sequence. According to the virus RNA extraction kit instructions, the nucleic acid of BCoV is extracted, and the BCoV RNA is reverse transcribed into cDNA using the reverse transcription kit. The synthesized cDNA is used as a template to amplify the gene segment of BCoV S1-RBD and the vector fragment pT7-BLR-NSP3 using the primer designed in step 1. In order to realize the "self-cleavage" expression of NSP3 and foreign protein, and improve the self-cleavage efficiency, the flexible linker and P2A coding sequence are introduced at the end of the NSP3 protein coding sequence in the vector pT7-BLR-NSP3, so that the flexible linker, P2A and RBD are fused with the C-terminal of NSP3 protein. The amplified gene segment of BCoV S1-RBD and the vector fragment pT7-BLR-NSP3 are subjected to homologous recombination using Takara In-Fusion cloning kit, and finally the pT7 / NSP3-2A-BCoV RBD reverse genetic recombination plasmid is obtained, which is used for expressing BCoV RBD recombinant rotavirus rescue ( Figure 4 ).
[0052] The results show that: the specific PCR amplification of the inserted fragment was carried out on the recombinant plasmids pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, pT7 / NSP3-2A-BCoV-RBD, respectively, and single bands of about 645 bp (BCoV S1 CTD), 849 bp (BCoV S1 NTD), 938 bp (BCoV S1 RBD) were amplified, which were consistent with the expected target bands. The recombinant plasmids were named as pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, pT7 / NSP3-2A-BCoV-RBD, respectively. Sequence determination was carried out on each recombinant plasmid, and it was determined that all the plasmids were successfully constructed.
[0053] 3. Rescue of recombinant rotavirus expressing BCoV protective antigen protein CTD: Mix 11 plasmids pT7 / VP1 BLR, pT7 / VP2 BLR, pT7 / VP3 BLR, pT7 / VP4 BLR, pT7 / VP6 BLR, pT7 / VP7 BLR, pT7 / NSP1 BLR, pT7 / NSP2 BLR, pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP4 BLR and pT7 / NSP5 BLR. Transfect BHK-21-T7 cells with 11 plasmids, 0.6 μg for each plasmid, using Lipo3000 transfection reagent. Culture the transfected cells for 2 days, then add Marc-145 cells to the cell wells for co-culture for 2 days. Harvest the culture and propagate the virus on Marc-145 cells to obtain recombinant rotavirus expressing BCoV protective antigen protein CTD (rBLR-BCoV-CTD).
[0054] 4. Rescue of recombinant rotavirus expressing BCoV protective antigen protein NTD: Mix 11 plasmids pT7 / VP1 BLR, pT7 / VP2 BLR, pT7 / VP3 BLR, pT7 / VP4 BLR, pT7 / VP6 BLR, pT7 / VP7 BLR, pT7 / NSP1 BLR, pT7 / NSP2 BLR, pT7 / NSP3-2A-BCoV-NTD, pT7 / NSP4 BLR and pT7 / NSP5 BLR. Transfect BHK-21-T7 cells with 11 plasmids, 0.6 μg for each plasmid, using Lipo3000 transfection reagent. Culture the transfected cells for 2 days, then add Marc-145 cells to the cell wells for co-culture for 2 days. Harvest the culture and propagate the virus on Marc-145 cells to obtain recombinant rotavirus expressing BCoV protective antigen protein NTD (rBLR-BCoV-NTD).
[0055] 5. Rescue of recombinant rotavirus expressing BCoV protective antigen protein RBD: Mix 11 plasmids pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-BCoV-RBD, pT7 / NSP4BLR and pT7 / NSP5BLR. Transfect BHK-21-T7 cells with 11 plasmids, 0.6 μg each, using Lipo3000 transfection reagent. Incubate transfected cells for 2 days, then add Marc-145 cells to the cell wells for 2 days of co-cultivation. Harvest the culture and propagate the virus on Marc-145 cells to obtain recombinant rotavirus expressing BCoV protective antigen protein RBD (rBLR-BCoV-CTD).
[0056] 6. Identification of recombinant rotavirus expressing BCoV protective antigen protein
[0057] After the rescued recombinant virus rBLR-BCoV-NTD / CTD / RBD was amplified for 1-2 passages, the biological characteristics of the produced recombinant virus were identified by PCR, indirect immunofluorescence, WB, and RNA electrophoresis, and the genetic stability and virus growth characteristics of the recombinant rotavirus were determined, thereby obtaining a recombinant rotavirus expressing the protective antigen of BCoV. For PCR identification, after the genomic RNA of the recombinant rotavirus was extracted using a nucleic acid extraction kit, it was reverse transcribed into cDNA, and the synthesized cDNA was used as a template to identify the recombinant rotavirus using BCoV S1-NTD, S1-CTD, and BLR NSP3 specific primers (Table 1), and sequencing was performed. For RNA electrophoresis analysis of the recombinant rotavirus, the recombinant rotavirus was mixed with RNA extraction buffer at a ratio of 1:1, phenol-chloroform-isoamyl alcohol was added and mixed thoroughly, and the mixture was allowed to stand at room temperature for 10 min, and then centrifuged at 12,000 rpm at 4°C for 10 min. Then, 30 μL of the deep blue supernatant was taken and subjected to RNA-PAGE. The mixture was electrophoresed in a 10% polyacrylamide gel at room temperature for 1 h, and then transferred to a refrigerator at 4°C for electrophoresis. The electrophoresis was performed at 10 mA for 16 h. After the electrophoresis was completed, the gel was fixed with a fixing solution for 30 min. The gel was washed with distilled water three times, and then stained with silver nitrate solution for 30 min. The gel was washed with distilled water three times, and then developed with a color developing solution for about 10 min until the bands were clear, and the RNA migration profile was determined. For indirect immunofluorescence identification, Marc-145 cells were cultured in a 12-well culture dish, and 1 MOI of the recombinant rotavirus was added. After 9 h of infection, the cells were fixed with pre-cooled methanol for 30 min. The cells were incubated in 5% BSA at room temperature for 30 min, washed with PBST three times, and then rabbit anti-BLR polyclonal antibody and mouse anti-BCoV polyclonal antibody were added and incubated at room temperature for 1 h. The cells were washed with PBST three times, and then Alexa 488 anti-mouse IgG (green) and Alexa 594 anti-rabbit IgG (red) were added and incubated at room temperature for 30 min. The cells were washed with PBST three times, and then DAPI was added and incubated at room temperature for 15 min. Fluorescence microscopy was used for analysis. For WB analysis, Marc-145 cells were cultured in a 12-well culture dish, and 1 MOI of the recombinant rotavirus was added. After 9 h of infection, the cells were collected and lysed with a protein lysis solution for 30 min. The proteins were electrophoretically separated on a 10% polyacrylamide (SDS) gel, and then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk for 1 h, and then incubated with rabbit anti-BLR polyclonal antibody, mouse anti-BCoV polyclonal antibody, or rabbit monoclonal β-actin antibody at room temperature for 1 h. The membrane was washed with PBST three times, and then incubated with a HRP-labeled corresponding secondary antibody at room temperature for 1 h. The membrane was washed with PBST three times, and then developed with ECL. The expression of BCoV protein in the recombinant rotavirus was detected using an EB Lot imaging system.For genetic stability determination, the recombinant rotavirus was serially passaged on Marc-145 cell monolayer, and when the cells showed obvious CPE, the cell samples were collected and freeze-thawed three times repeatedly, and the lysate was clarified by low-speed centrifugation, and the genetic stability was analyzed by RNA electrophoresis. For growth characteristic analysis, the recombinant rotavirus was used to infect monolayer Marc-145 cells at MOI = 0.01, and after adsorption at 37°C for 1 h, the cells were washed twice with PBS, and cultured in serum-free medium containing a final concentration of 0.5 μg / mL trypsin, and at 0, 6, 12, 24, 48 h after infection, the cell samples were collected, freeze-thawed three times repeatedly, and the TCID. 50 The virus titers at each time point were determined, and the values of TCID 50 at each time point were plotted as a line graph to draw the multi-step growth curve of the recombinant rotavirus.
[0058] The results showed that after freeze-thawing the cell culture of the transfected generation twice, inoculating Marc-145 cells, and culturing for 24-48 h, rotavirus-specific CPE could be observed, showing cell shrinkage and aggregation, unclear fine boundaries, cell surface disintegration, large interstitial spaces, and shedding and death, and the rescued viruses were named rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD. The NSP3 full gene of the BLR parent virus (rBLR) and the rescued viruses (rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD) was amplified by the RT-PCR method established in the laboratory, the PCR products were identified by 1% agarose electrophoresis, and the PCR products were sequenced. The results showed that the PCR products of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD were one 1818 bp, 2022 bp, and 2111 bp band, respectively, and the PCR product of the parent virus rBLR was one 1074 bp band, and sequence analysis confirmed that the nucleotide sequences of the 8th segment of the rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD recombinant rotavirus matched the inserted sequences of pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, and pT7 / NSP3-2A-BCoV-RBD plasmids, respectively.
[0059] RNA electrophoresis identification of recombinant rotavirus dsRNA genomic fragments revealed that the recombinant viruses rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD rescued using pT7 / NSP3-2A-BCoV-CTD, pT7 / NSP3-2A-BCoV-NTD, or pT7 / NSP3-2A-BCoV-RBD plasmids contained segment 8 dsRNA. Their migration rate was slower than that of the parental rBLR virus segment 8 dsRNA. These dsRNAs migrated on polyacrylamide gels, near the positions of segments 4 or 5, consistent with the predicted band size. Figure 5 A) indicates that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD are rescued viruses, not wild-type strains. Western blot (WB) and in vitro ablation (IFA) tests using rabbit anti-bovine rotavirus polyclonal antibodies and mouse anti-bovine coronavirus polyclonal antibodies showed that cells inoculated with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD all exhibited specific bands. Figure 5 B) and specific fluorescence ( Figure 5 (C) indicates that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD can all induce the expression of BCoV CTD, NTD, and RBD proteins.
[0060] The growth kinetics of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in Marc-145 cells showed that the viruses had similar replication kinetics to the parent rBLR. Figure 5 D). These data indicate that rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD carry modified BLR gene fragment 7 during viral replication and express the BCoV protective antigens CTD, NTD, and RBD in infected cells. To assess the genetic stability of recombinant rotavirus, rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD were passaged five times consecutively in Marc-145 cells at MOI=1, and their genetic stability was analyzed by RNA electrophoresis. The results showed that the size of 11 genomic fragments, including fragment 8, remained unchanged in the five consecutive passages, indicating that these viruses have good genetic stability and can be stably passaged ( Figure 5 E).
[0061] Example 3. Immunogenicity evaluation of recombinant rotavirus expressing BCoV protective antigen protein
[0062] 1. Effects of exogenous protein gene insertion on BLR replication and pathogenicity in vivo
[0063] To evaluate the effects of BCoV S1 CTD, S1 NTD, and S1 RBD gene insertion on rotavirus (RV) replication in vivo, and to assess the safety of parental rBLR and recombinant viruses rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in suckling mice, rBLR-BCoV-CTD, rBLR-BCoV-NTD, or parental rBLR (5 × 10⁻⁶) were inserted. 8 TCID 50 Five-day-old BALB / c pups were inoculated with 0.5 mL of homologous culture medium, while healthy controls (con) were orally administered 0.5 mL of the medium. The diarrhea rate and fecal rotavirus shedding were compared over 10 days. Similar to rBLR, rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD induced diarrhea in the early post-infection period in BALB / c suckling mice. Figure 6 A), but rotavirus was not detected in the feces of BALB / c pups (A). Figure 6 B). These data indicate that in BALB / c juvenile mice, rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD were associated with diarrhea to a similar degree as rBLR, exhibiting clinical diarrhea but without viral shedding, suggesting they are safe.
[0064] 2. Immunogenicity evaluation of rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in adult BALB / c mice.
[0065] To investigate the induction of antibody responses against BCoV by rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD in BALB / c mice, 25 six-week-old SPF-grade female BALB / c mice were randomly divided into 5 groups (① rBLR-BCoV-CTD intramuscular live vaccine group; ② rBLR-BCoV-NTD intramuscular live vaccine group; ③ rBLR-BCoV-RBD intramuscular live vaccine group; ④ rBLR+BCoV group (rBLR+BCoV served as a positive control group, with mice receiving intramuscular injections of 10...). 8.5 TCID 50⑤ Healthy control group (con group): 5 mice per group, all mice were housed and managed separately. Except for the healthy control group which received 0.5 mL of homologous culture medium intramuscularly, all mice received 10 mL of live virus vaccine rBLR and BCoV. 8.5 TCID 50 0.5 mL of live virus per mL was added with 10% ISA 15A adjuvant, and the same dose of virus was administered intramuscularly again 2 weeks after immunization. Figure 7 A) Clinical symptoms of mice in each group were observed daily for 0-7 days after inoculation; mouse serum was collected weekly, and neutralizing antibody levels were detected using a neutralization test, as follows: Bovine rotavirus and bovine coronavirus virus solutions were treated with 50 μg / ml trypsin solution at 37°C for 1 hour. Mouse serum was serially diluted 2-fold starting at a 1:8 ratio using serum-free DMEM maintenance solution containing 10 μg / ml trypsin. The trypsin-treated virus was diluted to 1000 TCID. 50 Add an equal volume of diluted virus to serially diluted serum samples, neutralize at 37°C for 1 h, and culture Marc-145 (rotavirus neutralizing antibody assay) or HRT-18G cells (coronavirus neutralizing antibody assay) in 96-well cell culture plates for 48 h. Wash twice with PBS, add the serum-virus mixture to 96-well cell culture plates, with two replicates per sample, adding the virus sequentially according to the serum dilution from highest to lowest. Include positive and negative controls. Incubate at 37°C for 1 h for adsorption, add serum-free DMEM maintenance medium, and continue culturing at 37°C. CPE was observed daily, and the endpoint was determined after 5 days of culture. Neutralizing antibody titers were calculated using the Reed-Muench method. Serum IgG antibody levels were detected using indirect ELISA, specifically as follows: Bovine rotavirus or bovine coronavirus virus solutions were diluted with coating buffer at a ratio of 1:4, and 100 μL / well was added to each well of the ELISA plate. The plate was incubated overnight at 4°C. 5% BSA diluted in PBS was added, and the plate was blocked at 37°C for 1 h. Mouse serum was diluted with PBST at a ratio of 1:200, and 100 μL / well was added to each well of the ELISA plate. The plate was incubated at 37°C for 1 h. HRP-labeled goat anti-mouse IgG was added, and the plate was incubated at 37°C for 1 h. TMB substrate buffer was added, and the reaction was carried out in the dark for 15 min. The reaction was terminated by adding 2 M H₂SO₄. Furthermore, to detect the presence of antibodies against rotavirus and coronavirus in mouse serum, indirect immunofluorescence (IFA) was used to identify the antibodies in mouse serum collected at 21 days.
[0066] Results showed that all sera from rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD immunized adult mice reacted with RV at 7 d, and the anti-RV IgG titers were further increased at 21 d after the booster immunization (Fig. 5A, 5B, 5C, and 5D). Figure 7 Notably, the booster immunization induced seroconversion of BCoV in rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD immunized adult mice at 21 d, and the anti-BCoV specific antibody levels in sera from rBLR-BCoV-NTD immunized mice were higher than those from rBLR-BCoV-CTD and rBLR-BCoV-RBD immunized mice at each time point (Fig. 5A, 5B, 5C, and 5D). Figure 7 Ba). To further detect whether the mouse sera contained antibodies against BRV or BCoV, the 21 d collected mouse sera were identified by IFA method. The sera from rBLR-BCoV-CTD, rBLR-BCoV-NTD, rBLR-BCoV-RBD or rBLR+BCoV immunized mice all strongly reacted with BRV infected Marc-145 cells or BCoV infected HRT-18G cells, and the staining signal from rBLR-BCoV-NTD group was the strongest (Fig. 6A, 6B, 6C, and 6D), indicating that the sera from rBLR-BCoV-NTD immunized BALB / C mice had strong specific reaction to BCoV S1 protein. The above results showed that the sera from rBLR-BCoV-NTD immunized adult mice contained antibodies against BRV and BCoV, and the secondary booster immunization enhanced the immune response to BRV and BCoV. Figure 8 ), indicating that the sera from rBLR-BCoV-NTD immunized BALB / C mice had strong specific reaction to BCoV S1 protein. The above results showed that the sera from rBLR-BCoV-NTD immunized adult mice contained antibodies against BRV and BCoV, and the secondary booster immunization enhanced the immune response to BRV and BCoV.
[0067] Further evaluation of the neutralization activity of BRV and BCoV serum antibodies found that the sera from each group of mice could neutralize BRV, and the levels of neutralizing antibodies in each group were not significantly different. When the neutralizing antibody was the highest, the anti-rotavirus neutralizing antibody titer of rBLR-BCoV-NTD group was 1:1536 (Fig. 6Cb, Table 2). In addition, the detection of anti-BCoV neutralizing antibodies found that the level of neutralizing antibodies produced by rBLR-BCoV-NTD group was higher than that of rBLR-BCoV-CTD and rBLR-BCoV-RBD groups, and the BCoV neutralizing antibody titer produced by rBLR-BCoV-NTD group was 1:64 at 28 d (Fig. 6Ca, Table 2). These results showed that the rBLR-BCoV-NTD recombinant virus could induce a high level of antibodies against BCoV in BALB / C adult mice. Figure 7 Ca, Table 2). These results showed that the rBLR-BCoV-NTD recombinant virus could induce a high level of antibodies against BCoV in BALB / C adult mice.
[0068] Example 4. Recombinant rotavirus expressing Clostridium perfringens alpha toxin and PEDV antigen
[0069] 1. Constructing recombinant plasmids expressing Clostridium perfringens alpha toxin protein (Cp-α) and PEDV protective antigen protein S1 CTD using rotavirus BLR strain as a backbone vector. Figure 9 )。
[0070] (1) Constructing pT7 / NSP3-2A-Cp-α vector: connecting the end of the NSP3 coding sequence in the vector pT7 / NSP3BLR with the flexible linker coding sequence (SEQ ID NO. 13) and the P2A coding sequence (SEQ ID NO. 14) and the Cp-α coding sequence (SEQ ID NO. 18) obtained.
[0071] Using the step 1 designed and synthesized primer pair to amplify the gene segment of Cp-α and the vector fragment pT7-BLR-NSP3 using Clostridium perfringens alpha toxin DNA as a template. In order to realize the "self-cleavage" expression of NSP3 and foreign protein and improve the self-cleavage efficiency, the flexible linker and P2A coding sequence were introduced at the end of the NSP3 coding sequence in the vector pT7-BLR-NSP3, so that the flexible linker, P2A and Cp-α were fused with the C-terminal of NSP3 protein. Using Takara In-Fusion cloning kit to perform homologous recombination on the amplified Cp-α gene segment and the vector fragment pT7-BLR-NSP3, and finally obtaining the pT7 / NSP3-2A-Cp-α reverse genetic recombination plasmid (pT7 / NSP3-2A-Cp-α) for expressing Cp-α recombinant rotavirus rescue. Figure 9 ), which is used for expressing Cp-α recombinant rotavirus rescue.
[0072] (2) Constructing pT7 / NSP3-2A-PEDV CTD vector: connecting the end of the NSP3 coding sequence in the vector pT7 / NSP3BLR with the flexible linker coding sequence (SEQ ID NO. 13) and the P2A coding sequence (SEQ ID NO. 14) and the PEDV CTD coding sequence (SEQ ID NO. 18) obtained.
[0073] According to the virus RNA extraction kit, the nucleic acid of PEDV is extracted, the reverse transcription kit is used to reverse transcribe the PEDV RNA into cDNA, the synthesized cDNA is used as a template, the primer designed and synthesized in step 1 is used to amplify the gene segment of PEDV S1-CTD and the vector fragment pT7-BLR-NSP3, in order to realize the “self-cleavage” expression of NSP3 and the foreign protein, and improve the self-cleavage efficiency, the flexible linker and P2A coding sequence are introduced into the terminal of the NSP3 coding sequence of the vector pT7-BLR-NSP3, the flexible linker, P2A and PEDV S1-CTD are fused with the C-terminal of the NSP3 protein, the Takara In-Fusion cloning kit is used for homologous recombination of the amplified PEDV S1-CTD gene segment and the vector fragment pT7-BLR-NSP3, and finally the pT7 / NSP3-2A-PEDV CTD reverse genetic recombination plasmid is obtained. Figure 9 ), which is used for expressing the PEDV CTD recombinant rotavirus rescue.
[0074] 2. Rescue of recombinant rotavirus expressing Cp-α: mix pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-Cp-α, pT7 / NSP4BLR and pT7 / NSP5BLR 11 plasmids. Use Lipo3000 transfection reagent to co-transfect BHK-21-T7 cells with 0.6 μg of each plasmid, culture the transfected cells for 2 days, then add Marc-145 cells to the cell wells for co-culture for 2 days, harvest the culture to propagate the virus on Marc-145 cells to obtain the recombinant rotavirus expressing Cp-α.
[0075] 3. Rescue of recombinant rotavirus expressing PEDV CTD: mix pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3-2A-PEDV CTD, pT7 / NSP4BLR and pT7 / NSP5BLR 11 plasmids. Use Lipo3000 transfection reagent to co-transfect BHK-21-T7 cells with 11 plasmids, culture the transfected cells for 2 days, then add Marc-145 cells to the cell wells for co-culture for 2 days, harvest the culture to propagate the virus on Marc-145 cells to obtain the recombinant rotavirus expressing PEDV CTD.
[0076] The results showed that after transfecting contemporary cell cultures and performing two freeze-thaw cycles, rotavirus-specific cytopathic effects (CPE) were observed in Marc-145 cells after 24-48 hours of culture. These CPE manifested as cell shrinkage and aggregation, indistinct cell boundaries, cell surface disintegration, increased intercellular spaces, and cell death. The rescued viruses were named rBLR-Cp-α and rBLR-PEDV-CTD, respectively. Using a laboratory-established RT-PCR method, the complete NSP3 gene of the parental virus rBLR and the rescued viruses rBLR-Cp-α and rBLR-PEDV-CTD was amplified. The PCR products were identified by 1% agarose gel electrophoresis, and sequence analysis confirmed that the nucleotide sequences of the 8th gene segment of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses matched the insertion sequences of the corresponding recombinant plasmids. RNA electrophoresis analysis of the recombinant rotavirus dsRNA genome revealed that the molecular weight of the dsRNA segment 8 of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses was larger than that of the parental rBLR segment 8, consistent with the predicted band size. Figure 9 (A, b) indicates that these recombinant viruses are rescue viruses, not wild-type strains. Western blot (WB) and in vitro analyte (IFA) tests using rabbit anti-bovine rotavirus polyclonal antibody, mouse anti-PEDV S1 polyclonal antibody, or mouse anti-Clostridium perfringens α toxin protein polyclonal antibody showed that cells inoculated with rBLR-Cp-α and rBLR-PEDV-CTD recombinant rotaviruses all exhibited specific bands. Figure 9 Ba, b) and specific fluorescence ( Figure 9 C a, b). Growth kinetics of the recombinant virus in Marc-145 cells showed that the replication titer of the recombinant virus was essentially consistent with that of the parental virus rBLR ( Figure 9 (D a, b). To assess the genetic stability of recombinant rotaviruses, rBLR-Cp-α and rBLR-PEDV-CTD were passaged five times consecutively in Marc-145 cells at MOI=1, and their genetic stability was analyzed by RNA electrophoresis. The results showed that the sizes of all 11 genomic fragments of the rBLR-Cp-α and rBLR-PEDV-CTD recombinant viruses remained unchanged throughout the five passages, indicating that these viruses possess good genetic stability and can be stably passaged. Figure 9 E a, b). These results demonstrate that the method of this invention can be used to express different protective antigen proteins and has broad-spectrum carrier applicability.
[0077] 4. Safety Evaluation of Recombinant Viruses rBLR-Cp-α and rBLR-PEDV-CTD To investigate the safety of rBLR-Cp-α and rBLR-PEDV-CTD inoculated into mice, rBLR, rBLR-Cp-α, and rBLR-PEDV-CTD were orally administered to BALB / c suckling mice. The results showed that, similar to rBLR, rBLR-Cp-α and rBLR-PEDV-CTD were safe in BALB / c suckling mice infected (5 × 10⁻⁶) 8 TCID 50 Early diarrhea following ( / mL) Figure 11 A), but rotavirus was not detected in feces ( Figure 11 B). These data indicate that in BALB / C juvenile mice, the association between rBLR-Cp-α and rBLR-PEDV-CTD and diarrhea is similar to that of rBLR, both causing diarrhea but without eliciting toxins, suggesting they are safe.
[0078] 5. Immunogenicity Evaluation of Recombinant Viruses rBLR-Cp-α and rBLR-PEDV-CTD To evaluate the immunogenicity of rBLR-Cp-α and rBLR-PEDV-CTD in adult BALB / c mice, especially the induction of antibody responses to rBLR-Cp-α toxin and PEDV by rBLR-Cp-α and rBLR-PEDV-CTD in BALB / c mice, recombinant viruses were administered to BALB / c mice via intramuscular injection. Results showed that all sera from adult mice inoculated with rBLR-Cp-α or rBLR-PEDV-CTD reacted with BRV as early as 7 days of age, and after a booster immunization at 14 days, serum anti-RV IgG titers further increased at 21 days of age. Figure 12 Aa). Boosted immunization resulted in adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD showing serological seroconversion to PEDV or Cp-α at 21 days, with OD at 21 days... 450 The values were 0.29 and 0.36 respectively. Figure 12 Based on these findings, we conclude that the serum of adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD contains antibodies against BRV and PEDV or Cp-α, and that secondary booster immunization enhances the immune response against BRV and PEDV or Cp-α.
[0079] Further evaluation of the neutralization activity of BRV serum antibodies found that the serum of adult mice immunized with rBLR-Cp-α or rBLR-PEDV-CTD had the ability to neutralize BRV, and both showed a growing trend with time. After the second immunization at 14 d, the antibodies further increased, and by 14 d after the second immunization, the antibody levels began to decrease. At the highest level of neutralizing antibodies, the anti-rotavirus neutralizing antibody titer of the rBLR-PEDV-CTD group was 1:768, and the anti-rotavirus neutralizing antibody titer of the rBLR-Cp-α group was 1:768. Figure 12 B, Table 3). In addition, the anti-PEDV neutralizing antibody titer of the serum of the mice immunized with rBLR-PEDV-CTD at 28 d was determined, and the results showed that the neutralizing antibody titer was 1:64, indicating that the recombinant virus rBLR-PEDV-CTD could produce neutralizing antibodies against PEDV in mice; the mice immunized with the recombinant rotavirus rBLR-Cp-α at 35 d were injected intraperitoneally with a lethal dose of Clostridium perfringens alpha toxin, and the clinical symptoms were observed daily, and the protective effect of the recombinant rotavirus rBLR-Cp-α against alpha toxin was evaluated by calculating the survival rate of the mice, wherein the mortality rate of each treatment group was represented as: mortality rate (%) = (number of mice died / total number of mice) x 100, and the cumulative mortality rate was calculated. The results showed that the protective rate of the serum of the mice immunized with the recombinant rotavirus rBLR-Cp-α at 35 d against Clostridium perfringens alpha toxin was 80% (4 / 5), and the protective rate of the corresponding alpha toxin subunit vaccine immunization group was 100% (5 / 5). These data support the conclusion that rBLR-Cp-α or rBLR-PEDV-CTD induces an antibody response against PEDV or Cp-α in BALB / C adult mice.
[0080] Table 1 Primer sequences for amplifying BCoV protective antigen protein, Clostridium perfringens alpha toxin protein, and PEDV protective antigen protein
[0081]
[0082] Table 2 Average of neutralizing antibody titers against BRV and BCoV in serum of mice inoculated with rBLR-BCoV-CTD, rBLR-BCoV-NTD, and rBLR-BCoV-RBD
[0083]
[0084] Table 3 Average of neutralizing antibody titers against BLR in serum of mice inoculated with rBLR-Cp-α and rBLR-PEDV-CTD
[0085]
Claims
1. A recombinant bovine rotavirus strain, characterized in that, The recombinant bovine rotavirus strain obtained by connecting the sequence of SEQ ID NO. 13, SEQ ID NO. 14 and then connecting the sequence of SEQ ID NO. 15 or SEQ ID NO. 16 to the end of the coding gene of the sequence shown in SEQ ID NO. 10 in the pT7 / NSP3BLR plasmid in the attenuated bovine rotavirus strain; the attenuated bovine rotavirus strain rescued by the rescue plasmid combination; the bovine rotavirus rescue plasmid is the pT7 / VP1BLR, pT7 / VP2BLR, pT7 / VP3BLR, pT7 / VP4BLR, pT7 / VP6BLR, pT7 / VP7BLR, pT7 / NSP1BLR, pT7 / NSP2BLR, pT7 / NSP3BLR, pT7 / NSP4BLR and pT7 / NSP5BLR plasmids obtained by connecting the sequences shown in SEQ ID NO. 2-12 respectively with the pT7 vector as the starting vector.
2. The recombinant bovine rotavirus strain of claim 1 for use in the preparation of a bovine rotavirus and bovine coronavirus bivalent vaccine or drug.
Citation Information
Patent Citations
Rotavirus gene recombined strain and construction method and application thereof
CN101633910A
Sheep rotavirus recombinant plasmid, reverse genetic virology rescue system as well as construction method and application of reverse genetic virology rescue system
CN117947096A