Codling moth nuclear polyhedrosis virus strains and their application in biopesticides

Abstract

The present invention belongs to the technical field of biological control of agricultural pests, and specifically discloses a codling moth nuclear polyhedrosis virus strain and its application in biological insecticides. The strain was deposited in the China Center for Type Culture Collection on April 25, 2024, and the deposited name is codling moth nuclear polyhedrosis virus Cydia pomonella nucleopolyhedrovirus, the deposit number is CCTCC NO: V202451, and the deposit address is Wuhan University, China. Compared with the prior art, the CypoNPV virus provided by the present invention has a strong toxicity to codling moth, has a good development and application prospect, and has application value in preparing insecticides and preventing and controlling codling moth.

Description

Technical Field

[0001] The invention relates to the technical field of biological control of agricultural pests, in particular to a codling moth nuclear polyhedrosis virus strain and application thereof in biological insecticides. Background Art

[0002] The codling moth (Cydia pomonella) belongs to the family Cydiapomonella in the order Lepidoptera and is an important quarantine pest of pome fruits worldwide. The codling moth has serious overlapping generations and has strong adaptability, resistance and reproductive capacity. It infests the fruit with its larvae, and the fruit infestation rate is generally over 50%, and can reach 70%-100% in severe cases, which seriously affects the production and sales of fruits.

[0003] Codling moth is widely distributed and difficult to eliminate once it colonizes. The main control measures for codling moth include plant quarantine, agricultural control, physical control, chemical control and biological control, but chemical control is still the main method for controlling codling moth. The long-term and frequent use of pesticides not only kills natural enemies and destroys the ecological balance, but also makes codling moth resistant to pesticides to varying degrees, increasing the cost and difficulty of control. Biological control plays an important role in the control of codling moth due to its wide source and environmental friendliness. At present, codling moth granulovirus CpGV is widely used in the control of codling moth in Europe and America, and multiple CpGV products have been registered, but codling moth populations resistant to CpGV continue to appear in the field. Therefore, the screening and development of new viruses or highly toxic strains play an important role in the prevention and control of codling moth. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a codling moth nuclear polyhedrosis virus strain and its application in biological pesticides.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] One of the purposes of the present invention is to provide a codling moth nuclear polyhedrosis virus strain, which was deposited in the China Center for Type Culture Collection on April 25, 2024, with the deposited name being codling moth nuclear polyhedrosis virus Cydiapomonella nucleopolyhedrovirus, and the deposited number being CCTCC NO:

[0007] V202451, the deposit address is Wuhan University, China.

[0008] The second object of the present invention is to provide a use of the codling moth nuclear polyhedrosis virus strain as claimed in claim 1 in the preparation of a biological insecticide for controlling codling moth.

[0009] The third object of the present invention is to provide a biological pesticide comprising the codling moth nuclear polyhedrosis virus strain.

[0010] A fourth object of the present invention is to provide a biopesticide for use in preventing and controlling apple codlings.

[0011] Compared with the prior art, the CypoNPV virus provided by the present invention has stronger toxicity to codling moth, has good development and application prospects, and has application value in preparing pesticides and preventing and controlling codling moth. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a picture of the symptoms of codling moth larvae after being infected with the virus.

[0013] Figure 2 These are electron microscope images of the codling moth nuclear polyhedrosis virus CypoNPV: A is a scanning electron microscope image; B is a transmission electron microscope image.

[0014] Figure 3 Phylogenetic tree of baculovirus based on lef-8, lef-9 and polh.

[0015] Figure 4 It is the corrected mortality rate of newly hatched larvae of codling moth infected with CypoNPV. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0017] Example 1: Acquisition of Cydia pomonella nuclear polyhedrosis virus CypoNPV.

[0018] Collect the dead codling moths suspected of virus infection during artificial breeding indoors, add appropriate amount of sterilized water (V:V = 1: 5-10) to grind or directly filter the liquid with 3 layers of gauze. Then centrifuge at low speed 800rpm for 5min, discard the precipitate, take the supernatant and centrifuge at 8000rpm for 10min and discard the supernatant, repeat 2-3 times, and obtain a light gray precipitate, which is the crude isolated virus. The precipitate is suspended in 20ul sterile water and stored at 4℃ or -20℃ for use. For further purification, the light gray precipitate is resuspended in 20% glycerol, added to the prepared 50 / 55 / 60% sucrose gradient, centrifuged at 12100g for 15 minutes, recovered the white band area at 55%-60%, resuspended in sterile water, centrifuged again at 12100g for 15 minutes to recover the precipitate, washed with sterile water 3 times, and the precipitate is the purified virus. The precipitate is suspended in sterile water and stored at 4℃ or -20℃ for use.

[0019] Using sterile distilled water as a control, cut the feed into small pieces (0.5×0.5×2cm), use a pipette to absorb 2μL of the purified virus suspension and drop it on the surface of the feed. After natural air drying, place the feed in a 24-well plate. After starving for 6 hours, the healthy 4-instar codling moth larvae that have been continuously raised indoors and have basically the same growth are picked into the above 24-well plate, and one larva is placed in each well. After 1 day, observe and replace with fresh feed. The dead larvae at this time are considered to be caused by human factors. The breeding temperature is 26±1℃, the relative humidity is 65±10%, and the light cycle is L:D=16:8. Observe the changes in the insect body every day and add feed in time.

[0020] When infected with the virus, the moth becomes less active, swollen, and has irregular pink or brown patches under the epidermis. After the larvae die, the body liquefies and is filled with white pus. The epidermis is loose and easily ruptured, and liquid oozes out with a slight touch, without any odor (see Figure 1 ). Based on the symptoms, the pathogen was preliminarily identified as a baculovirus, and it was proven that the pathogen could multiply and reproduce in the body of the codling moth and had pathogenicity.

[0021] Then, 10 μl of the purified virus suspension was taken with a pipette and spread on a tin foil of appropriate size. After drying naturally at room temperature, it was fixed on a metal table with a conductive double-sided tape. After gold spraying, the virus inclusion bodies were observed and photographed under a Hitachi Regulus 8100 scanning electron microscope at a voltage of 5 kV. Under the scanning electron microscope, the virus inclusion bodies were irregular in shape, mostly round or oval, with different sizes and a diameter of 0.5-1.1 μm (see Figure 2 A).

[0022] The purified virus was centrifuged to obtain the precipitate, 100 μl of hot-melt 1% agar was added, and the agar pre-embedded was completed by centrifugation at 1000 rpm for 5 minutes. The virus-embedded block was resuspended and mixed in the electron microscope fixative at 4°C for 2-4 hours, rinsed 3 times with 0.1M phosphate buffer (pH7.4), fixed at room temperature in the dark for 2 hours in 1% osmium acid prepared in 0.1M phosphate buffer (pH7.4), rinsed 3 times with 0.1M phosphate buffer (pH7.4), 15 minutes each time. Dehydrated step by step in gradient ethanol solution (30%, 50%, 70%, 80%, 95%, 100%, 100%), dehydration time 20 minutes, 100% acetone twice, 15 minutes each time. After dehydration, infiltrate at 37℃ for 2-4h in acetone: embedding agent = 1:1, then infiltrate at 37℃ overnight in acetone: embedding agent = 1:2, and infiltrate at 37℃ for 5-8h in pure embedding agent. Pour pure embedding agent into embedding plate, insert sample into embedding plate and place in oven at 37℃ overnight, place embedding plate in oven at 60℃ for polymerization for 48h, take out resin block for later use. Use ultra-thin slicer to slice at 60-80nm, and use 150 mesh square copper mesh to pick up slices. The copper mesh was stained with 2% uranyl acetate saturated alcohol solution in the dark for 8 minutes, washed 3 times with 70% alcohol, washed 3 times with ultrapure water, stained with 2.6% lead citrate solution in the dark for 8 minutes, washed 3 times with ultrapure water, slightly dried with filter paper, and the copper mesh slices were placed in a copper mesh box to dry overnight at room temperature, observed and photographed under a JEM1400PLUS transmission electron microscope; under the transmission electron microscope, the codling moth virus particles were rod-shaped, with 1-6 virus particles in each inclusion body, and the virus particles contained 1 or 2 nucleocapsids (see Figure 2 B) in the figure is consistent with the morphological characteristics of nuclear polyhedrosis virus.

[0023] After the virus type is determined, molecular identification of the virus is performed. The specific operations are as follows:

[0024] Take the purified virus precipitate and add appropriate amount of 0.1M Na 2 CO 3and 0.01M NaCl, pH10.5 to lyse the virus. After 1 hour, add 0.5% SDS to disperse the virus particles and neutralize with 1.0M HCl to pH8.0; add an equal volume of phenol:chloroform (1:1), extract twice, 12000rpm, 10min; add 2.5 times the volume of pre-cooled 95% ethanol and add 10% volume of 3M sodium acetate, mix well and let stand at -20℃ for 20-30min; the flocculent precipitate is DNA, centrifuge at 12000 for 10min, remove the supernatant, wash the precipitate with 70% ethanol 1-2 times; centrifuge at 12000rpm for 5min to retain the precipitate, add appropriate amount of sterilized ultrapure water to dissolve after drying, and store at -20℃ for later use. The extracted viral genomic DNA was used as a template, and the universal primers for identifying the conserved genes of polh / gran, lef-8 and lef-9 of baculovirus were selected (Jehle et al., 2006). The target fragments were amplified by PCR, purified and connected to the PMD-19 vector, and the positive clones were sent to Shanghai Biotech for sequencing. The sequencing results are as follows:

[0025] >polh

[0026] CCTGGGACCCGGCATAAACCAGAAGCTTACATTGTTCAAAGAAATCCGTAGCGTTAAGCCTGACACGATGAAACTCGTTGTTAACTGGAGCGGCAAAGAGTTTTTGAGGGAAACTTGGACCCGTTTC ATGGAAGATAGTTTCCCCATTGTAAACGACCAAGAAATTATGGATGTTTTCCTAGTAATTAACATGCGCCCAACTAGACCTAACCGTTGCTACAAGTTCCTTGCTCAACACGCTCTTCGTTGCGACCC AGATTACGTGCCTCACGAAGTAATTAGGATAGTTGAACCATCCTGGGTGGGAAGTAATAACGAATACCGCATTAGTCTGGCCAAGCGCGGTGGCGGATGTCCAGTGATGAACCTGCATTCTGAGTACA CCAATTCGTTCGAAGAGTTTATTAACAGAGTTATTTGGGAAAACTTTTACAAGCCCATAGTATACATTGGTACCGACTCTGCTGAGGAAGAGGAAATTCTTATGGAAGTTTCCTTGGTGTTCAAAGTA

[0027] >lef-8

[0028] AGTGGCGGGTAAAAAAATTTTTTCTGTGCCGCAACGTTCGTCTTCCGAATGTGGACTACGAAATTGTACGTGAAAAATTCAATAGATTAATTGATCAAAATTTAATAAATAAAGTGACCGACGACAACGACACGCAGGTTTTTAATTCAAACTCTGATTCGAAAACTTTGTGGCTAACTTTTAATGATCGTCCGACCGTTTTTTATTGTCAGAGAGCAGATTTGTACAAAATTTTCTACGAGTTGAAACGAGGTATGACACCGATAGAAATGAAAATGGCTAACGGGATTTTATTCATCAATCATCACGAAGGGATGATTTGTATTAAACGAACCGTGAAGGTAAACGGCCAAGCAA CTATCGTCACACTGTTAACTCCATATGAATACCACAACGGTTGTTCTATCCTAAACAGCACTACCGATGTGGGCACAATTATAGAAGACGATAACGTCGATTGTCTCATGTCAAAGTTGGTTCAGTATTATTACAAAAACTTTTTAAAAATTTACAGCACCATTCCGACACCCAAATTGATTGTATCTTTGACTAATTTGAAAAATGCCATGCCGATTTTGAATAGTGAAATCGATGAAGAAACTTTTCTAGACACACTACCCTTCGGCAATTGTGTCGCCGTCAAGCCTGAAATCAAACTTAATAACAAAATGTTCAAACTATGGACGATTGTGCGCGACAGTAGACTCATGACA

[0029] >courage-9

[0030] CAATTTTTATATTCTAATTTCCTTAACACGGCCTCTTTTTACGCTAATGTACAATGTTTAAACGGCGTCAACGAAATCGTACCGCCAAAGGCGAGCATCAAGCGATATTACGGGCGAGACGTTAAAAACGT TCGCGCATGGACCACTCGTCACCCTAACATTTCGCAATTGAGCACGCAAATATCGGAAGTCCATCAACCGAAAGAATATACAAATTGGAACGTCAAAGTTGGTTTGGGAATATTTACCGGTGCAAATACA.

[0031] Based on the conserved gene sequences of polh / gran, lef-8 and lef-9 baculovirus, multiple sequence alignment was performed using the clusterW tool in MEGA7.0 software, and a phylogenetic tree was constructed using the Maximum Likelihood method (ML method). Bootstrap was repeated 1000 times for testing, and the pairwise genetic distances of polh / gran, lef-8 and lef-9 gene sequences were calculated according to the Timura-2-parameter.

[0032] According to the identification criteria of baculoviruses (Jehle et al., 2006; ICTV), the phylogenetic tree and pairwise genetic distance analysis of lef-8, lef-9 and polh of some baculoviruses were constructed using MEGA7.0 software. According to the results of phylogenetic analysis, this virus is clustered into a large branch with other Lepidoptera NPV viruses, and has the highest similarity with CrpeNPV and EpgrNPV (see Figure 3 ), but the pairwise genetic distances were all greater than 0.05 (see Tables 1-3), and it was determined to be a new NPV virus, named CypoNPV, and deposited in the China Center for Type Culture Collection on April 25, 2024, with the deposited name Cydia pomonella nucleopolyhedrovirus and the deposit number CCTCC NO:

[0033] V202451, the deposit address is Wuhan University, China.

[0034] Table 1

[0035]

[0036] Note: The lower triangle is genetic distance, and the upper triangle is standard error.

[0037] Table 2

[0038]

[0039] Note: The lower triangle is genetic distance, and the upper triangle is standard error.

[0040] Table 3

[0041]

[0042]

[0043] Note: The lower triangle is genetic distance, and the upper triangle is standard error.

[0044] Example 2: Application of Cydia pomonella nuclear polyhedrosis virus CypoNPV

[0045] The purified CypoNPV suspension of Cypocystis apple moth was counted under an optical microscope using a hemocytometer. The purified CypoNPV suspension of Cypocystis apple moth was diluted to 1.79×10 1 , 1.79×10 2 , 1.79×10 3 , 1.79×10 4 and 1.79×10 5 OBs / mL, with sterile distilled water as the control. According to the artificial infection method, the newly hatched larvae (<8h) were bioassayed, and the larvae that died at this time were observed and replaced with fresh feed after 1 day. The larvae were considered to be caused by human factors. Observations were recorded according to the test requirements, the mortality rate was calculated, and the lethal median time of different virus concentrations was calculated. The obtained data were analyzed for variance using SPSS software.

[0046] The results of bioassays using CypoNPV to treat newly hatched larvae of codling moth are shown in Figure 4 .from Figure 4 It can be seen that using 1.79×10 1 , 1.79×10 2 , 1.79×10 3 , 1.79×10 4 and 1.79×10 5 After treatment with CypoNPV at OBs / mL, the mortality rate of newly hatched larvae of codling moth increased with the increase of virus concentration. Probit of SPSS software was used for linear regression analysis to calculate the half lethal concentration (LC) of newly hatched larvae of codling moth treated with CypoNPV on the 7th day. 50 is 3.41×10 3 OBs / mL, half lethal concentration LC on day 14 50 3.19 OBs / mL ( Figure 4The bioassay results showed that the LC50 of CypoNPV for newly hatched larvae of codling moth on the 7th day was 50 (3.41×10 3 OBs / mL) was lower than that of the domestic strain of Cydia pomonella granulovirus CpGV-WW (14.65×10 3 OBs / mL), CpGV-ALE (18.76×10 3 OBs / mL), equivalent to the Belgian commercial virus preparation strain CpGV-M (3.4×10 3 OBs / mL), indicating that CypoNPV has strong toxicity to codling moth and good development and application prospects.

[0047] Example 3: Preparation of biological insecticide for controlling codling moth

[0048] According to the test results of Example 2, a biopesticide was prepared, which contained a concentration of 1.79×10 5 OBs / mL or above suspension of Cydia pomonella nuclear polyhedrosis virus CypoNPV.

[0049] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A strain of Cydia pomonella nuclear polyhedrosis virus, characterized in that: The strain was deposited in the China Center for Type Culture Collection on April 25, 2024, and the preservation name is Cydia pomonella nuclear polyhedrovirus CypoNPV Cydia pomonellanucleopolyhedrovirus, the preservation number is CCTCC NO: V202451, and the preservation address is Wuhan University, China.

2. Use of the codling moth nuclear polyhedrosis virus strain as claimed in claim 1 in the preparation of a biological insecticide for controlling codling moth.

3. A biological insecticide, characterized in that: The method comprises the codling moth nuclear polyhedrosis virus strain as claimed in claim 1.

4. Use of the biological insecticide according to claim 3 in controlling codling moth.

Images