Use of intervening basophil EXOSC3 in the preparation of a drug for preventing or treating lupus nephritis
By interfering with the expression of EXOSC3 in basophils, inhibiting its activation, and developing new drugs to treat lupus nephritis, solving the problem of difficult to effectively treat refractory lupus nephritis in the prior art, achieving a significant improvement in renal pathology.
Patent Information
- Application Number
- CN202410951295.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2044-07-16
AI Technical Summary
The prior art is difficult to effectively treat refractory lupus nephritis, and long-term use of first-line drug hormones and immunosuppressants will cause serious side effects.
By interfering with the expression of EXOSC3 in basophils, EXOSC3 is knocked down or knocked out using CRISPR-Cas9 technology, siRNA, shRNA and other methods, thereby inhibiting the activation of basophils and developing new drugs to prevent or treat lupus nephritis.
It significantly inhibits the activation of basophils, reduces the expression of inflammatory factors IL-4, IL-6 and IL-13, weakens the activation level of T cells, improves the renal pathology of lupus mice, and provides new ideas for the treatment of lupus nephritis.
Smart Images

Figure CN118987030B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biopharmaceutical technology, and particularly to the application of interfering with basophil EXOSC3 in the preparation of drugs for preventing or treating lupus nephritis. Background Art
[0002] Systemic lupus erythematosus (SLE) is a typical autoimmune disease, the main feature of which is the disorder of the patient's own immune tolerance, leading to the imbalance of multiple cellular immune responses in the body, such as the over-activation of immune cells and the production of a large number of pro-inflammatory factors, thus involving multiple organs and systems and causing diseases, and the kidney is the most frequently involved organ, that is, lupus nephritis (LN). In lupus nephritis, T cells can participate in the pathological damage process through multiple pathways. First, T cells can stimulate the body to produce an inflammatory response and cause local tissue damage, thus causing symptoms such as proteinuria and hematuria. Second, T cells can also promote the fibrosis process, thus aggravating kidney damage and the deterioration of renal function. Currently, the first-line drugs for lupus nephritis are hormones and immunosuppressants, such as cyclophosphamide and mycophenolate mofetil. Although they can relieve the symptoms of lupus nephritis patients, they are ineffective for some refractory lupus nephritis patients, and long-term use will cause serious side effects. In recent years, targeted B-cell biologics, such as biologics targeting B-cell surface antigens or B-cell stimulating factors, can improve the condition of lupus nephritis to a certain extent. However, their non-specific clearance of B cells often interferes with the normal immune system, limiting their clinical application.
[0003] Therefore, for the treatment of lupus nephritis, it is urgent to explore new targets to develop safe and effective new drugs and provide new ideas for the treatment of lupus nephritis. Summary of the Invention
[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of interfering with basophil EXOSC3 in the preparation of drugs for preventing or treating lupus nephritis, providing a new intervention target for inhibiting basophil activation and a new way and means for treating autoimmune diseases mediated by basophil activation.
[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0006] In the first aspect, the present invention applies basophils that interfere with the expression of EXOSC3 to the preparation of drugs for preventing and / or treating lupus nephritis, and the interference includes knocking down or knocking out the expression of EXOSC3.
[0007] The present invention uses human basophils as the research object. By dividing them into a Control group, an Anti-IgE group, and an Anti-IgE+CQ group, proteomic detection is carried out. Subsequently, differentially expressed proteins that mediate basophil activation are intervened. The basophils after intervening the differentially expressed proteins are adoptively transferred into pristane-induced lupus mice. The results show that EXOSC3 expression is enhanced after basophil activation and decreased after inhibition of activation. After knocking down EXOSC3 in basophils, the levels of inflammatory factors IL-4, IL-6, and IL-13 expressed by them are significantly reduced. After co-culturing T cells with basophils with knocked-down EXOSC3, the activation level of T cells is significantly reduced. After adoptively transferring basophils with knocked-down Exosc3 into lupus mice, the kidney pathology is significantly improved. The present invention confirms that knocking down basophil EXOSC3 can significantly inhibit its activation and improve the kidney pathology of lupus mice, providing a new idea for the treatment of lupus diseases mediated by basophil activation.
[0008] As a preferred embodiment of the application described in the present invention, the method for knocking down the expression of basophil EXOSC3 includes performing gene editing using the CRISPR-Cas9 technology, and using siRNA, plasmid-mediated shRNA, or virus-mediated shRNA to silence EXOSC3.
[0009] As a preferred embodiment of the application described in the present invention, the nucleotide sequence of the shRNA is:
[0010] GCTTAATTAGAAAGCTATTAGCTCGAGCTAATAGCTTTCTAATTAAGCTTTTT or
[0011] GGTGCTGAATCAGGTGGTTCTCTCGAGAGAACCACCTGATTCAGCACCTTTTT.
[0012] In a second aspect, the present invention applies basophil EXOSC3 as a target in the preparation of reagents for preventing and / or treating lupus nephritis.
[0013] In a third aspect, the present invention applies an inhibitor targeting the expression of basophil EXOSC3 in the preparation of drugs for preventing and / or treating lupus nephritis.
[0014] As a preferred embodiment of the application described in the present invention, the basophils are basophils derived from peripheral blood.
[0015] In a fourth aspect, the present invention provides a preparation for preventing and / or treating lupus nephritis, including a substance that knocks down or knocks out the expression of basophil EXOSC3.
[0016] As a preferred embodiment of the preparation of the present invention, the substance for knocking down the expression of EXOSC3 in basophils is siRNA, dsRNA, shRNA, miRNA or antisense nucleic acid.
[0017] As a preferred embodiment of the preparation of the present invention, the nucleotide sequence of the shRNA is:
[0018] GCTTAATTAGAAAGCTATTAGCTCGAGCTAATAGCTTTCTAATTAAGCTTTTT or
[0019] GGTGCTGAATCAGGTGGTTCTCTCGAGAGAACCACCTGATTCAGCACCTTTTT.
[0020] As a preferred embodiment of the preparation of the present invention, it further comprises a pharmaceutically acceptable carrier.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] Basophils play a key role in autoimmune diseases. Basophils can recognize autoreactive IgE and be activated, promoting the differentiation of T helper cells and exacerbating the progression of lupus nephritis. The present invention finds that the expression of EXOSC3 is enhanced after the activation of basophils and decreased after the inhibition of activation. After knocking down EXOSC3 in basophils, the levels of inflammatory factors IL-4, IL-6 and IL-13 are significantly reduced. After co-culturing the basophils with knocked-down EXOSC3 and T cells, the activation level of T cells is significantly reduced. The present invention finds that basophils promote their activation through EXOSC3, and further promote the progression of lupus nephritis, confirming that knocking down EXOSC3 in basophils can significantly inhibit their activation and improve the renal pathology of lupus mice, providing a new idea for the treatment of lupus diseases mediated by basophil activation. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 For the results of proteomics detection and verification of interfering with basophil activation, where A is the result of proteomics detection of interfering with basophil activation; B is the result of Western blot verification of proteomics of interfering with basophil activation.
[0024] Figure 2 For the plasmid map of the recombinant plasmid for knocking down EXOSC3 in human basophils.
[0025] Figure 3To investigate the effect of knocking down EXOSC3 in human basophils on their activation, where A is the flow cytometry plot of the IL-4 expression level after knocking down EXOSC3 in basophils; B is the statistical chart of the IL-4 expression level after knocking down EXOSC3 in basophils; C is the flow cytometry plot of the IL-6 expression level after knocking down EXOSC3 in basophils; D is the statistical chart of the IL-6 expression level after knocking down EXOSC3 in basophils; E is the flow cytometry plot of the IL-13 expression level after knocking down EXOSC3 in basophils; F is the statistical chart of the IL-13 expression level after knocking down EXOSC3 in basophils; P<0.05 indicates significant difference, marked with *.
[0026] Figure 4 To investigate the effect of knocking down EXOSC3 in human basophils on T cell activation, where A is the flow cytometry plot of the T cell activation marker CD25; B is the statistical chart of the T cell activation marker CD25; C is the flow cytometry plot of the T cell activation marker CD44; D is the statistical chart of the T cell activation marker CD44; E is the flow cytometry plot of the T cell activation marker CD69; F is the statistical chart of the T cell activation marker CD69; P<0.05 indicates significant difference, marked with *.
[0027] Figure 5 Plasmid map of the recombinant plasmid for knocking down Exosc3 in mouse basophils.
[0028] Figure 6 Gating strategy and purity detection for flow cytometry sorting of mouse bone marrow-derived basophils.
[0029] Figure 7 Effect of adoptive transfer of basophils with knocked-down Exosc3 on kidney pathology in lupus mice. Detailed implementation manners
[0030] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0031] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels. The nucleotide sequence of human EXOSC3 can be found in sequence NM_016042.4 in NCBI, and the nucleotide sequence of mouse Exosc3 can be found in sequence NM_001362788.1 in NCBI.
[0032] Example 1: EXOSC3 is a key protein regulating basophil activation
[0033] The experimental intervention methods are as follows:
[0034] (1) Extraction of human basophils
[0035] 1) Place human peripheral blood in an EDTA anticoagulant tube into a 15 mL centrifuge tube, add 1 mL of HetaSep TM Solution, invert gently up and down to mix well, centrifuge (90 g, 5 min, room temperature), and let stand at room temperature for 10 min;
[0036] 2) Slowly transfer the plasma to a 50 mL centrifuge tube using a 3 mL Pasteur pipette, add 4 volumes of EasySep TM Buffer, invert gently up and down to mix well, centrifuge (120 g, 10 min, room temperature);
[0037] 3) Remove the supernatant using a 3 mL Pasteur pipette, resuspend with EasySep TM Buffer, centrifuge (120 g, 10 min, room temperature);
[0038] 4) Repeat step 3);
[0039] 5) Remove the supernatant using a 3 mL Pasteur pipette, resuspend the PBMC with 1.5 mL of EasySep TM Buffer, transfer the PBMC to a flow cytometry tube using a 200 μL pipette;
[0040] 6) Counting: Take 2 μL of the PBMC suspension into a 200 μL Ep tube, dilute it to 10 μL with EasySep TM Buffer, add 10 μL of trypan blue, gently pipette to mix well, take 10 μL and place it on a counting chamber for counting and detecting cell viability;
[0041] 7) Adjust the cell concentration to 5×10 7 cells / mL, add 50 μL of primary antibody per milliliter, gently pipette to mix well, let stand for 7 minutes, add the same volume of secondary antibody (vortex for 30 seconds before adding), resuspend the PBMC with EasySep TM Buffer to 2.5 mL, immediately place it in a magnet, let stand for 3 minutes, then directly pour the liquid into a new flow cytometry tube, repeat once, and finally obtain basophils.
[0042] (2) Proteomics detection and verification of activated human basophils
[0043] The basophils extracted in step (1) were grouped into three groups: Control, Anti-IgE, and Anti-IgE+CQ. In the Control group, no intervention was performed; in the Anti-IgE group, 1 μL / mL of Anti-IgE (Sigma, USA) was added and cultured for 24 hours to promote their activation; in the Anti-IgE+CQ group, 1 μL / mL of Anti-IgE (Sigma, USA) and 1 μL / mL of CQ (Sigma, USA) were added and cultured for 24 hours to inhibit activation.
[0044] Subsequently, the three groups of basophils were sent to Shanghai New Life Sciences Co., Ltd. for proteomics detection.
[0045] Finally, the proteomics results were verified by Western blotting.
[0046] The experimental results are shown in Figure 1 , and through cell activation-related cluster analysis, it was screened out that the expression of EXOSC3 was enhanced during basophil activation and decreased after inhibition of activation. The above results suggest that EXOSC3 is a key protein regulating basophil activation.
[0047] Example 2: Intervention of human basophil EXOSC3 to inhibit its activation level
[0048] The basophils extracted in step (1) of Example 1 were grouped into three groups: Control, Anti-IgE, and Anti-IgE+EXOSC3 KD . In the Control group, no intervention was performed; in the Anti-IgE group, 1 μL / mL of Anti-IgE (Sigma, USA) was added and cultured for 24 hours to promote their activation; in the Anti-IgE+EXOSC3 KD group, after knocking down EXOSC3 in basophils, 1 μL / mL of Anti-IgE (Sigma, USA) was added and cultured for 24 hours.
[0049] The process of knocking down human basophil EXOSC3 is as follows:
[0050] Preparation of the plasmid for knocking down EXOSC3: The Homo-EXOSC3-sh3 sequence was inserted into the plasmid pLK0.1-U6-EF1a-copGFP-T2A-puro (purchased from Guangzhou Aiji Biotechnology Co., Ltd.). The plasmid map of the recombinant plasmid pLKO.1-U6-Homo-EXOSC3-sh3-EF1a-copGFP-T2A-puro is shown in Figure 2 ; the nucleotide sequence of Homo-EXOSC3-sh3 is:
[0051] ccggGCTTAATTAGAAAGCTATTAGCTCGAGCTAATAGCTTTCTAATTA AGCTTTTTgaatt (The lowercase letters are the restriction site sequences).
[0052] Take 10 μl each of celetrix electroporation solution A and electroporation solution B, mix them thoroughly, add human basophils, and then add 2 μg / μl of the EXOSC3 knockdown plasmid (pLKO.1-U6-Homo-EXOSC3-sh3-EF1a-copGFP-T2A-puro) and mix evenly. Then add the mixed solution into an electroporation cuvette with a volume of 20 μL, place the electroporation cuvette into the electroporator, and set the electroporation parameters to 850 V and a duration of 20 ms.
[0053] Subsequently, flow cytometry was performed on the three groups of basophils. The specific operation procedure of flow cytometry is as follows:
[0054] 1) Incubate extracellular antibodies: Add extracellular staining antibodies (see Table 1) to the sample, incubate in the dark at 4°C for 30 min, and then wash twice with PBS.
[0055] Table 1 Staining antibodies and incubation systems
[0056] Stained antibody Incubation system CD123 APC-Cy7 (eBioscience, USA) 5 μL / 100 μL system CD203c PE (eBioscience, USA) 5 μL / 100 μL system
[0057] 2) Fixation / permeabilization: After extracellular staining, aspirate the excess PBS. Then add 1 mL of fixation / permeabilization solution (BD Biosciences, USA), mix by vortexing for 3 s, incubate in the dark at 4°C for 40 - 50 minutes.
[0058] 3) Permeabilization / washing: Add 1 mL of permeabilization / washing solution (BD Biosciences, USA) to the sample, centrifuge at 350 g at 4°C for 6 min, discard the supernatant, and repeat 2 times.
[0059] 4) Incubate intracellular antibodies: Add intracellular staining antibodies (see Table 2) to the sample, incubate in the dark at 4°C for 30 - 50 min, and then wash twice with the permeabilization / washing solution (BD Biosciences, USA).
[0060] Table 2 Staining antibodies and incubation systems
[0061] Stained antibody Incubation system IL-4 PE-Cy7 (eBioscience, USA) 5 μL / 100 μL system IL-6 APC (eBioscience, USA) 5 μL / 100 μL system IL-13 FITC (eBioscience, USA) 5 μL / 100 μL system
[0062] 9) Flow cytometry detection: Resuspend the sample with 200 μL of the permeabilization / washing solution (BD Biosciences, USA), and detect using a BD FACS Celesta flow cytometer (BD Biosciences, USA).
[0063] The experimental results are shown in Figure 3 , after knocking down EXOSC3 in basophils, the levels of inflammatory factors IL-4, IL-6 and IL-13 expressed by them were significantly decreased. The above results indicate that basophils promote their activation through EXOSC3.
[0064] Example 3: Basophils promote T cell activation through EXOSC3
[0065] The experimental method is as follows:
[0066] (1) Extract T cells:
[0067] 1) Extract PBS containing 2% FBS;
[0068] 2) Place the human peripheral blood in an EDTA anticoagulant tube into a 50 mL centrifuge tube, and add PBS containing 2% FBS according to the ratio of peripheral blood: PBS containing 2% FBS = 1:1, and mix well;
[0069] 3) Place lymphocyte separation medium in a 50 mL lymphatic vessel, and slowly add the mixed solution in step 2) above to the upper layer of lymphocyte separation medium according to the ratio of lymphocyte separation medium: peripheral blood: PBS containing 2% FES = 1:1:1 using a 1 mL pipette tip;
[0070] 4) Centrifuge at 800 g for 20 min at room temperature;
[0071] 5) After centrifugation, remove the upper plasma, take the peripheral blood mononuclear cells (PBMC) in the cloudy layer into a new 50 mL centrifuge tube, and wash with 4-fold volume of PBS containing 2% FBS;
[0072] 6) Centrifuge at 3000 rpm for 10 min at room temperature to remove platelets;
[0073] 7) Remove the supernatant, and continue to resuspend and wash with PBS containing 2% FBS;
[0074] 8) Centrifuge at 1200 rpm for 10 min at room temperature;
[0075] 9) Remove the supernatant, resuspend the PBMC with 1 mL - 1.5 mL of PBS containing 2% FBS, and place it in a 5 mL flow tube;
[0076] 10) Count, adjust the cell concentration to 5×10 7 cells / mL, add 50 μL of Isolation Cocktail per milliliter, let it stand at room temperature for 7 min, and then add an equal volume of RapidSpheres TM(Pre-vortex oscillation for 15 s). Resuspend PBMC with EasySep TM Buffer to 2.5 mL. Immediately place the flow tube in the magnet and let it stand for 3 min. Pour the liquid into a new flow tube, continue to place it in the magnet and let it stand for 1 min. Finally, T cells are obtained.
[0077] (2) Co-culture of basophils with knocked-down EXOSC3 and T cells:
[0078] Add the basophils with knocked-down EXOSC3 prepared in Example 2 above to Anti-IgE (Sigma, USA) at 1 μL / mL and culture for 24 hours. Then co-culture with the T cells in step (1) above in an incubator at 37 °C containing 5% CO 2 using X-Vivo TM 15 Medium, adding 1 μg / mL IL-2, 10% fetal bovine serum and 1% double antibody for co-culture for 24 hours. At the same time, set up a Control group and an Anti-IgE group without knocking down basophil EXOSC3.
[0079] (3) Detection of T cell activation level by flow cytometry:
[0080] 1) Extract the T cells after co-culture, add extracellular staining antibodies (see Table 3), protect from light, incubate at 4 °C for 30 min, and wash twice with PBS.
[0081] Table 3 Staining antibodies and incubation systems
[0082] Stained antibody Incubation system CD3 APC-Cy7 (BD Biosciences, USA) 5 μL / 100 μL system CD25 BB515 (BD Biosciences, USA) 5 μL / 100 μL system CD44 PE (BD Biosciences, USA) 5 μL / 100 μL system CD69 APC (BD Biosciences, USA) 5 μL / 100 μL system
[0083] 2) Detection by flow cytometer: Resuspend the sample with 200 μL PBS (BD Biosciences, USA) and detect using a BDFACS Celesta flow cytometer (BD Biosciences, USA).
[0084] The experimental results are shown in Figure 4 , after knocking down basophil EXOSC3 and co-culturing with T cells, the activation level of T cells can be significantly reduced. The above results indicate that basophils promote T cell activation through EXOSC3.
[0085] Example 4: Adoptive transfer of Exosc3 basophils to improve kidney pathology in pristane-induced lupus mice
[0086] The experimental intervention method is as follows:
[0087] (1) Preparation of mouse basophils
[0088] Take the bone marrow of C57BL / 6J mice, induce and differentiate it into basophils with IL-3, and improve the purity by sorting with flow cytometry. The specific steps are as follows:
[0089] ① Sacrifice the mice and soak them in 75% alcohol for at least 5 min. Skin the mice from the back, cut off the thighs (including the pubis) of the mice (avoid cutting the bone marrow here to prevent alcohol from entering the bone marrow and causing death of bone marrow cells), and soak the thighs in 75% alcohol for at least 2 min.
[0090] ② Transfer the mouse thighs from alcohol to commercial PBS (using a culture dish) in a laminar flow hood to wash off the alcohol. Transfer the mouse thighs to a clean culture dish, remove the muscle of the mouse thighs, and divide the bones into several segments. Aspirate PBS (or medium) with a 5 mL syringe and pipette the bone marrow into the culture dish. Approximately 15 mL of PBS is used for each mouse. After thoroughly dispersing the bone marrow fluid with a 1 mL pipette, filter the bone marrow fluid through a 40 μm filter into a 15 mL EP tube, and then centrifuge: 1200 g, 4 °C, 10 min, and remove the supernatant. Add 2 mL of red blood cell lysate (the red blood cell lysate is diluted 1:9 with double-distilled water), lyse for 10 min, and then centrifuge: 1200 g, 4 °C, 5 min, and remove the supernatant.
[0091] ③ Cell culture: Prepare 50 mL of cell culture medium (10% FBS): 45 mL of culture medium (RPMI 1640 medium) + 5 mL of serum (100% FBS) + 500 μL of penicillin-streptomycin. The bone marrow-induced cells of each mouse are cultured in 2 dishes, and the IL-3 concentration for cell culture is 15 ng / mL. Observe under the microscope whether the cells are evenly seeded. Measure the cell number and record it, and then place it in an incubator for culture. It takes 9 days to induce basophils, and the medium is changed every 3 - 4 days, and a total of 2 times of medium changes are required during this period. Take out the cells cultured for 3 days, collect the supernatant and centrifuge: 200 g, room temperature, 5 min. IL-3 with a concentration of 15 ng / mL needs to be added each time the medium is changed.
[0092] ④ Purification and verification of mouse basophils
[0093] Collect the cells in a 15 mL centrifuge tube on the 9th day of culture, centrifuge: 200 g, room temperature, 5 min, then remove the supernatant and resuspend in 1 mL of RPMI 1640 medium, and transfer it to a flow tube.
[0094] For every 1×10 6Add 0.5 μL of BV421 Hamster Anti-Mouse FcεR1α, 0.5 μL of BV510 Hamster Anti-Mouse CD49b, 0.5 μL of BB700 Rat Anti-Mouse CD117, and 1.25 μL of APC anti-mouse CD11c Antibody to the cells, incubate at room temperature in the dark for 30 min, add 3 mL of RPMI 1640 medium to wash, centrifuge at 350 g, room temperature, for 8 min, discard the supernatant, repeat the washing 2 times, and resuspend with 1 mL of RPMI 1640 medium.
[0095] Sort the labeled basophils by flow cytometry, and the gating is set as: FcεRI + CD117 - CD11c - CD49b + . After sorting, select some cells for purity verification, and the gating is set as: FcεRI + CD49b + , and obtain basophils with a purity > 90%. The results are shown in Figure 6
[0096] (2) Construction of mouse Exosc3-knockdown basophils:
[0097] Prepare the Exosc3-knockdown plasmid: Insert the Mus-Exosc3-sh2 sequence into the pLK0.1-U6-EF1a-copGFP-T2A-puro plasmid (purchased from Guangzhou Aiji Biotechnology Co., Ltd.). The plasmid map of the recombinant plasmid pLKO.1-U6-Mus-Exosc3-sh2-EF1a-copGFP-T2A-puro is shown in Figure 5 ;
[0098] The nucleotide sequence of the said Mus-Exosc3-sh2 is:
[0099] ccggGGTGCTGAATCAGGTGGTTCTCTCGAGAGAACCACCTGATTCAG CACCTTTTTgaatt (the lowercase letters are the restriction site sequences).
[0100] Take 10 μL each of celetrix electroporation solution A and electroporation solution B, mix them well, add murine basophils, and then add 2 μg / μL of the plasmid for knocking down Exosc3 (pLKO.1-U6-Mus-Exosc3-sh2-EF1a-copGFP-T2A-puro), and mix evenly. Then add the mixed solution into an electroporation cuvette with a volume of 20 μL, put the electroporation cuvette into the electroporation instrument, and set the electroporation parameters to 850 V with a duration of 20 ms.
[0101] (3) Pristane-Mcpt8 flox / flox,CAGGCre-ERTM Construction of lupus mice:
[0102] Purchase basophil-deficient mice (Mcpt8 flox / flox,CAGGCre-ERTM ) and control mice (Mcpt8 flox / flox ) from Cyagen Biosciences Inc. Construct Pristane-Mcpt8 flox / flox,CAGGCre-ERTM lupus mice by intraperitoneal injection of Pristane. Subsequently, adoptively transfer the basophils with knocked-down Exosc3 (Baso-Exosc3 KD ) from step (1) to observe the role of Exosc3. At the same time, establish a disease control group (control) and a healthy control group (Mcpt8 flox / flox ).
[0103] (4) Pristane-Mcpt8 flox / flox,CAGGCre-ERTM Pathological evaluation of the kidneys of lupus mice:
[0104] Use the PAS staining method to perform pathological staining on mouse kidney tissue sections. PAS staining steps: ① Deparaffinization: xylene for 10 min × 2 times; ② Hydration: 100% alcohol for 10 s → 95% alcohol for 10 s → water wash for 30 s; ③ 1% periodic acid for 25 min → water wash for 30 s; ④ PAS staining solution for 30 min → soak in water for 2 min; ⑤ Stain nuclei: hematoxylin for 6 min → water wash 3 times, about 5 min → 1% hydrochloric acid alcohol for 2 s → water wash for 2 s → 1% ammonia water for 2 s → water wash for 2 s; ⑥ Stain cytoplasm: 1% eosin for 4 min → water wash for 1 min; ⑦ 100% alcohol for 2 s → dry by baking, cover the slide; ⑧ Observe under a microscope and take pictures to evaluate the kidney pathology.
[0105] The experimental results are shown in Figure 7 . After adoptively transferring basophils with knocked-down Exosc3, the shedding of the brush border of the mouse kidneys was significantly improved. It can be seen that lupus nephritis can be significantly improved. The above results indicate that the activation of basophils promotes the progression of lupus nephritis through Exosc3.
[0106] In summary, the expression of EXOSC3 is enhanced after basophil activation and decreased after inhibition of basophil activation. After knocking down EXOSC3 in basophils, the levels of inflammatory factors IL-4, IL-6, and IL-13 were significantly decreased. After co-culturing basophils with knocked-down EXOSC3 and T cells, the activation level of T cells was significantly decreased. Finally, adoptive transfer of basophils with knocked-down Exosc3 into lupus mice showed that it could significantly improve the renal pathology of lupus mice. In conclusion, basophils promote their activation through EXOSC3, thereby promoting the progression of lupus nephritis. Knocking down Exosc3 in basophils can significantly improve the renal pathology of lupus mice. This invention provides a new idea for the treatment of lupus mediated by basophil activation.
[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Use of basophils intervening in the expression of EXOSC3 in the preparation of a drug for preventing and / or treating lupus nephritis, characterized in that: The intervention includes knocking down or knocking out the expression of EXOSC3.
2. The use according to claim 1, characterized in that: The method for knocking down the expression of basophil EXOSC3 includes using CRISPR-Cas9 technology to perform gene editing, and using siRNA, plasmid-mediated shRNA or virus-mediated shRNA to silence EXOSC3.
3. The use according to claim 2, characterized in that: The nucleotide sequence of the shRNA is: GCTTAATTAGAAAGCTATTAGCTCGAGCTAATAGCTTTCTAATTAAGCTTTTT or GGTGCTGAATCAGGTGGTTCTCTCGAGAGAACCACCTGATTCAGCACCTTTTT.