A yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, and a construction method and application thereof

Abstract

The present invention discloses a yeast mutualistic symbiotic community for de novo synthesis of lignin glycosides, its construction method and application, which relates to the technical field of synthetic biology. The key technical points of the technical solution are that the present invention constructs a Saccharomyces cerevisiae symbiotic community for the first time, and heterologously synthesizes complex antiviral active lignin glycosides of plant origin using simple carbon sources. In the early stage, a Saccharomyces cerevisiae cell factory with high production of ferulic acid and efficient conversion of ferulic acid to synthesize lignin glycosides was constructed. Methionine and adenosine auxotrophies were respectively constructed in the two cell factories to achieve the optimal auxotrophic pair to form a symbiotic community, and successfully achieved de novo synthesis of antiviral active lignin glycosides with glucose as the sole carbon source, including recteoside B, pinoresinol monoglycoside and pinoresinol diglycoside. The present invention uses a microbial symbiotic community to synthesize lignin glycosides in one step, providing a strong research and application basis for subsequent synthesis of other high-value complex active components using the mutually beneficial symbiotic Saccharomyces cerevisiae flora.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and more specifically, it relates to a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, a construction method thereof, and an application thereof. Background Art

[0002] Lignan glycoside compounds represented by clemastanin B, pinoresinol monoglycoside, and pinoresinol diglycoside are a class of antiviral active ingredients ( Figure 1 ), which can not only interfere with the expression of a certain protein of influenza virus to inhibit the transmission of various subtypes of influenza virus such as human influenza virus and avian influenza virus, but also play a role in regulating the innate immunity of the human body by inhibiting the activation of inflammatory factors induced by influenza virus. In addition, pinoresinol diglycoside also exhibits antioxidant, anti-tumor, immunity-enhancing, anti-fatigue, anti-aging, and bacteriostatic effects.

[0003] Traditionally, lignan glycosides are derived from the extraction of medicinal plants such as Isatis indigotica Fort., Eucommia ulmoides Oliv., and Schisandra chinensis (Turcz.) Baill. However, the cultivation and growth of medicinal plants are often directly affected by the environment and climate, and the yield and growth cycle fluctuate greatly, thus affecting the stable supply of lignan glycosides. Compared with the plant extraction method, microbial fermentation using cell factories can get rid of unstable factors such as the environment and climate, and achieve all-weather production to meet the growing market demand. However, in the prior art, there is a lack of engineered microorganisms that can de novo produce clemastanin B, pinoresinol monoglycoside, and pinoresinol diglycoside of lignan glycosides. Summary of the Invention

[0004] The purpose of the present invention is to provide a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, a construction method thereof, and an application thereof, so as to improve the current situation that there is a lack of engineered microorganisms that can directly utilize glucose to synthesize antiviral active lignan glycosides, clemastanin B, pinoresinol monoglycoside, and pinoresinol diglycoside.

[0005] The above technical purpose of the present invention is achieved through the following technical solutions: a construction method of a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, wherein the yeast mutualistic symbiotic community uses Saccharomyces cerevisiae CEN.PK113-11C* as a chassis strain, and constructs knockout vectors gRNA to knockout the following genes in its genome respectively: MET15 and ADE2, to form two different auxotrophic strains CEN met15Δ and CEN ade2Δ , ensuring that the initial total OD600 of the seed bacterial liquid is 0.2, and inoculating the engineered bacteria into 20 ml of Delft fermentation medium at an initial inoculation ratio of 1:1, and their growth is strictly supported by the exchange of defective metabolites between the strains, and after 144 hours of co-culture, an interdependent bacterial consortium is formed.

[0006] The present invention is further configured such that: the engineered bacterium includes an upstream module for the synthesis of lignin glycoside and a downstream module for the synthesis of lignin glycoside.

[0007] The present invention is further configured such that: the engineered bacterium of the upstream module for the synthesis of lignin glycoside is obtained by the following method:

[0008] In a genotype of MATa, MAL2-8C, SUC2, ura3Δ, his3Δ, gal80Δ, XI5::(P TEF -CAS9-T CYC1 ), aro10Δ,

[0009] ARO10::(T HIS3 >ScARO7 G141S -Sc OPT1 <P GAL10 / 1 >ScARO4 K229L -Sc OPT1 <T ENO2 )+(P GAL7 >EcAROL<T ADH1 ), pdc5Δ,

[0010] PDC5::(T CYC1 >FjTAL-Sc OPT1 <P GAL10 / 1 >SbPAL1-Sc OPT1 <T TDH2 )+(T FBA1 >At

[0011] CPR1-Sc OPT1 <P GAL7 ),

[0012] XII4::(T PRM9 >PtrC4H2-Sc OPT1 <P GAL10 / 1 >PtrC4H1-Sc OPT1 <T PYK )+(P GAL7 >P

[0013] trC3H3-Sc OPT1 <T DIT1 ),

[0014] X2::(T PRM9 >PaHPAB-Sc OPT1 <P GAL10 / 1 >SeHPAC-Sc OPT1 <T HIS3 ),

[0015] XII1::(P GAL7>ScARO1<T ENO2 )+(T CPS1 >ScARO2<P GAL10 / 1 >ScARO3<T HIS5 ),

[0016] gpp1Δ,

[0017] GPP1::(TENO2T ENO2 >CkPTA-Sc OPT1 <P GAL10 / 1 >LmXFPK-Op OPT1 <T HIS5 ),

[0018] XII5::(T CPS1 >NtCOMT1-Sc OPT1 <P GAL10 / 1 >NtCOMT1-Op OPT1 <T HIS5 ),

[0019] XI8::(T CPS1 >NtCOMT1-Sc OPT1 <P GAL10 / 1 >NtCOMT1-Op OPT1 <T HIS5 ),

[0020] XI7::(T PRM9 ><P GAL10 >ScTAL1<T PYK1 ),I16::(P GAL7 >ScTKL1<T ENO2 ),hoΔ,

[0021] (T HSP26 >ScMET6<P GAL10 / 1 >MTFHR

[0022] chimera1-Sc OPT1 <T PDC6 )+(P GAL7 >LiMETK1-Sc OPT1 <T UBX6 ),V3::(T PRM9 >ScADO1<P GAL10 / 1>ScSAH1<T PYK1 The engineered bacterium RB218 was obtained by knocking out the MET15 gene and overexpressing the e-GFP fluorescent protein coding gene in the genome of the engineered bacterium RB218 with high yield of ferulic acid met15Δ 。

[0023] The present invention is further configured such that the engineered bacteria of the downstream module for lignin glycoside synthesis are obtained by any one of the following methods:

[0024] (1) In the genotype MATa, MAL2-8C, SUC2, ura3Δ, his3Δ, gal80Δ, XI5::(P TEF -CAS9-T CYC1 ), XII1::(P GAL7 >Ptr4CL5-Sc OPT1 <T ENO2 )+(T CPS1 >ScADH6<P GAL10 / 1 >PtrCCR2-Sc OPT1 <T HIS5 ) After knocking out the ADE2 gene in the genome of the engineered bacteria RB57 with high production of coniferyl alcohol during ferulic acid feeding and overexpressing the mPlum fluorescent protein, the engineered bacteria RB57 are obtained ade2Δ ;

[0025] (2) In the genotype MATa, MAL2-8C, SUC2, ura3Δ, his3Δ, gal80Δ, XI5::(P TEF -CAS9-T CYC1 ),

[0026] XII1::(P GAL7 >Ptr4CL5-Sc OPT1 <T ENO2 )+(T CPS1 >ScADH6<P GAL10 / 1 >PtrCCR2-Sc OPT1 <T HIS5 ),

[0027] XII3::(T SPG5 >trIiDIR1<P GAL10 / 1 >trTsLAC3-Sc OPT1 <T IDP1 ), XI3::(T PRM5 ><P GAL10 >IiUGT71B2<T LSC2 ) After knocking out the ADE2 gene in the genome of the engineered bacteria XH7B1 with high production of pinoresinol monoglycoside during ferulic acid feeding and overexpressing the mPlum fluorescent protein coding gene, the engineered bacteria XH7B1 are obtained ade2Δ ;

[0028] (3) In the genotype MATa, MAL2-8C, SUC2, ura3Δ, his3Δ, gal80Δ, XI5::(P TEF -CAS9-TCYC1 ),

[0029] XII1::(P GAL7 >Ptr4CL5-Sc OPT1 <T ENO2 )+(T CPS1 >ScADH6<P GAL10 / 1 >PtrCCR2-Sc OPT1 <T HIS5 ),

[0030] XII3::(T SPG5 >trIiDIR1<P GAL10 / 1 >trTsLAC3-Sc OPT1 <T IDP1 ),XI3::(T PRM5 ><P GAL10 >IiUGT715a<T LSC2 ) The engineered strain with high production of pinoresinol diglycoside during ferulic acid feeding is the engineered strain XH8B1 obtained by knocking out the ADE2 gene and overexpressing the mPlum fluorescent protein coding gene in the genome of XH8B1 ade2Δ ;

[0031] (4) In the genotype of MATa, MAL2-8C, SUC2, ura3Δ, his3Δ, gal80Δ, XI5::(P TEF -CAS9-T CYC1 ),

[0032] XII1::(P GAL7 >Ptr4CL5-Sc OPT1 <T ENO2 )+(T CPS1 >ScADH6<P GAL10 / 1 >PtrCCR2-Sc OPT1 <T HIS5 ),

[0033] XII3::(T SPG5 >trIiDIR2<P GAL10 / 1 >trTsLAC3-Sc OPT1 <T IDP1 ),

[0034] XI3::(T PRM5 ><P GAL10 >IiUGT715b<T LSC2 ),

[0035] Ⅱ1::(T PRM5 >IiUGT71B5b<P GAL10 >IiUGT71B5b<TLSC2 ) The engineered strain XH12 is obtained by knocking out the ADE2 gene in the genome of the engineered strain XH12 with high-yield orthosiphonin B during ferulic acid feeding and overexpressing the mPlum fluorescent protein-encoding gene. ade2Δ .

[0036] The present invention is further configured as follows: It includes the following construction methods:

[0037] (a) When producing coniferyl alcohol from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineered strains RB218 met15Δ and the engineered strain RB57 ade2Δ into 20 ml of Delft fermentation medium and perform mutualistic co-culture for 144 hours;

[0038] (b) When producing pinoresinol monoglycoside from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineered strains RB218 met15Δ and the engineered strain XH7B1 ade2Δ into 20 ml of Delft fermentation medium and perform mutualistic co-culture for 144 hours;

[0039] (c) When producing pinoresinol diglycoside from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineered strains RB218 met15Δ and the engineered strain XH8B1 ade2Δ into 20 ml of Delft fermentation medium and perform mutualistic co-culture for 144 hours;

[0040] (d) When producing orthosiphonin B from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineered strains RB218 met15Δ and the engineered strain XH12 ade2Δ into 20 ml of Delft fermentation medium and perform mutualistic co-culture for 144 hours.

[0041] The present invention is further configured as follows: The preparation method of the Saccharomyces cerevisiae seed bacterial solution is as follows: Pick the target yeast monoclonal colony, inoculate it into 5 ml of YPD liquid medium, culture it in a shaker at 30 °C and 220 rpm for 16 hours, then dilute it 10 times and measure the OD600 between 0.3 - 0.5, and obtain it after washing twice with an equal volume of Delft medium.

[0042] The present invention is further configured as follows: The method for preparing the Saccharomyces cerevisiae seed bacterial liquid is as follows: Pick a target yeast monoclonal colony, inoculate it into 5 ml of YPD liquid medium, culture it in a shaker at 30 °C and 220 rpm for 16 hours, dilute it 10 times, measure the OD600 between 0.3 and 0.5, and obtain it after washing twice with an equal volume of Delft medium.

[0043] In summary, the present invention has the following beneficial effects: The present invention uses the wild-type Saccharomyces cerevisiae CEN.PK113-11C* as the starting strain. On the basis of obtaining two different auxotrophic strains CENmet15Δ and CENade2Δ respectively, they are inoculated into the same system in equal proportions. After confirming that its stable growth is strictly supported by the exchange of defective metabolites between strains, the mutualistic co-culture strategy is applied to the upstream engineering strain RB218 for producing ferulic acid and the downstream engineering strains RB57 / XH7B1 / XH8B1 / XH12 for producing lignans, obtaining four groups of Saccharomyces cerevisiae mutualistic symbiotic communities: RB218met15Δ-RB57ade2Δ, RB218met15Δ-XH7B1ade2Δ, B218met15Δ-XH8B1ade2Δ, RB218met15Δ-XH12ade2Δ, which can respectively produce lignan coniferyl alcohol, pinoresinol monoglycoside, pinoresinol diglycoside and clematoclethion B from glucose fermentation. It is the first report so far to produce lignan coniferyl alcohol, pinoresinol monoglycoside, pinoresinol diglycoside and clematoclethion B de novo using microorganisms, and the construction method is efficient and simple to operate. Description of the Drawings

[0044] Figure 1 It is a schematic diagram of the yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides of the present invention;

[0045] Figure 2 It is three experimental schematic diagrams of the cross-feeding relationship between met15Δ and ade2Δ of the mutualistic symbiotic community of the present invention;

[0046] Figure 3 It is a growth curve diagram of the cross-feeding relationship between met15Δ and ade2Δ of the mutualistic symbiotic community of the present invention;

[0047] Figure 4 It is a mechanism model diagram of the mutualistic cross-feeding between met15Δ and ade2Δ of the present invention;

[0048] Figure 5 It is the mutualistic symbiotic community RB218 of the present invention met15Δ and RB57 ade2Δ The yield diagram of de novo production of coniferyl alcohol;

[0049] Figure 6 It is the mutualistic symbiotic community RB218 of the present invention met15Δ and XH7B1ade2Δ Production graph of pinoresinol monoglycoside produced de novo

[0050] Figure 7 is the mutualistic community RB218 of the present invention met15Δ and XH8B1 ade2Δ Production graph of pinoresinol diglycoside produced de novo

[0051] Figure 8 is the mutualistic community RB218 of the present invention met15Δ and XH12 ade2Δ Production graph of recteoline B produced de novo Detailed implementation mode

[0052] The following is combined with the attached Figure 1-8 to further elaborate on the present invention in detail

[0053] Example 1: Construction of a yeast mutualistic community with stable growth

[0054] (1) Construction of defective strains CEN met15Δ and CEN ade2Δ of Saccharomyces cerevisiae

[0055] Previously, a recombinant Saccharomyces cerevisiae CEN.PK113-11C* integrating the CAS9 gene and knocking out the GAL80 gene was independently constructed, which can achieve the efficient expression of the pathway genes expressed after the promoters P GAL7 and P GAL10 / 1 under sugar-limited conditions, and the defective strains were constructed using this as the host strain

[0056] Taking the MET15 and ADE2 gene fragments to be knocked out in the Saccharomyces cerevisiae genome as the genomic recombination sites, two sgRNA expression vectors were constructed. Combining with the CRISPR / Cas9 gene editing technology and using the characteristics of yeast's own homologous recombination, the sgRNA expression vectors and the DNA fragments carrying the upstream homologous arm - downstream homologous arm of the knockout site were introduced into Saccharomyces cerevisiae CEN.PK113-11C*, and the defective strains CEN met15Δ and CENa de2Δ were obtained

[0057] All the sgRNA expression vectors used in the present invention are exactly the same except for the different 20bp targeting sequences. Briefly speaking, first, the vector backbone S1 was amplified from the pgRNA-GAL80 plasmid using the primer 6005 (GATCATTTATCTTTCACTGCGGAGAAG); then, sgRNA-1 and sgRNA-2 were amplified respectively, where sgRNA-1 used the primer:

[0058] p1: GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATC;

[0059] pX1: AAACTTCTCCGCAGTGAAAGATAAATGATC(M20)GTTTTAGAGCTAGAAATAG, where M20 is a replaceable 20bp targeting sequence).

[0060] Primers used for sgRNA-2:

[0061] p2: GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGC;

[0062] pX2: AAACTTCTCCGCAGTGAAAGATAAATGATC(N20)GTTTTAGAGCTAGAAATAG, where N (N20) is another replaceable 20bp targeting sequence).

[0063] Finally, the sgRNA fragment and the vector backbone fragment are cloned and ligated using the Gibson Assembly method. After the obtained recombinant vector is sequenced correctly, it is applied. The replacement sequences of M20 and N20 in pX1 and pX2 and the corresponding sequence names after replacement are shown in Table 1. The sgRNA expression vectors involved in the present invention include pgRNA-MET15 (targeting site MET15) and pgRNA-ADE2 (targeting site ADE2). For the DNA fragment carrying the knockout site up homologous arm - dw homologous arm, approximately 500bp sequences upstream and downstream of the targeting site of the pgRNA vector are amplified respectively as homologous arms, and then the homologous arms are assembled by fusion PCR to obtain a complete DNA fragment, which is co-transformed with the pgRNA vector at the corresponding site into yeast for gene editing and strain modification.

[0064] Table 1 Integration sites

[0065]

[0066] (2) Construction of a stable-growing yeast mutualistic symbiotic community met15Δ - ade2Δ

[0067] The obtained defective strains CEN met15Δ and CEN ade2ΔStreak on the YPD plate to obtain monoclonal colonies for preparing the seed culture solution for fermentation. Then pick yeast monoclonal colonies and inoculate them into 5 ml of YPD liquid medium. After culturing in a constant temperature shaker at 30 °C and 220 rpm for 16 hours, dilute 10-fold and measure the OD600 between 0.3 - 0.5. Wash twice with an equal volume of Delft medium and resuspend to obtain the seed culture solution.

[0068] Three experiments to confirm that the growth of the mutualistic symbiotic community met15Δ and ade2Δ strictly depends on cross-feeding of defective nutrients ( Figure 2 ): a, Fermentation of the supernatant of met15Δ-ade2Δ. Culture the CENa d e 2Δ bacteria for 16 h, wash three times with an equal volume of sterile water, break with 0.2 ml of glass beads at 1600 rpm for 10 min, then boil in water for 5 min, centrifuge to collect the supernatant, filter through a 0.22 μm sterile microporous filter membrane, and use the supernatant equivalent to an initial OD600 of 0.1 volume to co-culture with the CENmet 15Δ seed culture solution for 144 hours; b, Fermentation of the supernatant of ade2Δ-met15Δ. Culture the CENmet 15Δ bacteria for 16 h, wash three times with an equal volume of sterile water, break with 0.2 ml of glass beads at 1600 rpm for 10 min, then boil in water for 5 min, centrifuge to collect the supernatant, filter through a 0.22 μm sterile microporous filter membrane, and use the supernatant equivalent to an initial OD600 of 0.1 volume to co-culture with the CENa d e 2Δ seed culture solution for 144 hours; c, Co-fermentation of met15Δ-ade2Δ double bacteria. Ensure that the initial total OD600 of the seed culture solution is 0.2 at inoculation, and inoculate CEN met15Δ and CEN ade2Δ bacteria into 20 ml of Delft fermentation medium at an initial inoculation ratio of 1:1 for 144 hours of mutualistic co-culture. All the above fermentation combinations measure the OD600 at time points 8 h, 16 h, 24 h, 48 h, 72 h, 96 h, 120 h, 144 h to make a growth curve to observe the growth of the community ( Figure 3 ), and draw a mechanism model of mutualistic cross-feeding of met15Δ and ade2Δ ( Figure 4 ).

[0069] Example 2: Construction of a yeast mutualistic symbiotic community for de novo synthesis of lignin glycosides

[0070] Using gene editing tools and mutualistic co-culture strategies, de novo synthesis of lignin glycosides was achieved in a Saccharomyces cerevisiae symbiotic community ( Figure 1 ).

[0071] (1) Construction of auxotrophic bacteria for producing metabolites

[0072] The engineered bacterium RB218 contains the biosynthetic pathway from glucose to ferulic acid. The MET15 gene was knocked out using it as the upstream producer. After transforming approximately 500 ng of pgRNA-MET15 and approximately 500 ng of the DNA fragment MET15up-MET15dw using the chemical transformation method, it was spread on an SD plate supplemented with histidine and methionine and incubated upside down at 30 °C for 3 days. After the transformants were cultured in a liquid SD medium supplemented with histidine and methionine, they were verified to be correct by PCR, spread on a solid medium containing histidine, methionine, uracil, and 5-fluorouracil for plasmid loss. After the strains with plasmid loss were verified to be correct by PCR again, they were stored for later use, and the engineered yeast auxotrophic strain RB218 producing ferulic acid was obtained. met15Δ .

[0073] The engineered bacterium RB57 contains the biosynthetic pathway from ferulic acid to coniferyl alcohol, the engineered bacterium XH7B1 contains the biosynthetic pathway from ferulic acid to pinoresinol monoglycoside, the engineered bacterium XH8B1 contains the biosynthetic pathway from ferulic acid to pinoresinol diglycoside, and the engineered bacterium XH12 contains the biosynthetic pathway from ferulic acid to recteoline B. The above strains were used as downstream producers for ADE2 gene knockout. After transforming approximately 500 ng of pgRNA-ADE2 and approximately 500 ng of the DNA fragment ADE2up-ADE2dw using the chemical transformation method, it was spread on an SD plate supplemented with histidine and adenosine and incubated upside down at 30 °C for 3 days. After the transformants were cultured in a liquid SD medium supplemented with histidine and adenosine, they were verified to be correct by PCR, spread on a solid medium containing histidine, adenosine, uracil, and 5-fluorouracil for plasmid loss. After the strains with plasmid loss were verified to be correct by PCR again, they were stored for later use, and the engineered yeast auxotrophic strains RB57 producing coniferyl alcohol ade2Δ , the engineered yeast auxotrophic strain XH7B1 producing pinoresinol monoglycoside ade2Δ , the engineered yeast auxotrophic strain XH8B1 producing pinoresinol diglycoside ade2Δ , the engineered yeast auxotrophic strain XH12 producing recteoline B ade2Δ .

[0074] (2) Construction of a mutually symbiotic community of Saccharomyces cerevisiae for de novo synthesis of lignin glycosides

[0075] The obtained auxotrophic strains RB57 ade2Δ , XH7B1 ade2Δ , XH8B1 ade2Δ , XH12 ade2ΔStreak on YPD plates to obtain monoclonal colonies for preparing the seed culture solution for fermentation; then pick yeast monoclonal colonies and inoculate them into 5 ml of YPD liquid medium. After culturing in a constant temperature shaker at 30 °C and 220 rpm for 16 hours, dilute 10-fold and measure the OD600 between 0.3 - 0.5. Wash twice with an equal volume of Delft medium and resuspend to obtain the seed culture solution.

[0076] Construct four groups of de novo synthesized lignan glycoside-producing Saccharomyces cerevisiae mutualistic communities that are growth-dependent on cross-feeding of defective nutrients: a, RB218 met15Δ and RB57 ade2Δ For the co-fermentation of the two strains, ensure that the initial total OD600 of the seed culture solution is 0.2 during inoculation. Inoculate RB218 met15Δ and RB57 ade2Δ strains into 20 ml of Delft minimal medium with glucose as the carbon source for 144 hours of mutualistic co-culture; b, RB218 met15Δ and XH7B1 ade2Δ For the co-fermentation of the two strains, ensure that the initial total OD600 of the seed culture solution is 0.2 during inoculation. Inoculate RB218 met15Δ and XH7B1 ade2Δ strains into 20 ml of Delft minimal medium with glucose as the carbon source for 144 hours of mutualistic co-culture; c, RB218 met15Δ and XH8B1 ade2Δ For the co-fermentation of the two strains, ensure that the initial total OD600 of the seed culture solution is 0.2 during inoculation. Inoculate RB218 met15Δ and XH8B1 ade2Δ strains into 20 ml of Delft minimal medium with glucose as the carbon source for 144 hours of mutualistic co-culture; d, RB218 met15Δ and XH12 ade2Δ For the co-fermentation of the two strains, ensure that the initial total OD600 of the seed culture solution is 0.2 during inoculation. Inoculate RB218 met15Δ and XH12 ade2Δ strains into 20 ml of Delft minimal medium with glucose as the carbon source for 144 hours of mutualistic co-culture. The fermentation conditions are: liquid volume 20 / 100 mL, 30 °C, 220 rpm, and the total fermentation time is 96 - 144 h.

[0077] Furthermore, extract and detect the end-fermentation products. The results prove that the yeast mutualistic community RB218 met15Δ -RB57 ade2Δ can produce coniferyl alcohol with a yield of 0.88 mg / L ( Figure 5 ); the yeast mutualistic community RB218met15Δ -XH7B1 ade2Δ It can produce pinoresinol monoglycoside with a yield of 1.22 μg / L( Figure 6 ); yeast mutualistic community RB218 met15Δ -XH8B1 ade2Δ It can produce pinoresinol diglycoside with a yield of 0.47 μg / L( Figure 7 ); yeast mutualistic community RB218 met15Δ -XH12 de2Δ It can produce orthocarpine B with a yield of 1.36 μg / L( Figure 8 ).

[0078] The specific steps of the above extraction and detection technical scheme are as follows: Take 500 μL of the fermentation sample, add 500 μL of absolute ethanol, and vortex thoroughly for 10 min; centrifuge at 13000 g for 5 min, take 500 μL of the supernatant, and filter it through a 0.22 μm nylon microporous membrane to obtain the injection sample. The detection uses Agilent 1200-6410 LC-MS, the chromatographic column is 3×100 mm 2.7 um Poroshell120 EC-C18 (Agilent), the flow rate is 0.3 mL / min, the mobile phase A is H2O + 0.05% HCOOH, and the mobile phase B is ACN + 0.05% HCOOH. The specific mobile phase gradient is 95% - A (0 min), 80% - A (2 min), 78% - A (6 min), 75% - A (12 min), 5% - A (23 min), and then extend for 5 min.

[0079] Example 3: Medium, experimental process and gene information involved in the fermentation production of lignin glycoside by recombinant Saccharomyces cerevisiae

[0080] (1) Medium

[0081] YPD medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract;

[0082] SD medium: 20 g / L glucose, 6.7 g / L YNB, and essential amino acid components (such as histidine, uracil, methionine, adenosine) are added as needed;

[0083] Fermentation medium (basic salt medium): (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, add about 900 mL of ddH2O, adjust the pH to 5.6, make up the volume to 950 mL, and sterilize at 115 °C for 20 min. After sterilization, supplement 1 mL of vitamin solution and 2 mL of trace metal solution, and add histidine and uracil (40 mg / L) as needed. Add glucose to 20 g / L to the fermentation medium for the fermentation of Saccharomyces cerevisiae engineering bacteria.

[0084] (2) Experimental procedures and conditions

[0085] After activating the engineered yeast strains, single colonies were picked and inoculated into 3 / 15 mL YPD medium, and cultured with shaking at 30 °C and 220 rpm for 16 h. At the time of fermentation inoculation, the seed liquid was washed twice with the fermentation medium, and inoculated into the fermentation medium according to the calculated inoculum size based on the target initial OD600. The liquid loading volume was 20 mL / 100 mL conical flask, and fermentation was carried out at 30 °C and 220 rpm for 96 - 144 h. Sampling was carried out at fixed points or at the end point for the analysis of biomass (represented by the absorbance value at 600 nm) and the yield of lignin glycosides.

[0086] (3) DNA operations and genes used

[0087] All natural promoters, genes, and terminators were amplified by PCR using the genomic DNA of Saccharomyces cerevisiae CEN.PK113 - 11C as a template. All genes used are listed in Table 2.

[0088] Table 2 Gene names and sequence numbers

[0089] Gene Name Source Sequence ID MET15 Saccharomyces cerevisiae SEQ ID NO: 1 ADE2 Saccharomyces cerevisiae SEQ ID NO: 2

[0090] SED ID NO: 1:

[0091]

[0092] SED ID NO:2:

[0093]

[0094] This specific embodiment is only an interpretation of the present invention and does not limit the present invention. After reading this specification, those skilled in the art may make modifications to this embodiment that do not contribute creatively as needed, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A method for constructing a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, characterized in that: The yeast mutualistic symbiotic community uses Saccharomyces cerevisiae CEN.PK113-11C* as the chassis strain, and the yeast mutualistic symbiotic community is composed of engineering bacteria of the upstream module for syringin synthesis and engineering bacteria of the downstream module for syringin synthesis; The engineering bacteria of the upstream module for syringin synthesis are obtained by the following method: In the genotype MATa , MAL2-8C , SUC2 , ura3Δ , his3Δ , gal80Δ , XI5 ::(P TEF - CAS9 -T CYC1 ), aro10Δ , ARO10::(T HIS3 > ScARO7 G141S -Sc OPT1 <P GAL10 / 1 > ScARO4 K229L -Sc OPT1 <T ENO2 )+(P GAL7 >EcAROL<T ADH1 ), pdc5Δ , PDC5 ::(T CYC1 > FjTAL -Sc OPT1 <P GAL10 / 1 > SbPAL1 -Sc OPT1 <T TDH2 )+(T FBA1 > AtCPR1 -Sc OPT1 <P GAL7 ), XII4 ::(T PRM9 > PtrC4H2 -Sc OPT1 <P GAL10 / 1 > PtrC4H1 -Sc OPT1 <T PYK )+(P GAL7 > PtrC3H3 -Sc OPT1 <T DIT1 ), X2 ::(T PRM9 > PaHPAB -Sc OPT1 <P GAL10 / 1 > SeHPAC -Sc OPT1 <T HIS3 ), XII1 ::(P GAL7 > ScARO1 <T ENO2 )+(T CPS1 > ScARO2 <P GAL10 / 1 > ScARO3 <T HIS5 ), gpp1Δ , GPP1 ::( TENO2 T ENO2 > CkPTA -Sc OPT1 <P GAL10 / 1 > LmXFPK -Op OPT1 <T HIS5 ), XII5 ::(T CPS1 > NtCOMT1 -Sc OPT1 <P GAL10 / 1 > NtCOMT1 -Op OPT1 <T HIS5 ), XI8 ::(T CPS1 > NtCOMT1 -Sc OPT1 <P GAL10 / 1 > NtCOMT1 -Op OPT1 <T HIS5 ), XI7 ::(T PRM9 ><P GAL10 > ScTAL1 <T PYK1 ), I16 ::(P GAL7 > ScTKL1 <T ENO2 ), hoΔ , (T HSP26 > ScMET6 <P GAL10 / 1 > MTFHR chimera1 -Sc OPT1 <T PDC6 )+(P GAL7 > LiMETK1 -Sc OPT1 <T UBX6 ), V3 ::(T PRM9 > ScADO1 <P GAL10 / 1 > ScSAH1 <T PYK1 ) After knocking out the MET15 gene and overexpressing the e-GFP fluorescent protein coding gene in the genome of the engineering bacterium RB218 capable of high-yielding ferulic acid, the engineering bacterium RB218 is obtained met15Δ ; The engineering bacteria of the downstream module for syringin synthesis are obtained by the following method: In the genotype MATa , MAL2-8C , SUC2 , ura3Δ , his3Δ , gal80Δ , XI5 ::(P TEF - CAS9 -T CYC1 ), XII1 ::(P GAL7 > Ptr4CL5 -Sc OPT1 <T ENO2 )+(T CPS1 > ScADH6 <P GAL10 / 1 > PtrCCR2 -Sc OPT1 <T HIS5 ) The gene was knocked out in the genome of engineering bacterium RB57 with high-yield coniferyl alcohol during ferulic acid fermentation, and after overexpressing the mPlum fluorescent protein, engineering bacterium RB57 was obtained ADE2 ; ade2Δ ; The lignin glycoside described above is coniferyl alcohol. When producing coniferyl alcohol from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineered bacteria RB218 and the engineered bacteria RB57 at an initial inoculation ratio of 1:1 into 20 ml of Delft fermentation medium for 144 hours of mutualistic co-culture. met15Δ and the engineered bacteria RB57 ade2Δ in 20 ml of Delft fermentation medium for 144 hours of mutualistic co-culture.

2. A method for constructing a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, characterized by: The yeast mutualistic symbiotic community uses Saccharomyces cerevisiae CEN.PK113-11C* as the chassis strain, and the yeast mutualistic symbiotic community is composed of engineering bacteria of the upstream module for syringin synthesis and engineering bacteria of the downstream module for syringin synthesis; The engineering bacteria of the upstream module for syringin synthesis are as described in claim 1; The engineering bacteria of the downstream module for syringin synthesis are obtained by the following method: In the genotype MATa , MAL2-8C , SUC2 , ura3Δ , his3Δ , gal80Δ , XI5 ::(P TEF - CAS9 -T CYC1 ), XII1 ::(P GAL7 > Ptr4CL5 -Sc OPT1 <T ENO2 )+(T CPS1 > ScADH6 <P GAL10 / 1 > PtrCCR2 -Sc OPT1 <T HIS5 ), XII3 ::(T SPG5 > trIiDIR1 <P GAL10 / 1 > trTsLAC3 -Sc OPT1 <T IDP1 ), XI3 ::(T PRM5 ><P GAL10 > IiUGT71B2 <T LSC2 ) The engineered bacterium with high-yield pinoresinol monoglycoside during ferulic acid feeding is obtained by knocking out the ADE2 gene and overexpressing the mPlum fluorescent protein-encoding gene in the genome of engineered bacterium XH7B1 ade2Δ ; The lignin glycoside is pinoresinol monoglycoside. When producing pinoresinol monoglycoside from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineering bacteria RB218 met15Δ and the engineering bacteria XH7B1 ade2Δ into 20 ml of Delft fermentation medium for 144 hours of mutualistic co-culture.

3. A method for constructing a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, characterized by: The yeast mutualistic symbiotic community uses Saccharomyces cerevisiae CEN.PK113-11C* as the chassis strain, and the yeast mutualistic symbiotic community is composed of engineering bacteria of the upstream module for syringin synthesis and engineering bacteria of the downstream module for syringin synthesis; The engineering bacteria of the upstream module for syringin synthesis are as described in claim 1; The engineering bacteria of the downstream module for syringin synthesis are obtained by the following method: In the genotype MATa , MAL2-8C , SUC2 , ura3Δ , his3Δ , gal80Δ , XI5 ::(P TEF - CAS9 -T CYC1 ), XII1 ::(P GAL7 > Ptr4CL5 -Sc OPT1 <T ENO2 )+(T CPS1 > ScADH6 <P GAL10 / 1 > PtrCCR2 -Sc OPT1 <T HIS5 ), XII3 ::(T SPG5 > trIiDIR1 <P GAL10 / 1 > trTsLAC3 -Sc OPT1 <T IDP1 ), XI3 ::(T PRM5 ><P GAL10 > IiUGT715a <T LSC2 ) The engineered bacterium with high yield of pinoresinol diglycoside during ferulic acid feeding is obtained by knocking out the ADE2 gene and overexpressing the mPlum fluorescent protein coding gene in the genome of XH8B1, and the engineered bacterium XH8B1 is obtained. ade2Δ ; The lignin glycoside is pinoresinol diglycoside. When producing pinoresinol diglycoside from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineering bacteria RB218 met15Δ and the engineering bacteria XH8B1 ade2Δ into 20 ml of Delft fermentation medium for 144 hours of mutualistic co-culture.

4. A method for constructing a yeast mutualistic symbiotic community for de novo synthesis of lignan glycosides, characterized by: The yeast mutualistic symbiotic community uses Saccharomyces cerevisiae CEN.PK113-11C* as the chassis strain, and the yeast mutualistic symbiotic community is composed of engineering bacteria of the upstream module for syringin synthesis and engineering bacteria of the downstream module for syringin synthesis; The engineered bacteria of the upstream module for the synthesis of lignin glycoside are as described in claim 1; The engineered bacteria of the downstream module for the synthesis of lignin glycoside are obtained by the following method: In the genotype MATa , MAL2-8C , SUC2 , ura3Δ , his3Δ , gal80Δ , XI5 ::(P TEF - CAS9 -T CYC1 ), XII1 ::(P GAL7 > Ptr4CL5 -Sc OPT1 <T ENO2 )+(T CPS1 > ScADH6 <P GAL10 / 1 > PtrCCR2 -Sc OPT1 <T HIS5 ), XII3 ::(T SPG5 > trIiDIR2 <P GAL10 / 1 > trTsLAC3 -Sc OPT1 <T IDP1 ), XI3 ::(T PRM5 ><P GAL10 > IiUGT715b <T LSC2 ), Ⅱ1 ::(T PRM5 > IiUGT71B5b <P GAL10 > IiUGT71B5b <T LSC2 ) After knocking out the ADE2 gene and overexpressing the mPlum fluorescent protein-encoding gene in the genome of the engineered bacterium XH12 with high production of recteoline B during ferulic acid feeding, the engineered bacterium XH12 is obtained ade2Δ ; The lignan glycoside is recteoline B. When producing recteoline B from scratch, ensure that the initial total OD600 of the seed bacterial solution is 0.2, and inoculate the engineering bacteria RB218 met15Δ and the engineering bacteria XH12 ade2Δ into 20 ml of Delft fermentation medium for 144 hours of mutualistic co-culture.

5. The method for constructing a yeast mutualistic symbiotic community for de novo synthesis of lignin glycoside according to claim 1, wherein: The method for preparing the Saccharomyces cerevisiae seed bacterial solution is as follows: Pick the target yeast monoclonal colony, inoculate it into 5 ml of YPD liquid medium, culture it in a shaker at 30 °C and 220 rpm for 16 hours, then dilute it 10 times and measure the OD600 to be 0.3-0.5, and wash it twice with an equal volume of Delft medium and then resuspend it to obtain the seed bacterial solution.

Images