Positive regulation of osnrt2-p2 gene in improving crop yield

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of positive regulation of OsNRT2-P2 gene in improving crop yield. The application can not only improve the yield of crops, but also improve the protein content and nitrogen utilization efficiency of crop fruits or seeds by overexpressing the OsNRT2-P2 gene in crops. When the crop is rice, the rice seeds obtained by using the GSP1 and GSP2 nucleotide sequences or genes have the advantages of yield increase, yield improvement and high nitrogen utilization rate, which opens up the channel of genetic breeding yield increase, yield improvement and high nitrogen utilization of rice, provides a new production idea for genetic breeding to improve yield, improve rice nutrition allocation and improve high-efficiency nitrogen utilization of rice, and further guarantees food security.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to an application of positively regulating OsNRT2-P2 gene in improving crop yield. BACKGROUND

[0002] As one of the world's major food crops, rice yield and yield improvement is crucial to global food security. Rice yield and yield improvement can effectively meet the growing demand for food, ensure stable food supply, improve farmers' economic income and living standards, promote rural development, reduce the number of poor people, and enhance social stability. In addition, yield improvement and yield increase can also help reduce over-exploitation and destruction of land resources and protect the ecological environment.

[0003] In recent years, extensive research on the variation of high yield and yield-related traits in different rice germplasms and their genetic basis has yielded a series of results. Genetic modification of target genes has become one of the most feasible solutions to high yield and yield, and is crucial to future sustainable agriculture. A large number of studies have found many rice high yield and yield-related genes through gene knockout mutants. However, many studies have shown that due to the possible hindrance of other intracellular limiting factors to the final function of the target gene when it is positively regulated, the imbalance of normal regulation mechanism in cells, the occurrence of intracellular toxicity effect, and the fact that cells have already made trade-offs on adaptive expression levels, many target genes may not necessarily effectively achieve the function of enhancing.

[0004] Therefore, how to provide an application of positively regulating crop yield-related genes to effectively achieve crop yield improvement has become a problem to be solved by those skilled in the art. SUMMARY

[0005] In order to provide a gene and its application capable of improving crop yield, protein content and nitrogen use efficiency, the present application provides the following technical solutions:

[0006] Application of positively regulating OsNRT2-P2 gene in one or more of improving crop yield, improving crop protein content and improving nitrogen use efficiency of crops.

[0007] The nucleotide sequence of the OsNRT2-P2 gene is shown in SEQ ID NO. 1.

[0008] Preferably, the positive regulation mode comprises overexpression.

[0009] Preferably, the improvement of crop protein content comprises improvement of fruit protein content and / or seed protein content of crops.

[0010] Preferably, the crop in the application as described above is rice.

[0011] The application also provides the use of the biological material overexpressing the OsNRT2-P2 gene in one or more of increasing the yield of crops, increasing the protein content of crops and increasing the nitrogen use efficiency of crops, wherein the biological material comprises one or more of a primer pair amplifying the OsNRT2-P2 gene, a recombinant expression vector containing the OsNRT2-P2 gene, and a recombinant microorganism containing the OsNRT2-P2 gene.

[0012] Preferably, the primer pair comprises a forward primer GSP1 and a reverse primer GSP2, wherein the nucleotide sequence of the forward primer GSP1 is shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer GSP2 is shown as SEQ ID NO. 3.

[0013] Preferably, the initial vector of the recombinant expression vector comprises pCAMBIA1300-35S.

[0014] Preferably, the OsNRT2-P2 gene is inserted between BamH I and Hind III of pCAMBIA1300-35S.

[0015] The application also provides a method for cultivating an OsNRT2-P2 transgenic crop, comprising: introducing the OsNRT2-P2 gene as described above into a target crop to obtain the OsNRT2-P2 transgenic crop.

[0016] Preferably, the crop is rice.

[0017] The application has the following beneficial effects:

[0018] The application provides the use of the OsNRT2-P2 gene in one or more of increasing the yield of crops, increasing the protein content of crops and increasing the nitrogen use efficiency of crops. By positively regulating the yield of rice, the protein content of rice and the nitrogen use efficiency in the strain, the yield per plant is increased by 20%, the protein content of rice is increased by 10%, and the nitrogen use efficiency of rice is also increased by 25%; the application opens up a channel for genetic breeding of high-yield and high-nitrogen efficient rice, and provides a new production idea for genetic breeding of high-yield, high-nutrition and high-nitrogen efficient rice, and further guarantees food security. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0020] Figure 1A schematic diagram of a rice gene expression skeleton vector structure in embodiment one of the present application;

[0021] Figure 2 Relative expression amount of OsNRT2-P2 of different plant materials in embodiment three of the present application;

[0022] Figure 3 A schematic diagram of an agronomic trait of an above-ground length of wild rice and modified rice after planting in embodiment four of the present application;

[0023] Figure 4 A schematic diagram of an agronomic trait of a biomass of wild rice and modified rice after planting in embodiment four of the present application;

[0024] Figure 5 A schematic diagram of an agronomic trait of a yield of wild rice and modified rice after planting in embodiment four of the present application;

[0025] Figure 6 A schematic diagram of a grain protein content of wild rice and modified rice after planting in embodiment five of the present application;

[0026] Figure 7 A schematic diagram of a nitrogen utilization efficiency of wild rice and modified rice after planting in embodiment five of the present application. DETAILED DESCRIPTION

[0027] The present application provides an application of positively regulating OsNRT2-P2 gene in one or more of improving crop yield, improving crop protein content and improving nitrogen utilization efficiency of crops; the accession number of the OsNRT2-P2 gene in the MSU database is (LOC_Os04g40410), and the CDS sequence of the OsNRT2-P2 gene is shown in SEQ ID NO. 1, and is specifically as follows:

[0028] SEQ ID NO. 1: 5'-ATGGCTCGGTTTGGGGCGGTAATTCACCGCGTGTTT CTACCGCTGTTGCTGCTCCTTGTAGTTCTCGGTGCTTGCCATGTCACGCCGGCGGCGGCGGCGGCGGGGGCGCGCCTCTCCGCGCTCGCGAAGGCGCTCGTCGTCGAGGCGTCGCCCCGTGCCGGCCAAGTCCTGCACGCCGGCGAGGACGCCATCACCGTGACATGGTCGCTGAACGCGACGGCGGCGGCGGCGGCGGCCGGGGCGGATGCCGGCTACAAGGCGGTGAAGGTGACCCTGTGCTACGCGCCGGCGAGCCAGGTGGGCCGCGGGTGGCGCAAGGCCCACGACGACCTGAGCAAGGACAAGGCGTGTCAGTTCAAGATCGCCCAGCAGCCGTACGACGGCGCCGGCAAGTTCGAGTACACGGTGGCACGCGACGTCCCGACGGCGTCGTACTACGTGCGCGCCTACGCGCTCGACGCGTCGGGGGCGCGGGTGGCCTATGGCGAGACGGCGCCCTCGGCCAGCTTCGCCGTCGCGGGCATCACCGGCGTCACCGCGTCCATCGAGGTCGCCGCCGGCGTGCTCTCCGCGTTCTCCGTCGCCGCGCTCGCCGTCTTCCTCGTCCTCGAGAACAAGAAGAAGAACAAGTGA-3'.

[0029] The positive regulation is preferably overexpression.

[0030] The crop is preferably rice. The increase in protein content of the crop is preferably increase in protein content of the fruit and / or seed of the crop, more preferably increase in protein content of rice.

[0031] The application further provides use of the biological material overexpressing the OsNRT2-P2 gene in one or more of the following: increasing yield of the crop, increasing protein content of the crop, and increasing nitrogen use efficiency of the crop, wherein the biological material comprises one or more of the following: a primer pair amplifying the OsNRT2-P2 gene, a recombinant expression vector containing the OsNRT2-P2 gene, and a recombinant microorganism containing the OsNRT2-P2 gene.

[0032] The primer pair of the application preferably comprises a forward primer GSP1 and a reverse primer GSP2, the nucleotide sequence of the forward primer GSP1 is preferably shown as SEQ ID NO. 2, and the nucleotide sequence of the reverse primer GPS2 is preferably shown as SEQ ID NO. 3.

[0033] SEQ ID NO. 2: 5'-gagctcggtacccggggatccATGGCTCGGTTTGGGGCG-3';

[0034] SEQ ID NO. 3: 5'-acgacggccagtgccaagcttTCACTTGTTCTTCTTCTTGTTCT CG-3'.

[0035] The initial vector of the recombinant expression vector of the application is preferably pCAMBIA1300-35S containing the 35S promoter of the Cauliflower mosaic virus (CaMV); when the initial vector is pCAMBIA1300-35S, the OsNRT2-P2 gene is preferably inserted between BamH I and Hind III of pCAMBIA1300-35S, and more preferably the CDS sequence amplified by the primer pair described in the above technical solution is inserted between BamH I and Hind III of pCAMBIA1300-35S to form pCAMBIA1300-35S-OsNRT2-P2. The construction method of the recombinant expression vector of the application is not particularly limited, and the conventional vector construction method in the art can be used, such as enzyme digestion and ligation.

[0036] The recombinant microorganism of the application is preferably a recombinant microorganism obtained by transforming the recombinant expression vector described in the above technical solution into Agrobacterium, and the Agrobacterium is preferably EHA105.

[0037] The application also provides a method for cultivating an OsNRT2-P2 transgenic crop, comprising: introducing the OsNRT2-P2 gene into a target crop to obtain the OsNRT2-P2 transgenic crop, and the crop is preferably a monocotyledonous plant, and more preferably rice. The method for introducing the OsNRT2-P2 gene into the target crop is not particularly limited, and the conventional method in the art can be used.

[0038] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the application.

[0039] Example 1

[0040] Construction of a gene expression vector for overexpression of the OsNRT2-P2 gene

[0041] 1) RNA extraction

[0042] Take 20-50 mg of Japonica rice Zhonghua 11 plant sample, freeze in liquid nitrogen and grind into powder. Add 1 ml of Invitrogen Trizol reagent from Thermo Fisher Scientific to lyse the cells, then add 0.2 ml of chloroform, shake vigorously for 15 s, incubate at room temperature for 3 min, and centrifuge (8000 g, 15 min). Transfer the aqueous phase (supernatant) to a new tube, precipitate the RNA in the aqueous phase with isopropanol, incubate at room temperature for 10 min, and centrifuge again (8000 g, 15 min). Wash the RNA precipitate with 1 ml of 75% ethanol, centrifuge at 7500 g for 5 min, discard the supernatant, remove the ethanol, air dry, and dissolve in 30 μl of ddH2O.

[0043] 2) RNA reversal

[0044] Using the Novizan reverse transcription kit Reverse transcription was performed using the 1st Strand cDNA Synthesis Kit. In a 200 μl centrifuge tube, the following solutions were mixed: 1 μl Oligo(dT)23VN (50 μM), 3 μl RNase-free ddH2O, and 5 μl of the RNA solution from the previous step. The mixture was heated at 65°C for 5 min, then rapidly cooled on ice and incubated for 2 min on ice. 8 μl of the mixture from the previous step was added to 10 μl of 2×RT Mix and 2 μl of HiScript II Enzyme Mix, and gently mixed by pipetting.

[0045] The first-strand cDNA synthesis reaction was carried out at 50℃ for 45 min and 85℃ for 2 min on a PCR instrument.

[0046] 3) Acquisition of target genes

[0047] Mix the following solutions in a 200 μl centrifuge tube: 5 μl of the cDNA solution obtained in the previous step, 2 μl of GSP1 (as shown in SEQ ID NO. 2: 5'-gagctcggtacccggggatccATGGCTCGGTTTGGGGCG-3'), 2 μl of GSP2 (as shown in SEQ ID NO. 3: 5'-acgacggccagtgccaagcttTCACTTG TTCTTCTTCTTGTTCTCG-3'), 25 μl of 2×Phanta Max Master Mix, and 16 μl of dd H2O. Perform the PCR reaction according to the procedure described in Table 1.

[0048] Table 1 PCR reaction procedure

[0049]

[0050] 4) Recombinant vector obtaining

[0051] The pCAMBIA1300-35S vector was linearized by using high-fidelity restriction enzymes Hind III and BamH I, and the linearized vector was recovered. The solution of OsNRT2-P2 CDS with homologous arms obtained in the previous step was subjected to homologous recombination in the presence of 5x CE II Buffer and Exnase II (Vazyme ClonExpress II One Step Cloning Kit), and the reaction time was 1 h. The pCAMBIA1300-35S-OsNRT2-P2 recombinant vector was obtained, and the structure of the rice gene expression backbone vector is shown in Figure 1 .

[0052] Example 2

[0053] Taking japonica rice Zhonghua 11 (ZH11) as an example, the OsNRT2-P2 gene was transformed into rice seeds to obtain japonica rice Zhonghua 11 transgenic rice.

[0054] The pCAMBIA1300-35S-OsNRT2-P2 gene expression plasmid prepared in Example 2 was transferred into the competent cells of Agrobacterium tumefaciens strain EHA105, and then sequentially subjected to ice bath for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, and ice bath for 5 min. Subsequently, the LB culture medium without antibiotics was added, and the mixture was activated in a 28℃ shaking bed for 1 h to obtain the Agrobacterium strain containing the pCAMBIA1300-35S-OsNRT2-P2 gene expression plasmid.

[0055] The prepared EHA105 strain containing the gene expression plasmid was used to transform the callus of japonica rice Zhonghua 11, and the specific steps were as follows:

[0056] The callus induction and subculture of japonica rice Zhuhua 11 can be performed by using the conventional operation method known to those skilled in the art. The Agrobacterium containing the pCAMBIA1300-35S-OsNRT2-P2 gene expression plasmid is cultured in AAM liquid medium containing 50 mg / L kanamycin (Kan) and 50 mg / L rifampicin (Rif) at 28°C in the dark with 200 r / min shaking until the D600 nm is 0.4-0.6. The bacterial cells are collected by centrifugation and resuspended in liquid NB-As to a D600 nm of 0.1. The callus with a proper size and good condition is immersed in a 50 ml centrifuge tube containing the resuspended Agrobacterium for 30 min, and the excess bacterial liquid is absorbed on a sterile filter paper in a clean bench. After drying, the callus is transferred to solid NBD-As medium with sterile filter paper, and cultured in the dark at 25°C.

[0057] After 3 days, the callus is soaked in sterile water containing 150 mg / L Timentin for 10 min, the excess water is absorbed, and the callus surface is dried with sterile filter paper in a clean bench. Then, the callus is transferred to NBD-As medium for recovery and cultured in the light at 32°C for 4 d. Then, the callus is transferred to NBD-T medium containing the screening antibiotic hygromycin for further screening and subculture every 2 weeks. When the induced adventitious buds grow to 3-5 cm, the seedlings are cut and transferred to rooting medium RE2 for rooting induction to obtain seedlings.

[0058] Example Three

[0059] The total DNA of the leaf of the seedling obtained in Example Two is extracted, and the hygromycin resistance gene is identified by PCR to obtain three transformed positive seedlings. Then, the total RNA of the selected hygromycin positive seedlings is extracted, and the cDNA is obtained by reverse transcription. The SYBR qPCR MasterMix of Novozyme Biotech Co., Ltd. is used for qPCR detection, and the OsActin gene is used as an internal reference gene for comparison. The qPCR identification primers are as follows:

[0060] OsNRT2-P2 qPCR Forward Primer 5'-3'

[0061] SEQ ID NO. 4: TGTTGCTGCTCCTTGTAGTTCTC

[0062] OsNRT2-P2 qPCR Reverse Primer 5'-3'

[0063] SEQ ID NO. 5: CTTCTTCTTGTTCTCGAGGACGA

[0064] OsActin qPCR Forward Primer 5'-3'

[0065] SEQ ID NO. 6: GGGTTCACAAGTCTGCCTATTGT

[0066] OsActin qPCR Reverse Primer 5'-3'

[0067] SEQ ID NO. 7: ACGGGACACGACCAAGGA

[0068] The relative expression of OsNRT2-P2 in wild type Zhonghua 11 (ZH11) and three homozygous OsNRT2-P2 overexpression transgenic rice lines, OsNRT2-P2-OE1, OsNRT2-P2-OE4 and OsNRT2-P2-OE10, are shown in Figure 2 The relative expression of OsNRT2-P2 in OsNRT2-P2-OE1, OsNRT2-P2-OE4 and OsNRT2-P2-OE10 is 1-fold, 1.75-fold and 1.5-fold higher than that in ZH11, respectively.

[0069] Example Four

[0070] Rice plant height, biomass and rice yield detection

[0071] Wild type Zhonghua 11 rice (ZH11), OsNRT2-P2-OE1, OsNRT2-P2-OE4 and OsNRT2-P2-OE10 seeds were respectively cultivated into the soil according to the farmers' conventional cultivation method, and the agronomic management during the growth of the rice was implemented according to the farmers' daily management method. Only slow-release nitrogen, phosphorus and potassium compound fertilizer was applied during the whole growth period, and the total nitrogen application amount was 10.4 g / m 2 After the rice matured, the agronomic traits of the aboveground length, biomass and yield of the rice were measured, as shown in Figure 3 , 4 , 5, respectively.

[0072] As can be seen from Figure 3 , the aboveground height of wild type Zhonghua 11 rice (ZH11) is about 104 cm, while the plant height of three different OsNRT2-P2 overexpression homozygous lines, OsNRT2-P2-OE1, OsNRT2-P2-OE4 and OsNRT2-P2-OE10, is between 109 cm and 118 cm;

[0073] As can be seen from Figure 4It can be seen that the dry weight of the above-ground part of wild-type Zhonghua 11 rice (ZH11) is about 13.5 g, and the biomass of three different homozygous OsNRT2-P2 overexpression lines is increased by 18.5% to 48.1% compared with the wild type.

[0074] From Figure 5 It can be seen that the yield per plant of wild-type Zhonghua 11 rice (ZH11) is about 6.5 g, and the yield per plant of three different homozygous OsNRT2-P2 overexpression lines is increased by about 15% compared with wild-type Zhonghua 11 (ZH11).

[0075] In summary, overexpression of the OsNRT2-P2 gene can significantly increase the above-ground height, biomass, and overall growth of rice, and the yield of rice is also significantly increased.

[0076] Example Five

[0077] Rice protein content detection

[0078] The same rice material as in Example Four was used, and after measuring the agronomic traits in Example Four, the rice was harvested and the above-ground part and rice were dried and weighed. Then, 98% concentrated sulfuric acid was used for digestion, and after the solution was homogenized and turned black, 15% H2O2 was added to titrate the solution to a clear solution, and then the digestion was continued until the H2O2 was completely driven off. The completely lysed sample solution was filtered through a nylon filter membrane and collected in a clean tube. The ammonium content in the solution was determined by indigo blue colorimetry in an enzyme marker instrument, and the results are shown in Figure 6 .

[0079] From Figure 6 It can be seen that the protein content of wild-type Zhonghua 11 (ZH11) is about 6.3-7 mg / g, and the protein content of three different homozygous OsNRT2-P2 overexpression lines is increased by about 8%-15% compared with wild-type Zhonghua 11.

[0080] The nitrogen utilization efficiency of the rice material was calculated using the nitrogen utilization efficiency calculation formula, and the results are shown in Figure 7 .

[0081] The nitrogen utilization efficiency is calculated according to the following formula:

[0082] Nitrogen utilization efficiency = amount of nitrogen fertilizer absorbed by rice plants / amount of nitrogen fertilizer applied.

[0083] As Figure 7As shown, the nitrogen use efficiency of wild type Zhonghua 11 (ZH11) is about 47%, while the nitrogen use efficiency of three different homozygous OsNRT2-P2 overexpression lines can reach 58%-70%, and the nitrogen use efficiency of the three different homozygous OsNRT2-P2 overexpression lines is increased by 11%-33% compared with wild type Zhonghua 11 (ZH11).

[0084] In summary, the overexpression of rice OsNRT2-P2 gene significantly increases the nitrogen content and yield of rice and improves the nitrogen use efficiency of rice, and in addition, it also promotes the agronomic traits such as plant height and biomass.

[0085] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements can be made, and these improvements should also be considered as the protection scope of the present application.

Claims

1. Application of positively regulating OsNRT2-P2 gene in improving protein content of crops and / or improving nitrogen use efficiency of crops; the improvement of protein content of crops includes improvement of protein content of crop fruits; the crops are rice; the nucleotide sequence of the OsNRT2-P2 gene is shown as SEQ ID NO. 1; the positively regulating mode is overexpression.

2. A method of breeding an OsNRT2-P2 transgenic crop, characterized in that, Including: introducing the OsNRT2-P2 gene as described in claim 1 into target crops to obtain the OsNRT2-P2 transgenic crops; the OsNRT2-P2 transgenic crops have high protein content and / or high nitrogen use efficiency; the crops are rice.

Images