Application and method of PARP inhibitor Veliparib in screening out embryos with heterozygous BRCA1 mutations

Abstract

The present invention relates to the application and method of the PARP inhibitor Veliparib in screening BRCA1 heterozygous mutant embryos. The present invention applies a PARP inhibitor Veliparib with low capture effect to the screening of BRCA1 heterozygous mutant mouse embryos. Through animal experiments, a new use of 7.5 μM Veliparib in selectively blocking the development of BRCA1 heterozygous embryos is developed, blocking the inheritance of the BRCA1 pathogenic gene and avoiding the birth of BRCA1 heterozygotes in the offspring. Compared with the currently clinically applied PGT-M technology, the present invention breaks through the thinking of screening mutant embryos using gene sequences, and innovatively and more directly and efficiently screens BRCA1 heterozygous embryos with insufficient homologous recombination function from the protein function level, with the characteristics of simple operation, high cost performance, small trauma and high accuracy.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application and method of PARP inhibitor Veliparib in screening out embryos with BRCA1 heterozygous mutations. Background Art

[0002] Malignant tumors, as major public health events threatening human health, have ranked first among the causes of death in our country. Among them, hereditary tumors, with their unique genetic backgrounds and pathogenesis mechanisms, account for 5-10% of malignant tumors. Among such tumors, hereditary ovarian cancer and breast cancer (HBOC) and the BRCA1 gene have been widely studied. In patients with hereditary breast cancer, pathogenic mutations of BRCA1 have been detected in more than 90% of cases. The BRCA1 gene is located on human chromosome 17 and plays a crucial role in cell physiological processes such as transcriptional regulation, DNA repair, and cell cycle regulation. Research shows that pathogenic variations of BRCA1 can significantly increase the risks of ovarian cancer and breast cancer, up to 65% and 39% respectively. In addition, such gene variations can also increase the risks of patients suffering from other cancers, such as pancreatic cancer, gastric cancer, and male prostate cancer.

[0003] In the general population of our country, the incidence rate of pathogenic mutations in hereditary BRCA1 / 2 is 0.29%-1.10%. It poses a huge threat to the tumor susceptibility of individuals and families. For women carrying pathogenic BRCA1 mutations, reproductive decision-making is an urgent and difficult issue. On the one hand, they need to complete reproduction as early as possible and reduce the risk of malignant tumors through prophylactic surgery, salpingo-oophorectomy; on the other hand, due to the dominant inheritance characteristics of BRCA1 mutations, their offspring still have a 50% chance of carrying the same pathogenic mutations. Although prenatal diagnosis (PND) and preimplantation genetic testing (PGT) provide technical means to prevent the transmission of genetic diseases, there are still many deficiencies in the actual application of these methods. Among them, female patients undergoing PND may experience repeated miscarriages to obtain a healthy fetus. In contrast, although PGT enables patients to understand the gene mutation status of embryos before pregnancy and make decisions in advance; however, studies have found that the utilization rate of PGT-M (Preimplantation Genetic Testing for Monogenic Diseases) among BRCA1 pathogenic variant carriers is only between 10% and 26%. PGT-M usually obtains embryos through in vitro fertilization and conducts in vitro culture. When the embryos develop to the four- to eight-cell stage, one or two cells (called blastomeres) in the embryos are removed using microsurgical techniques, and then the DNA in the extracted cells is detected using probes or sequencing. According to the analysis results, it is judged whether the embryo has a genetic disease. The low utilization rate is because PGT requires more complex operations and higher detection costs, and there are still many problems to be solved technically; for example, there is potential embryo damage during the biopsy process, and the detection accuracy is limited; such as problems due to limited sampling and embryo chimerism, and again, due to the limitations of single-cell gene analysis technology and the false positive rate of FISH detection and the low concordance rate of NGS detection, all of which may lead to deviations in the final detection results. Particularly prominent is that humans currently cannot accurately interpret the functional changes of mutations at any locus of a certain gene, which means that even if the accuracy of PGT-M is fully improved, the data obtained by sequencing cannot represent whether the gene function is affected, and thus it is impossible to achieve the purpose of screening out all gene-defective embryos at the gene function level.

[0004] Since PARP inhibitors were discovered in 2005 to be able to kill tumor cells with BRCA1 mutations, they have currently been widely used in the maintenance treatment and post-relapse treatment of ovarian cancer with homologous recombination repair defects. Their killing effect is mainly achieved through the "synthetic lethality" effect, and at the same time, with the help of the DNA-binding effect, that is, firmly binding to the cell's DNA to assist in preventing the action of DNA repair enzymes, so that BRCA1 mutant tumor cells cannot successfully repair DNA damage and die. It is precisely because different PARP inhibitors have different degrees of DNA-binding effects that they also have a certain impact on the physiological functions of normal cells. After patients take the medicine, they will experience myelosuppression, gastrointestinal toxicity, renal toxicity, etc. However, regarding their specific effects on germ cells and embryos and their action mechanisms, there is currently a lack of sufficient research and understanding. Therefore, for the application of Veliparib in the field of reproductive health, the present invention needs to be cautious and continue to deeply explore its potential impacts. In view of this, the present invention relates to the application and method of the PARP inhibitor Veliparib in screening out BRCA1 heterozygous mutant embryos. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide the application and method of the PARP inhibitor Veliparib in screening out BRCA1 heterozygous mutant embryos. The purpose is to screen embryos at the protein function level to achieve safer, more effective, and more convenient pre-implantation embryo screening.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] First aspect, the application of the PARP inhibitor Veliparib in the preparation of a drug for screening out BRCA1 heterozygous mutant embryos.

[0008] Among them, Veliparib, as a member of PARP inhibitors, with the Chinese name veliparib and the code ABT-888, is a novel and effective PARP1 and PARP2 inhibitor, with K i being 5.2 nM and 2.9 nM respectively. The molecular formula is C 13 H 16 N 4 O .2 C l H, and the chemical structural formula is: It is used to treat BRCA1 mutant breast cancer and ovarian cancer.

[0009] The beneficial effects of the present invention are as follows: The present invention applies a PARP inhibitor Veliparib with low capture effect to the screening of BRCA1 heterozygous mutant mouse embryos; through animal experiments, a new use of 7.5 μM Veliparib to selectively block the development of BRCA1 heterozygous embryos is developed, blocking the inheritance of the pathogenic BRCA1 gene and avoiding the birth of BRCA1 heterozygotes in the offspring; compared with the currently clinically applied PGT-M technology, this invention breaks through the thinking of screening mutant embryos using gene sequences, and innovatively and more directly and efficiently screens BRCA1 heterozygous embryos with insufficient homologous recombination function from the protein function level, with the characteristics of simple operation, high cost performance, small trauma, and high accuracy.

[0010] On the basis of the above technical solution, the present invention can also be improved as follows.

[0011] Furthermore, the PARP inhibitor Veliparib, through the effect of synthetic lethality, takes advantage of the insufficient homologous recombination repair function of BRCA1 heterozygotes in BRCA1 heterozygous mutant embryos, causing the BRCA1 heterozygous mutant embryos to accumulate more DNA damage, so as to achieve the result of blocking the development of the BRCA1 heterozygous mutant embryos.

[0012] Furthermore, the PARP inhibitor Veliparib does not affect the development and implantation of normal embryos, as well as the growth and development of the offspring of normal embryo development.

[0013] In the second aspect, a drug for screening out BRCA1 heterozygous mutant embryos, the drug includes the PARP inhibitor Veliparib described above.

[0014] The actual dose of the active ingredient (PARP inhibitor Veliparib) in the above drug should be determined according to various relevant factors, including the severity of the disease to be treated, the administration route, the age, gender, and weight of the patient. Therefore, the above dose should not limit the protection scope of the present invention in any way.

[0015] Furthermore, the drug also includes pharmaceutically acceptable excipients.

[0016] Furthermore, the drug also includes pharmaceutically acceptable carriers.

[0017] Furthermore, the dosage form of the drug is any one of solution type, particulate dispersion type (such as microsphere preparation, microcapsule preparation, nanocapsule preparation).

[0018] Third aspect, a screening method for in vitro screening of BRCA1 heterozygous mutant embryos using the PARP inhibitor Veliparib, the screening method being for non-diagnostic purposes and comprising the following steps: placing the embryos cultured by in vitro fertilization into a culture medium containing the PARP inhibitor Veliparib and continuously culturing for at least 3 days until the embryos develop to the blastocyst stage.

[0019] Further, the initial stage of the embryos cultured by in vitro fertilization is mouse embryos at the two-cell stage of in vitro fertilization culture.

[0020] Further, the concentration of the PARP inhibitor Veliparib in the culture medium is 7.5 μM.

[0021] Further, a screening method for in vitro screening of BRCA1 heterozygous mutant embryos using the PARP inhibitor Veliparib comprises the following specific steps: (1) constructing a BRCA1 heterozygous deletion C57BL / 6 mouse model and performing in vitro fertilization (IVF) to simulate the process of in vitro fertilization embryo transfer in BRCA1 mutant female carriers, and screening the obtained mouse embryos in an embryo culture medium containing the optimally screened concentration of Veliparib until the embryos reach the blastocyst stage, so that the development of embryos with BRCA1 heterozygous mutations is inhibited due to DNA repair dysfunction, while wild-type embryos can continue to develop normally through homologous recombination repair.

[0022] Compared with PGT-M, the screening of embryos by the drug in the present invention is also carried out during the IVF-ET process. The drug action time is from the 2-cell stage to the blastocyst stage of the embryos, and the mouse embryos are implanted into the mouse uterine cavity through the same operation as the human embryo transfer process to verify the killing effect of the scheme on mutant embryos and the safety on wild-type embryos, which can effectively avoid the biopsy step in the PGT-M method, simplify the operation, and also effectively avoid the potential damage caused by biopsy to the embryos.

[0023] Under natural conditions, among the embryos obtained by in vitro fertilization of BRCA1 heterozygous female mice and wild-type male mice, BRCA1 heterozygous embryos should account for 50%, which is the same as the proportion of BRCA1 heterozygotes in the offspring mice. The genotypes of the embryos that have successfully developed to the blastocyst stage after screening with 7.5 μM Veliparib drug are identified by nested PCR method to judge that the drug treatment can effectively inhibit the development of BRCA1 heterozygous embryos and prevent them from reaching the blastocyst stage.

[0024] Furthermore, the in vitro fertilization-embryo transfer process in clinical practice was simulated. The blastocysts treated with 7.5 μM Veliparib were transplanted into the uterus of surrogate ICR mice. After pregnancy and delivery, the genotypes of the subsequent offspring mice were further identified by PCR. Through the drug screening treatment of this protocol, the purpose of effectively avoiding the birth of BRCA1 heterozygous mice was achieved.

[0025] Furthermore, a method for verifying the physiological functions of wild-type embryos after Veliparib screening treatment and the safety of the offspring mice developed from the embryos was provided. Specifically, the detection of the physiological functions of the embryos included indicators such as embryo proliferation ability, blastocyst differentiation ability, and embryo invasion ability; the safety of the offspring included verification of growth and development, nerve reflexes, onset of puberty, fertility, and learning and memory ability; to ensure that the drug treatment had no significant damage to the physiological functions of wild-type embryos and the healthy development of offspring mice. Brief Description of the Drawings

[0026] Figure 1 This is the chemical structural formula of Veliparib of the present invention;

[0027] Figure 2 This is the schematic diagram of the operation process of the present invention;

[0028] Figure 3 This shows the effect of Veliparib on the in vitro development of embryos in each group of the present invention; among them, A are pictures of embryos at each stage (2-cell / 4-cell / 8-cell / morula stage / blastocyst stage) of the WT group (WT♀×WT♂) and the BRCA1 group (Brca1 + / - ♀×WT♂) at different Veliparib concentrations; B is the comparison of the embryo survival curves between the WT group and the BRCA1 group at different Veliparib concentrations.

[0029] Figure 4 This shows the proportion of blastocyst genotypes in each group after Veliparib treatment of the present invention; among them, A are the electrophoresis results of genotype detection of blastocysts in the control group and the Veliparib treatment group using the semi-nested PCR method. The white numbered digits in the figure represent wild-type embryos, the yellow numbers represent BRCA1 heterozygous embryos, and the green "+" represents the positive control; B is the identification result of the genotype detection of the two groups of embryos.

[0030] Figure 5 This is the genotype of the offspring mice after blastocyst transplantation treated with Veliparib of the present invention.

[0031] Figure 6Detection of related indexes of the growth and development of the offspring after embryo transfer in the Veliparib treatment group and the control group of the present invention; among them, A is the comparison of the body weight changes of the offspring mice in the Veliparib treatment group and the control group at multiple time points; B is the comparison of the average percentage of bilateral auricle opening of the two groups of mice; C is the comparison of the average percentage of mandibular tooth eruption of the two groups of mice; D is the comparison of the average percentage of bilateral eye opening of the two groups of mice;

[0032] Figure 7 Detection of related indexes of the nerve reflex of the offspring after embryo transfer in the two groups of the present invention; among them, A is the comparison of the righting reflex of the offspring mice in the Veliparib treatment group and the control group; B is the comparison of the cliff avoidance test between the two groups of mice; C is the comparison of the negative geotaxis experiment between the two groups of mice;

[0033] Figure 8 Detection of related indexes of the onset of puberty of the offspring after embryo transfer in the two groups of the present invention; among them, A is the comparison of testicular descent of the offspring female mice in the Veliparib treatment group and the control group; B is the comparison of vaginal opening of the offspring male mice between the two groups;

[0034] Figure 9 Detection of related indexes of the reproductive ability of the offspring after embryo transfer in the two groups of the present invention; among them, A is the comparison of sperm concentration of the offspring male mice in the Veliparib treatment group and the control group; B is the comparison of sperm motility of the two groups of mice; C is the comparison of the percentage of forward motile sperm of the two groups of mice; D is the comparison of the pregnancy rate of the offspring female mice in the Veliparib treatment group and the control group after natural mating; E is the comparison of the average litter size of the two groups of female mice; F is the comparison of the live birth rate of the two groups of female mice;

[0035] Figure 10 Detection of related indexes of the learning and memory ability of the offspring after embryo transfer in the two groups of the present invention; among them, A is the representative trajectory image of the offspring mice in the Veliparib treatment group and the control group; B is the comparison of the number of times the two groups of offspring mice pass through the platform position; C is the comparison of the percentage of the time the two groups of offspring mice stay in the quadrant where the platform is located. Detailed implementation mode

[0036] The principles and features of the present invention are described below. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention. For those not specifying specific techniques or conditions in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For those reagents or instruments not indicating the manufacturer, they are all conventional products that can be purchased through regular channels.

[0037] Example

[0038] 1. Experimental reagents and materials

[0039] 1.1 Main reagents

[0040] Veliparib( Figure 1 , Selleck), mHTF embryo culture medium (cosmo bio), KSOM embryo culture medium (cosmobio), pregnant mare serum gonadotropin (Beijing Solarbio Science & Technology Co., Ltd.), human chorionic gonadotropin for injection (Anhui Fengyuan Pharmaceutical Co., Ltd.), ready-to-use normal goat serum (Boster Biological Technology), Triton X-100 (Beijing Solarbio Science & Technology Co., Ltd.), 75% ethanol (Xilong Scientific), bovine serum albumin (Saiweier Biological), DAPI staining reagent (Saiweier Biological), Red nucleic acid gel dye 10,000× (MCE), sodium pentobarbital (Sigma-Aldrich), 4% paraformaldehyde (Saiweier Biological), agarose (Beijing Baijing Biological), mineral oil for culture (Sigma-Aldrich).

[0041] 1.2 Main instruments

[0042] Tri-gas incubator (COOK), electronic balance (Mettler Toledo), electrophoresis apparatus (Bio-Rad), mouth pipette (Drummond scientific), microscope hot stage (Guangzhou Mingmei Technology Co., Ltd.), upright optical microscope (Olympus), fluorescence inverted microscope (Zeiss), high-speed low-temperature centrifuge (Heal Force), PCR instrument (Bio-Rad), etc.

[0043] 1.3 Experimental animals

[0044] The experimental research subjects were C57BL / 6 mice with heterozygous deletion of BRCA1, and the transgenic mice were constructed by Cyagen Biosciences Inc. The specific method was as follows:

[0045] The donor vector containing the "WPRE-rBGpA" cassette, the gRNA targeting the mouse BRCA1 gene (CATTTTGTACTTCTTGAATTTGG, SEQ ID NO: 1), and Cas9 mRNA were co-injected into C57BL / 6 mouse fertilized eggs to produce offspring mice with BRCA1 function deficiency. The genotypes of F0 primary mice were identified by PCR method and sequencing analysis was performed. The F0 primary mice were crossed with wild-type C57 mice for germline transmission and subsequent animal experiments. For C57BL / 6 mice used in in vitro fertilization experiments, the female mice were 4 weeks old (w) and the male mice were 8 weeks old (w).

[0046] All mice used in the research of this invention were housed in the SPF-class animal room of the Animal Experiment Center in the Research Building of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, maintaining a fixed light-dark cycle, conforming to the daily rhythm of mice, and having appropriate temperature and humidity. It has passed the approval of the Ethics Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (Ethics number: TJH-202110009).

[0047] 2. Experimental methods

[0048] The schematic diagram is as Figure 2 shown.

[0049] 2.1 Experimental grouping

[0050] Forty 4-week-old BRCA1 heterozygous female mice and ten 10-week-old wild-type (WT) male mice were used to obtain embryos through in vitro fertilization. The 2-cell embryos were randomly divided into two groups, namely the Veliparib treatment group and the blank control group. The concentration of Veliparib drug in the culture medium of the Veliparib treatment group was 7.5 μM.

[0051] 2.2 Mouse genotype identification

[0052] DNA extraction: Cut 1-2 mm of the mouse tail or toe and place it in a 1.5 mL EP tube. Use DNA extraction lysis solution to extract animal tissue DNA. Add 100 μL of Lysis Buffer for PCR and 1 μL of Proteinase K to each tube according to the instructions and mix well. Heat in a metal bath at 60 °C for 5 minutes, then at 98 °C for 2 minutes. After the reaction is completed, transfer the supernatant to a new centrifuge tube and place it on ice.

[0053] PCR: Take 2 μL of the supernatant as the DNA template for PCR reaction. Prepare the corresponding PCR mixture in an eight-well tube. The PCR reaction system is as follows:[[]]

[0054] Table 1 PCR reaction system

[0055]

[0056] Table 2 The PCR primer sequences are as follows

[0057]

[0058] Mix well and centrifuge. Perform the PCR reaction in a PCR instrument. The process is as follows:[[]]

[0059] Table 3 PCR reaction process

[0060]

[0061] Agarose gel electrophoresis: Dissolve 2 g of agarose powder in 100 mL of 0.5×TBE electrophoresis buffer and heat until completely dissolved. Add 10 μL of Red nucleic acid gel dye (10,000×), pour it into the gel casting mold, and let it stand at room temperature for 30 minutes. Add the PCR products and Marker into the sample wells of the agarose gel. Usually, 5 - 10 μL of the sample is added to each well. Connect the power supply, adjust the voltage to 100 V, and run for 30 minutes to make the DNA fragments move towards the positive electrode under the action of the electric field.

[0062] Observation of results: After the electrophoresis is completed, place the gel in the gel imaging system to observe and record the results.

[0063] 2.3 In vitro fertilization (IVF) and embryo treatment with Veliparib:

[0064] Superovulation of female mice: Use 4-week-old BRCA1 heterozygous C57BL / 6 female mice for superovulation. Each mouse is intraperitoneally injected with 5 IU of pregnant mare serum gonadotropin (PMSG), and 48 h later, injected with 5 IU / only of human chorionic gonadotropin (HCG). The mice are sacrificed by cervical dislocation 14 - 16 h later, and the bilateral fallopian tubes are removed. Under the stereomicroscope, find the transparent and enlarged parts of the bilateral fallopian tubes of the mice, tear them open with forceps to obtain the cumulus-oocyte complex (COC), and transfer it into mHTF;

[0065] Sperm collection and capacitation: Sacrifice 10-week-old C57BL / 6 male mice, take the bilateral caudal epididymides, squeeze out the sperm under the microscope and transfer it into the mHTF culture medium, and use it for fertilization after capacitation for 1 h.

[0066] In vitro fertilization: Add 3 - 4 μL of capacitated sperm into each mHTF droplet, and place it in a triple gas incubator for fertilization for 4 - 6 h. After fertilization is completed, transfer the embryos into the KSOM embryo culture medium;

[0067] Embryo treatment with Veliparib: Collect two-cell embryos (24 h after fertilization) the next day, randomly divide them into a control group and a Veliparib treatment group, and transfer them into the KSOM culture medium and the KSOM culture medium containing 7.5 μM Veliparib respectively for continued culture.

[0068] 2.4 Blastocyst-uterus transplantation

[0069] Preparation of pseudopregnant female mice: Select 8-week-old ICR female mice with a reproductive history, good mothering ability, and in estrus, and cage them with ligated male mice (female:male = 2:1). Observe the next morning, and those with a vaginal plug are pseudopregnant mice. Randomly divide them into a control group and an experimental group for use as surrogate mothers for transplantation;

[0070] Mouse anesthesia: On the 3.5th day after vaginal suppository administration, 1% sodium pentobarbital solution was prepared with normal saline as an anesthetic drug, and injected intraperitoneally at a dose of 50 mg / kg according to the weight of the mouse. After injection, the mouse was left to stand for 10 minutes to ensure that the mouse was fully anesthetized before subsequent surgical operations.

[0071] Disinfection and local infiltration anesthesia: Shave the back of the anesthetized female mouse, fix it on the operating table in a prone position, and wrap its head with a towel or cloth to prevent it from waking up during the operation. Disinfect the back of the female mouse with iodine and alcohol;

[0072] Incision: Make a small cut on one side of the spine on the back of the mouse, cut the peritoneum, and expose the ovaries and uterus of the surrogate mouse. The uterus is usually located deep in the abdominal cavity, close to the spine.

[0073] Embryo preparation: Take out the embryos from the KSOM embryo culture medium and use a microscope to check the quality and development stage of the embryos. Select high-quality blastocysts with obvious blastocyst cavity and hatched as the transplant objects, and transfer the blastocysts to the pre-balanced MⅡ culture medium;

[0074] Embryo transplantation: The embryo transplantation process requires the cooperation of two people. One person uses forceps to pull the ovaries, fallopian tubes and uterus out of the peritoneum. Under a stereo microscope, accurately find the connection between the uterus and the fallopian tubes, which is the uterine horn. Use an insulin syringe to gently pierce a small hole in the uterine horn. The other person uses a mouth pipette to suck the blastocyst into the capillary glass tube under the microscope, sucking as little liquid as possible, inserting the capillary glass tube loaded with the blastocyst into the small hole in the uterine horn, and gently blowing to allow the blastocyst in the capillary glass tube to enter the uterus. Be careful to avoid bringing in excess culture medium or bubbles. The capillary glass tube should not be inserted too deep to avoid damaging the endometrium or causing blockage of the tube. After completion, check whether there are any remaining embryos in the capillary glass tube.

[0075] Suturing the wound: After the transplant is completed, carefully put the ovaries, fallopian tubes and uterus back into the peritoneum, and use surgical sutures to suture the peritoneum and skin layer by layer to ensure that the wound is neat and tight to promote postoperative recovery.

[0076] Postoperative care: Place the mice in a warm and dry environment after surgery, and return them to the animal room after they fully wake up. Pay attention to the mice's condition and reaction, keep the surgical site clean and dry, and avoid infection and other complications. At the same time, give them appropriate nutrition and water supplements to promote wound healing and physical recovery.

[0077] 2.5 Experimental observation indicators

[0078] 2.5.1 IVF embryo development capacity in vitro

[0079] Observation and recording of results: At 48, 60, 72, and 96 h after fertilization, photos were taken using ZEN 2012 software and then counted. The development of embryos reaching the four-cell, eight-cell, morula, and blastocyst stages was observed and statistically analyzed respectively. The blastocyst stage was determined when a blastocoel was observed under the microscope. Main parameter calculation methods:

[0080] Blastocyst rate = number of blastocysts / number of two-cell embryos × 100%;

[0081] Fertilization rate = number of two-cell embryos / number of oocytes × 100%;

[0082] Embryo survival rate = number of embryos at this stage (four-cell, eight-cell, morula stage) / number of two-cell embryos × 100%;

[0083] 2.5.2 Observation and recording of the birth situation of offspring mice

[0084] Starting from the 14th day after transplantation, the pregnancy and delivery situations of surrogate female mice were observed daily. On the day of birth of offspring mice, the total number of born mice, the number of live births, and the number of stillbirths were counted, and the weight of each mouse was measured and its gender was checked. The calculation methods of the birth outcome parameters of offspring mice after transplantation are as follows:

[0085] Pregnancy rate (%) = number of pregnant mice after transplantation / total number of transplanted mice × 100%;

[0086] Live birth rate (%) = number of live births / total number of offspring × 100%;

[0087] Birth rate (%) = total number of offspring / number of transplanted embryos × 100%;

[0088] 2.5.3 Identification of blastocyst genotype by semi-nested PCR

[0089] According to the experimental plan, after the mixed embryos were transferred into Veliparib and treated for 72 hours, the embryos that successfully reached the blastocyst stage were collected for genotype identification to judge the killing effect of in vitro drug treatment on BRCA1 heterozygous embryos. However, due to the small number of blastocyst cells and low DNA content, in order to detect its genotype, the semi-nested PCR method was selected. This method requires two rounds of PCR amplification. Three primers were designed. First, the first pair of primers F3R6 was used to perform the first round of amplification on blastocyst DNA. Subsequently, using the first-round PCR product as a template, the second-round PCR amplification was carried out, and the second-round primer was F3R5. The primer sequences are as follows:

[0090] Table 4 Primer sequences

[0091]

[0092] DNA Extraction: Extract embryonic DNA using DNA extraction lysis buffer. Add 10 μL of Lysis Buffer for PCR and 0.1 μL of Proteinase K to each tube according to the instructions, mix well, place in an eight-strip tube, use a pipette to aspirate a single blastocyst and blow it into the liquid, centrifuge slightly, and heat in a PCR instrument at 60 °C for 5 minutes, then at 98 °C for 2 minutes. After the reaction is completed, it serves as the template for the first-round PCR;

[0093] Use F3R6 as the primer for the first-round PCR. The reaction conditions are the same as those for conventional PCR. The reaction system is as follows;

[0094] Table 5 Reaction System

[0095]

[0096] After the first-round PCR is completed, aspirate 5 μL of the PCR product as the template for the second-round PCR. Use F3R5 as the primer for the second-round PCR. The reaction conditions are the same as those for conventional PCR. The reaction system is as follows, and add the tail DNA of BRCA1 heterozygous mice as a positive control:

[0097] Table 6 Reaction System

[0098]

[0099] Agarose Gel Electrophoresis: After the reaction is completed, load the second-round PCR product onto an agarose gel for electrophoresis. The experimental operation and conditions are the same as those for conventional PCR. After electrophoresis, place the gel in a gel imaging system to observe and record the results.

[0100] 2.5.4 Safety Detection of Offspring Mice

[0101] (1) Detection of Female Mouse Fertility

[0102] Cage the female mice in the control group and the Veliparib treatment group with male mice of normal fertility at 10 weeks old in a ratio of 2:1. After co-housing and mating for 1 week, separate and raise them individually. Start checking the pregnancy status of female mice by visual inspection and palpation on the 14th day after co-housing, and continuously observe daily for whether they give birth. Record the number of offspring, stillbirths, and live births of each female mouse on the day of parturition.

[0103] (2) Cliff Avoidance Test

[0104] The cliff avoidance test is a classic method for evaluating the stereoscopic vision and perceptual abilities of rodents. The specific operation is as follows: The experimenter places a mouse on the 8th day after birth on an acrylic board about 30 cm above the ground, with the mouse's head and forelimbs exposed at the edge of the board. The experimenter releases the mouse while starting the timer. If the mouse turns its head by more than 180° on its own within 30 seconds, it is considered positive for the cliff avoidance experiment. If the mouse falls from the platform or does not turn its head, it is considered negative.

[0105] (3) Negative geotaxis experiment

[0106] Rodents (such as rats and mice) are born with the ability to rotate from a head-down position to a head-up position on an inclined plane. This reaction is called negative geotaxis. This natural reflex ability can be developed by normal pups in the second week after birth. The negative geotaxis experiment is a key test for evaluating the reflex ability, motor coordination, vestibular system, and cerebellar functional integrity of rodent pups. Through this experiment, researchers can gain a deeper understanding of the characteristics of rodents in terms of neural development and behavioral performance. The specific operation method of the negative geotaxis experiment is as follows: On the 9th day after the mouse is born, the experimenter uses an acrylic board to build an inclined plane at an angle of 45°. The young mouse is placed head-down on the board. The experimenter releases the mouse while starting the timer. If the mouse turns its head by more than 180° on its own within 30 seconds, it is considered positive for the negative geotaxis experiment. If the mouse slips off the platform or does not turn its head, it is considered negative.

[0107] (4) Righting reflex

[0108] The righting reflex is one of the classic experiments used to check the normal functions of the visual, vestibular systems, pressure receptors or tactile receptors of the limbs, and position sense of experimental animals. The operation method is as follows: On the 10th day after the mouse is born, the experimenter first gently fixes the mouse on its back with its four limbs facing up on a smooth and stable plane, ensuring that the mouse's body does not slide or move. Then, the experimenter releases both hands while starting the timer. The experimenter fixes the mouse on its back with its four limbs facing up on the plane and releases the hands while starting the timer. If the mouse can quickly adjust its body position and turn from the supine position to the normal crawling position within 2 seconds, it is considered positive for the righting experiment. Otherwise, it is considered negative.

[0109] (5) Mouse ear opening

[0110] Observe the mouse's ear opening from the 4th day to the 7th day after the mouse is born. When it is observed that the bilateral auricles of the mouse are clearly separated from the scalp, it is considered positive for ear opening. A magnifying glass can be used for detailed observation, and the proportion of positive mice with ear opening in each litter is recorded every day. During the observation process, be patient and gentle in your actions to avoid over-stimulating or disturbing the mouse.

[0111] (6) Mouse mandibular tooth eruption

[0112] The proportion of mice with positive mandibular tooth eruption in the offspring mice was observed and recorded daily from the 11th day to the 14th day after birth. The operation method is as follows: the experimenter gently fixes the mouse with one hand so that its head is facing up, and gently moves the lower jaw of the young mouse with the other hand. If the mandibular incisor of the mouse is carefully observed to be completely erupted from the gums, it is considered to be positive for mandibular tooth eruption.

[0113] (7) The mouse opened both eyes

[0114] The opening of both eyes of the mice was observed from the 16th day after birth until the 20th day. The observation criteria were as follows: in a quiet, bright environment without direct strong light sources, the bilateral eyelids of the mice were completely separated in their natural state, the eyeballs were clearly visible, and there was no secretion or adhesion. This was considered a positive test for both eyes to be open. The proportion of mice with positive results for both eyes to be open was recorded every day.

[0115] (8) Female rat vagina opens

[0116] Vaginal opening is a sign of the onset of puberty in female mice. The opening of the vagina of female mice was observed on the 28th day after birth. The specific operation method is as follows: the experimenter gently lifts the mouse tail with one hand and gently flicks the vaginal opening with a cotton swab with the other hand to observe whether the vaginal opening is completely separated from the surrounding skin without adhesion, and the proportion of mice with positive vaginal opening is recorded every day.

[0117] (9) Testicular descent in male mice

[0118] The testicular descent of male mice was observed and recorded starting 22 days after birth. The specific operation method was as follows: the experimenter held the mouse with one hand and gently pressed and touched the scrotum of the male mouse with the other hand to feel whether the male mouse testicles had completely fallen from the abdominal cavity into the scrotum. Be careful not to squeeze the male mouse testicles downward, and record the proportion of mice with positive testicular descent every day.

[0119] (10) Morris water maze

[0120] Build the experimental facilities: put water in a circular bathtub, add skim milk powder to the water to make the platform invisible, lower the water level so that the platform is about 0.5cm-1cm below the water surface, and paste direction reminders inside the four quadrants of the pool. Ensure that all equipment (such as the pool, platform, camera, computer, etc.) are working properly, and adjust the water temperature to 22-25 degrees Celsius;

[0121] Acquired training phase: The first five days are the training period. The mice are gently placed into the water facing the pool wall. Each day, each mouse is placed in each of the 4 quadrants separately and the experiment is repeated 4 times. The mice are allowed to freely explore in the water for 1 minute. If a mouse finds the platform within 1 minute, it is allowed to stay on the platform for 15 seconds and then fished out. If the mouse does not find the platform within 1 minute, it is manually guided to the platform and allowed to stay on the platform for 15 seconds before being fished out;

[0122] Formal testing phase: The sixth day is the formal test. The platform is removed and the mice are placed into the water from the quadrant opposite the platform, allowing them to freely swim in the water maze for 1 minute. The ANY-maze system and a camera are used to monitor the swimming trajectories of the mice, and the performance of the mice during the test phase is recorded, including parameters such as the number of passes through the location of the original platform and the swimming time staying in the quadrant area where the original platform was located.

[0123] (11) Monitoring of mouse body weight curves

[0124] The body weights of the mice are weighed on the 1st, 4th, 7th, and 14th days after birth respectively. The operation steps are as follows: Plug in the power of the electronic balance and turn it on. After the reading is stable, place the weighing box and zero it. Gently grab the offspring mice of each group and put them into the weighing box. After the value is stable, read and record the value.

[0125] (12) Sperm detection in male mice

[0126] Prepare a 37°C water bath, prepare 1.5 mL EP tubes. After making marks, add 1000 μL of PBS to each tube and place them in the water bath to preheat for 30 minutes. Take male mice around 8 weeks old. After decapitating and sacrificing them, cut open the abdominal cavity, take the bilateral cauda epididymis, and place it in the preheated PBS at 37°C. Use a clean ophthalmic scissors to reach into the EP tube and fully cut the tissue into pieces. Place the EP tube in the water bath and incubate at 37°C for 30 min. Take 100 μL of the supernatant and add it to a new EP tube containing 100 μL of paraformaldehyde in a 1:1 ratio, and fix it at room temperature for 30 min. Use an automatic cell counter to record the sperm concentration. Take 10 μl of the supernatant and smear it on a glass slide, drop it in the center of the slide, gently cover it with a coverslip and observe it under a microscope. Select multiple fields of view to count the number of progressively motile sperm, non-progressively motile sperm, and immotile sperm respectively. Count 200 sperm for each mouse, and take the average value after two counts to calculate the proportion of each type of sperm.

[0127] 2.6 Experimental data analysis

[0128] All measurements were performed in at least three independent replicates, and the results were expressed as the mean ± SD (standard deviation). Statistical analysis was carried out using GraphPad Prism 9.0 software (San Diego, CA, USA). The mean comparison between the Veliparib treatment group and the control group was performed using an independent-sample Student's t-test. The significance of the difference in rates between the two groups was determined using a chi-square test, and P < 0.05 was considered statistically significant.

[0129] 3. Experimental Results

[0130] 3.1 Effects of Veliparib on in vitro embryo development in each group

[0131] To verify whether Veliparib has the ability to screen for embryos carrying BRCA1 heterozygous mutations, the present invention used in vitro fertilization (IVF) technology to collect wild-type (WT) and BRCA1-mutated mouse embryos. These embryos were then cultured in KSOM medium containing different concentration gradients of Veliparib (0 μM, 2.5 μM, 5 μM, 7.5 μM, 10 μM). During the experiment, multiple time points were set to observe and record the development of embryos in the WT and BRCA1 groups. The present invention closely monitored the development process of each embryo to discover the different effects of Veliparib on these two groups of embryos.

[0132] As Figure 3 (A and B) show, the experimental results indicate that Veliparib had certain adverse effects on the early development of embryos in both the wild-type and BRCA1 groups. And Veliparib had a concentration-dependent inhibitory effect on embryo development. However, it is worth noting that compared with the WT group, embryos in the BRCA1 group showed higher sensitivity under the action of the same concentration of Veliparib. Specifically, at the same Veliparib concentration, more embryos in the BRCA1 group were blocked in development and could not continue to develop normally.

[0133] To find a suitable screening concentration to distinguish BRCA1 heterozygous embryos from wild-type embryos, the present invention further performed statistical analysis to plot the survival curve of embryo development ( Figure 3 as shown in B). Without the use of Veliparib, there was no significant difference in the survival curves of BRCA1 group embryos and wild-type embryos ( Figure 3For A and B, P = 0.0702). However, when treated with the same concentration of Veliparib, more embryos in the BRCA1 group were delayed or stopped developing. As the concentration of Veliparib increased, the difference in the survival curves between the two groups became more obvious. When the concentration of Veliparib reached 7.5 μM, there was a significant difference in the survival curves between the two groups (P < 0.001).

[0134] 3.2 Genotype of embryos before and after in vitro screening with Veliparib

[0135] First, oocytes from BRCA1 heterozygous female mice were collected and in vitro fertilized with sperm from wild-type male mice. All two-cell embryos were randomly divided into a control group and a Veliparib treatment group (7.5 μM). Embryos that reached the blastocyst stage were collected 96 h after fertilization and their genotypes were identified by semi-nested PCR. The results are shown in Figure 4 A and B. The present invention found that 45.2% (14 / 31) of the blastocysts in the control group without Veliparib treatment were BRCA1 heterozygous embryos. This distribution was expected and confirmed that the oocytes from heterozygous female mice contained the same number of wild-type and mutant oocytes, and had similar oocyte quality and developmental ability. Among the blastocysts in the Veliparib treatment group, only 3.6% (1 / 28) of the blastocysts were BRCA1 heterozygous embryos, and the remaining blastocysts were all wild-type. These results indicate that treatment with 7.5 μM Veliparib can effectively prevent the formation of BRCA1 heterozygous embryos into blastocysts.

[0136] 3.3 Proportion of genotypes of offspring after embryo transfer before and after in vitro screening with Veliparib

[0137] After verifying that Veliparib can effectively block the development of BRCA1 heterozygous embryos in vitro, the present invention further explored at the individual level whether this screening protocol can effectively avoid the birth of BRCA1 heterozygous mice through blastocyst-uterus transplantation. The present invention used ICR mice as surrogate mice to conduct blastocyst-uterus transplantation experiments to explore the screening efficiency of the Veliparib protocol. A total of 32 surrogate ICR mice in the Control group underwent embryo transfer surgery, and 8 of them gave birth to offspring smoothly. A total of 35 surrogate ICR mice in the Veliparib treatment group underwent embryo transfer surgery, and 8 of them also became pregnant and gave birth to offspring smoothly.

[0138] The identification results of the genotypes of the offspring mice are shown in Table 7 and Figure 5As shown below. The present invention first explored the genotypes of the offspring produced under natural mating conditions. Among the offspring produced by natural mating of 4 pairs of BRCA1 heterozygous female mice and WT male mice, 18 (47.4%) were BRCA1 heterozygotes (including 1 stillborn), and 20 (52.6%) were wild-type. This result is consistent with the dominant inheritance characteristics of the BRCA1 gene, and approximately 50% of the offspring carry the BRCA1 heterozygous mutation. A total of 33 offspring mice were born in the control group, among which 18 (54.5%) were wild-type (including 1 stillborn), and 15 (45.5%) were BRCA1 heterozygotes (including 1 stillborn). A total of 31 offspring were born in the 7.5 μM Veliparib treatment group, and all offspring were wild-type (including 2 stillborn), and no BRCA1 heterozygous mice were born, whether alive or stillborn. These results strongly prove the effectiveness of the screening scheme of the present invention.

[0139] Table 7 Genotype identification results of F1 generation mice produced by pregnant mice transplanted with offspring

[0140]

[0141] 3.4 Embryo transfer-related parameters

[0142] To preliminarily explore whether Veliparib treatment affects embryo implantation and pregnancy ability, the present invention further counted the pregnancy-related parameters after transplantation in the Veliparib treatment group and the Control group, as shown in Table 8. The present invention found that there were no significant differences in the average litter size (4.13 vs 3.88, P = 0.23) and the average pregnancy time (18.00 vs 18.38, P = 0.42) between the two groups. However, on the premise that the number of transplanted embryos in the two groups was similar (9.63 vs 10.13, P = 0.13), the litter rate in the Control group was higher than that in the Veliparib treatment group (41.91% vs 34.91%, P < 0.05). Combining the in vitro genotyping results, a reasonable explanation is that when transplanting embryos treated with Veliparib, although most of the transplanted blastocysts are wild-type, there are still some blastocysts carrying the BRCA1 heterozygous mutation that are transferred into the uterus. Due to the defect in their DNA damage repair function, they cannot complete subsequent implantation and embryonic growth and development normally, so the number of offspring formed is reduced accordingly. In terms of the live birth rate, no significant difference was found between the two groups (94.38% vs 92.71%, P = 0.79). These results preliminarily confirm that Veliparib treatment does not affect the implantation of wild-type embryos after screening and the normal pregnancy process.

[0143] Table 8 Comparison of parameters related to embryo transfer and pregnancy results

[0144]

[0145] Note: All data in each group are expressed as mean ± standard deviation, * compared with the Control group, the difference was statistically significant, * P < 0.05.

[0146] 3.5 Safety detection of the F1 offspring after Veliparib treatment

[0147] Regarding the safety of the offspring, further safety assessments were performed on the offspring mice produced after transplantation in the Veliparib treatment group and the Control group, and their physical development (weight change, auricle opening, eye opening, lower incisor eruption), pubertal sexual maturity (vaginal opening in female mice, testicular descent in male mice), reproductive function (natural mating in female mice, sperm detection in male mice), neural development (cliff avoidance, negative geotaxis, righting reflex), learning and memory (Morris water maze), etc. were detected to see if they were normal. The results are as Figure 6 shown in A - D in Figure 7 A and B in Figure 8 A - B in Figure 9 A - F in Figure 10 shown in A - C in. Except that the lower incisor eruption rate in the Veliparib treatment group was slightly lower than that in the Control group on the 13th day after birth (P = 0.0244), there were no significant differences in various offspring safety indexes such as physical development, pubertal sexual maturity, reproductive function, neural development, and learning and memory between the two groups of mice (P > 0.05). Generally speaking, Veliparib treatment did not significantly affect the physiological functions of wild - type blastocysts and the behavioral performances of offspring mice, which provided strong support for the safety of this protocol in clinical applications.

[0148] In summary, the present invention constructs a C57BL / 6 mouse model with heterozygous deletion of BRCA1, obtains mouse embryos through in vitro fertilization (IVF), and performs screening treatment in embryo culture medium containing Veliparib; Veliparib, with its unique chemical structure and mechanism of action, can effectively inhibit the development of BRCA1 heterozygous mutant embryos without affecting wild - type embryos; the present invention can screen and block BRCA1 heterozygous mutant embryos in vitro, avoid passing on pathogenic genes to offspring, and provide a new possibility for women carrying BRCA1 mutations to avoid passing on genetic pathogenic genes to offspring, which has important clinical application value.

[0149] Although the embodiments of the present invention have been shown and described above, it can be understood that the above - mentioned embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above - mentioned embodiments within the scope of the present invention.

Claims

1. The use of the PARP inhibitor Veliparib in the preparation of a drug for screening out BRCA1 heterozygous mutation embryos, characterized in that: The PARP inhibitor Veliparib, at a specific dose and during a specific embryonic development period, uses a synergistic lethal effect to utilize the insufficient homologous recombination repair function of BRCA1 heterozygous mutant embryos, causing the BRCA1 heterozygous mutant embryos to accumulate more DNA damage, thereby achieving the result of blocking the development of the BRCA1 heterozygous mutant embryos; The specific dose of the PARP inhibitor Veliparib is 7.5 μM; The initial drug action time for a specific embryonic development period is the two-cell stage of the in vitro fertilized embryo.

2. The use according to claim 1, characterized in that: The direct effect of the PARP inhibitor Veliparib at a specific dose on in vitro culture of embryos at a specific developmental period does not affect the development and implantation of normal embryos, as well as the growth and development of offspring of normal embryonic development.

Images