CrRNA for visual detection of dnmt3a gene r882c mutation and application thereof

By employing a visualization detection method based on the CRISPR/Cas12a system and utilizing specific crRNA and amplification primers, the complexity and cost issues of detecting the R882C mutation in the DNMT3A gene in existing technologies have been resolved, achieving rapid detection with high sensitivity and high specificity.

CN118995932BActive Publication Date: 2025-12-26GUANGZHOU KINGMED TRANSFORMATIVE MEDICINE INST CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411272066.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-11
Publication Date
2025-12-26
Estimated Expiration
2044-09-11

AI Technical Summary

Technical Problem

Existing methods for detecting the R882C mutation in the DNMT3A gene are cumbersome, time-consuming, have low sensitivity, require expensive equipment, and involve complex operations, making it difficult to achieve high specificity, high sensitivity, low cost, and rapid detection.

Method used

A visual detection method based on the CRISPR/Cas12a system was designed. Using specially designed crRNA and amplification primers, the fluorescence results are read with the naked eye through PCR amplification and CRISPR/Cas12 enzyme digestion reaction, achieving high sensitivity and high specificity for the detection of the R882C mutation in the DNMT3A gene.

Benefits of technology

It achieves high sensitivity to detect 1% of low-abundance mutant samples, is low-cost and simple to operate, and does not rely on expensive instruments. It can quickly and visually distinguish between wild-type and R882C mutant DNMT3A gene.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995932B_ABST
    Figure CN118995932B_ABST
Patent Text Reader

Abstract

The application discloses a kind of crRNA for visual detection DNMT3A gene R882C mutation and its application, the nucleotide sequence of the crRNA is as shown in SEQ ID NO:3, the kit includes above-mentioned crRNA, and the sequence as shown in SEQ ID NO:4 forward primer and the sequence as shown in SEQ ID NO:5 reverse primer.Utilize the crRNA and PCR amplification primer designed in the application, the detection of the sample marrow puncture of to be measured can be carried out with high sensitivity, high specificity distinguishes DNMT3A gene wild type and R882C mutant, can be visualized detection reaches 1% DNMT3A R882C mutation, the detection method of the application can visual interpretation result, low in cost, simple operation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and more particularly, the present application relates to a crRNA, a kit and a method for visual detection of DNMT3A gene R882C mutation. BACKGROUND

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous hematological malignancy that poses a serious threat to human health and is the most common type of leukemia in adults in China. DNA methyltransferase 3A (DNMT3A) is located on the short arm of human chromosome 2 at 2q23, an important gene closely related to epigenetic modification, responsible for de novo methylation modification of DNA. DNMT3A gene mutation has been found in various hematological tumors, especially in acute myeloid leukemia (AML), which has a high frequency of occurrence and is associated with poor prognosis. Studies have shown that about 20% of adult AML patients carry DNMT3A mutations, of which 60% of mutations occur at the R882 site, and R882C mutation is one of the most common mutations. DNMT3A R882C mutation is an important molecular marker for patient stratification and poor prognosis, helping to identify high-risk patients, thus contributing to the development of individualized treatment plans.

[0003] In the current detection of DNMT3A R882C gene mutation, commonly used techniques include Sanger sequencing (FGS), high-throughput sequencing (NGS) and real-time fluorescent quantitative PCR (qPCR). Although Sanger sequencing is the most classic method, it has the disadvantages of complicated operation, long detection time and low sensitivity. High-throughput sequencing technology (NGS) has the advantages of high throughput and high precision, but requires expensive equipment and complex operation, and for the detection of low-frequency mutations, the data volume requirement is high. Although the real-time fluorescent quantitative PCR detection method is widely used, its sensitivity is generally low, and the quantitative accuracy is highly dependent on the standard curve.

[0004] CRISPR / Cas technology is an adaptive immune system derived from bacteria and archaea that can cut foreign genes to protect bacteria or archaea from external interference, and has been widely used in gene editing and nucleic acid detection fields. Cas12a (formerly known as Cpf1) is a kind of endonuclease in the CRISPR system, which can specifically recognize and cut target DNA sequences under the guidance of CRISPR RNA (crRNA). At the same time, Cas12a has non-specific single-stranded DNA transcleavage activity. When Cas12a recognizes the target DNA, this enzyme activity is activated, thereby cutting the surrounding non-target single-stranded DNA. This property can be used for signal amplification, which has significant application value in nucleic acid detection. Based on its signal amplification and single-base resolution capability, it has been used for rapid, specific and sensitive nucleic acid detection methods.

[0005] Therefore, it is urgent to develop a visual detection method with high specificity, high sensitivity, low cost, simple operation and short detection time to effectively detect DNMT3A R882C gene mutation. SUMMARY

[0006] Based on this, the purpose of the present application is to provide a crRNA, a kit and a method for visual detection of DNMT3A gene R882C mutation. The kit including the crRNA is used to detect the sample to be tested, which can visually distinguish the wild type of DNMT3A gene and the R882C mutant type of DNMT3A gene with high sensitivity and high specificity.

[0007] The technical solutions for achieving the above-mentioned purposes include the following.

[0008] In a first aspect of the present application, a crRNA for visual detection of DNMT3A gene R882C mutation is provided, and the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3.

[0009] In a second aspect of the present application, a kit for visual detection of DNMT3A gene R882C mutation is provided, and the kit comprises the above-mentioned crRNA and amplification primers, wherein the amplification primers comprise a forward primer with a sequence shown in SEQ ID NO: 4 and a reverse primer with a sequence shown in SEQ ID NO: 5.

[0010] In a third aspect of the present application, a method for visual detection of DNMT3A gene R882C mutation is provided, and the method uses the above-mentioned kit for detection, comprising the following steps: using the amplification primers to perform PCR amplification on the genomic DNA of the sample to be tested, performing CRISPR / Cas12 enzyme cutting reaction on the PCR amplification product, and naked eye reading the fluorescence results.

[0011] In the present application, based on the PCR-CRISPR / Cas12a system, a crRNA for detecting the R882C mutation of the DNMT3A gene is designed, and a mismatch base is introduced at a specific position on the crRNA, and at the same time, the PAM site of TTTV is introduced by introducing a mismatch base in the forward primer of the PCR amplification primer, solving the problem of no PAM region at the target mutation site; under this concept, using the crRNA and PCR amplification primer designed by the present application, the bone marrow puncture of the sample to be detected is detected, which can distinguish the wild type and R882C mutant of the DNMT3A gene with high sensitivity (can detect 1% low abundance mutant samples) and high specificity.

[0012] The detection method of the present application can be naked eye judged by means of ultraviolet lamp, without relying on expensive instruments, low cost and simple operation. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 The results of 7 crRNAs in Example 2 of the present application for detecting DNMT3A gene wild type fragments (WT), DNMT3A gene R882C mutant fragments (MT) and nuclease-free water (NTC) respectively, wherein A is the fluorescence visualization result; B is the scatter plot quantified according to the fluorescence result data.

[0014] Figure 2 The amplification results of different primer pairs in Example 3 of the present application.

[0015] Figure 3 The sensitivity results of the detection method in Example 4 of the present application.

[0016] Figure 4 The detection results of clinical samples in Example 5 of the present application. DETAILED DESCRIPTION

[0017] In order to facilitate the understanding of the present application, the present application will be described more fully below. The present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0018] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the specific embodiments and are not used to limit the present application. The term "and / or" used in the present application includes any and all combinations of one or more related listed items.

[0019] The experimental methods in the following examples, unless otherwise specified, are generally performed according to routine conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual (2013), or as suggested by the manufacturer. The various common chemical reagents used in the examples are commercially available.

[0020] CRISPR (clustered regularly interspaced short palindromic repeats, CRISPR) / Cas (CRISPR-associated proteins, Cas) is a bacterial adaptive immune system, which has been widely used in gene editing and nucleic acid detection. CRISPR / Cas12 directs double-stranded DNA cleavage by a single RuvC catalytic domain guided by RNA, where Cas12 has a target DNA-primed non-specific transcleavage activity against single-stranded DNA, which has been used to develop a rapid, accurate and sensitive nucleic acid detection method based on its continuous signal amplification and single-base resolution capability. The present application is based on the detection method of PCR-CRISPR / Cas12a system, which detects DNMT3A gene R882C mutation by designing crRNA and amplification primers for DNMT3A gene R882C mutation, and has the characteristics of visualization, low cost, simple operation, high sensitivity (can detect 1% low frequency mutation), strong specificity.

[0021] In some embodiments of the present application, a crRNA for visual detection of DNMT3A gene R882C mutation is disclosed, and the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3.

[0022] In some other embodiments of the present application, a kit for visual detection of DNMT3A gene R882C mutation is disclosed, and the kit comprises the above-mentioned crRNA, and amplification primers, wherein the amplification primers comprise a forward primer with a sequence shown in SEQ ID NO: 4 and a reverse primer with a sequence shown in SEQ ID NO: 5.

[0023] In some embodiments, the kit further comprises a fluorescent probe, wherein the nucleotide sequence of the fluorescent probe is 5 to 15 random bases, the 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end of the fluorescent probe is labeled with a quenching group.

[0024] In some embodiments, the fluorescent group is FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE or Texas Red, and the quenching group is TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 or BHQ-3.

[0025] In some embodiments of the present application, a method for visualizing detection of the R882C mutation of the DNMT3A gene is disclosed, using the kit described above, comprising the following steps: after PCR amplification of the genomic DNA of the sample to be tested using the amplification primer pair, performing a CRISPR / Cas12 enzyme cutting reaction on the PCR amplification product, and naked eye reading the fluorescence results.

[0026] In some embodiments, the reaction system of the PCR amplification comprises: MasterMix 25 μL, forward primer and reverse primer at a final concentration of 20 pmol-30 pmol, 5 μL-20 μL template, and nuclease-free water added to 50 μL.

[0027] In some embodiments, the reaction procedure of the PCR amplification is: denaturation at 98℃ for 30 s; denaturation at 98℃ for 10 s, annealing at 60℃ for 10 s, extension at 72℃ for 10 s, 35 cycles; extension at 72℃ for 2 min.

[0028] In some embodiments, the reaction system of the CRISPR / Cas12 enzyme cutting reaction comprises: NEBuffer 2 μL, Cas12a at a final concentration of 0.05 μM-0.2 μM, crRNA at a final concentration of 0.05 μM-0.2 μM, 15 U-25 U Recombination RNase inhibitor, fluorescent probe 0.25 μM-1 μM, 2 μL-10 μL PCR amplification product, and nuclease-free water added to 20 μL.

[0029] In some embodiments, the reaction temperature of the CRISPR / Cas12 enzyme cutting reaction is 37℃±2℃, and the reaction time is 25 min-35 min.

[0030] In some embodiments, the naked eye reading of the fluorescence results comprises the following steps: when the sample to be tested has a significant fluorescence signal, the sample to be tested has the R882C mutation of the DNMT3A gene.

[0031] In the following embodiments, the probes and primers are synthesized by Shanghai Jeery Bioengineering Co., Ltd.

[0032] The present application is described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0033] Example 1 Visual detection method of DNMT3A gene R882C mutation

[0034] 1. Design crRNA, PCR amplification primer, and single-stranded DNA fluorescent probe FQ-ssDNA reporter

[0035] According to the design of the DNMT3A gene R882C mutation site, the length of the complementary sequence to the mutant is 18 nt, and the crRNA is constructed, and the sequence is shown as SEQ ID NO: 3 Synthesize plasmid (pUC57 T7 crRNA) containing crRNA transcription fragment, and obtain target crRNA through in vitro transcription and purification steps.

[0036] Since Cas12 recognizes the target sequence with a specific PAM region (i.e. Protospacer Adjacent Motif, usually TTTV, V is A, G, C), PCR amplification primers are designed by introducing T through primers, and the sequence is shown in Table 1.

[0037] Table 1 Primer sequence

[0038] Forward primer F CCACTATACTGACGTTTCCAACATGAGC (SEQ ID NO: 4) Reverse primer R ATGTCCCTTACACACACGCAA (SEQ ID NO: 5)

[0039] The nucleotide sequence of the fluorescent probe is 12 random bases, i.e. NNNNNNNNNNNN, and the 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ-1.

[0040] 2. PCR amplification

[0041] The genomic DNA of the sample bone marrow puncture is used as the template for PCR amplification.

[0042] The 50 μL PCR amplification system includes: Q5 High-Fidelity 2X MasterMix 25 μL, 25 pmol of forward primer and reverse primer, 20 μL template, and nuclease-free water. PCR amplification procedure: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 10s, cycle 35 times; 72℃ extension for 2min.

[0043] 3. CRISPR fluorescent detection reaction

[0044] PCR amplification product was subjected to CRISPR / Cas12 enzyme digestion, the CRISPR / Cas12 enzyme digestion system was mixed, and after short centrifugation, it was immediately incubated at 37°C, after 30 min, the signal was recorded using a nucleic acid gel imager. The fluorescence signal of the test sample was observed by naked eye, if there was obvious fluorescence signal, the test sample existed DNMT3A gene R882C mutation.

[0045] Wherein, 20 μL of the CRISPR / Cas12 enzyme digestion system comprises: NEBuffer 2.1 (10X) 2 μL, 2 pmol of Lba Cas12a (Cpf1), 4 pmol of crRNA, 20 U Recombination RNase inhibitor (RRI), FQ-ssDNA reporter 10 pmol, 5 μL PCR amplification product and nuclease-free water.

[0046] Example 2 Screening of high-specificity crRNA

[0047] In order to improve the specificity of crRNA, 1 mismatch base was artificially introduced at different positions of crRNA, and 7 crRNAs were designed, wherein crRNA1 was the original crRNA, and crRNA2-7 were crRNAs with 1 mismatch base introduced, and the specific sequences are shown in Table 2.

[0048] Table 2 crRNA sequence

[0049]

[0050] Note: Bold base U represents mutation site, italic bold base represents introduced mismatch base.

[0051] 1. Synthesis of plasmid containing DNMT3A gene wild type fragment and plasmid containing DNMT3A gene R882C mutant fragment

[0052] According to the NCBI search for DNMT3A gene sequence, the mutation site was determined, and the plasmid containing DNMT3A gene wild type (WT) fragment (SEQ ID NO: 1) (pUC57-WT) and the plasmid containing DNMT3A gene R882C mutant (MT) fragment (SEQ ID NO: 2) (pUC57-MT) were synthesized by Shengong Bioengineering Co., Ltd. The WT and MT gene fragment sequences are as follows:

[0053] SEQ ID NO: 1

[0054] GCTGTGTGGTTAGACGGCTTCCGGGCAGCCTGGTCTGGCCAGCACTCACC

[0055] CTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTAT

[0056] ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCTGGGCCG

[0057] GTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAGTA

[0058] TTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAA

[0059] GTTAAACAAACAAACAAAAAACACAAAACATAATAAAACACCAAGAACA

[0060] TGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATTTAAA

[0061] ACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAGSEQ ID NO:2(c.2644C>T)

[0062] GCTGTGTGGTTAGACGGCTTCCGGGCAGCCTGGTCTGGCCAGCACTCACC

[0063] CTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTAT

[0064] ACTGACGTCTCCAACATGAGCTGCTTGGCGAGGCAGAGACTGCTGGGCCG

[0065] GTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAGTA

[0066] TTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAA

[0067] GTTAAACAAACAAACAAAAAACACAAACATAATAAAACACCAGAACA

[0068] TGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATTTAAA

[0069] ACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAG

[0070] 2. Using plasmids containing the wild-type (WT) fragment of the DNMT3A gene (14 ng (10 ng) respectively) 11 (copies / μL)), plasmid containing the R882C mutant (MT) fragment of the DNMT3A gene (14 ng (10 copies / μL)) 11 Using copies / μL) and nuclease-free water (NTC) as test samples (templates), the method of Example 1 was used to test each crRNA and compare the sensitivity and specificity of different crRNAs.

[0071] The naked-eye visualization results of different crRNA reactions at a reaction time of 30 min are as follows: Figure 1 As shown in Figure A, it can be seen that only when crRNA2 is used is the MT signal strong (dark color) and the WT signal weak (light color), clearly distinguishing MT and WT. The fluorescence results were quantified using ImageJ software and plotted as a scatter plot, as shown below. Figure 1 As shown in Figure B, the WT signal is lower when using crRNA2 compared to when using crRNA4, crRNA1, crRNA3, and crRNA7, while the MT signal is significantly higher than that of crRNA5 and crRNA6. In summary... Figure 1 As a result, the best performing crRNA was crRNA2 (SEQ ID NO:3).

[0072] Example 3: Screening of amplification primers

[0073] In this embodiment, two forward primers F1 and F2 and four reverse primers R1, R2, R3, and R4 were designed. The two forward primers and four reverse primers were combined to form F1R1, F1R2, F1R3, F1R4, F2R1, F2R2, F2R3, and F2R4, respectively. The primer sequences are shown in Table 3.

[0074] Table 3 Primer sequences

[0075] Primer number Sequence Forward primer Fl CCACTATACTGACGTTTCCAACATGAGC (SEQ ID NO: 4) Forward primer F2 GTCCACTATACTGACGTTTCCAACAT (SEQ ID NO: 12) Reverse primer Rl ATGTCCCTTACACACACGCAA (SEQ ID NO: 5) Reverse primer R2 CGCAAAATACTCCTTCAGCGG (SEQ ID NO: 13) Reverse primer R3 TTGCCCCCATGTCCCTTACA (SEQ ID NO: 14) Reverse primer R4 TCGCTACCTCAGTTTGCCCC (SEQ ID NO: 15)

[0076] Then, using 8 pairs of primers, PCR amplification (using human genomic DNA as a template) was performed according to the reaction system and procedure of Example 1. The agarose gel electrophoresis was used for detection, and the size and color intensity of the target band and whether the amplified band was specific were observed to screen primers.

[0077] The results are as follows Figure 2 As shown, from Figure 2 It can be seen that all 8 primer pairs amplify specific bands. The F1R1 primer pair with the darkest amplified band color (largest product amount) and shortest amplified fragment was selected as the amplification primer pair.

[0078] Example 4: Sensitivity of the visual detection method for the R882C mutation in the DNMT3A gene of the present invention.

[0079] Linearized plasmid samples containing the R882C mutant fragment of the DNMT3A gene were serially diluted to 10. 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 Samples were prepared at copies / μL, 10 copies / μL, and 1 copy / μL. Separately, linearized plasmids containing the DNMT3A gene R882C mutant fragment were mixed with wild-type human genomic DNA (30 ng / μL, DNMT3AR882C-free, used to simulate clinical samples) to prepare samples with mutation frequencies of 100%, 50%, 10%, 1%, 0.1%, and 0% (i.e., entirely wild-type human genome).

[0080] Take 20 μL of the above sample as a template and amplify it according to the PCR reaction system and procedure in Example 1. After amplification, take 5 μL of the amplification product and add it to the CRISPR / Cas12 restriction enzyme digestion system (same as in Example 1) for CRISPR / Cas12 restriction enzyme digestion reaction. Read the fluorescence using a gel imaging system and observe the results with the naked eye. Figure 3 As shown, the results indicate that using the method of this invention to detect the DNMT3AR882C mutation, with a reaction time of 30 min, 100 copies / μL of sample can be detected. Figure 3 (A) and can detect low-abundance mutant samples with a mutation frequency of 1% ( Figure 3 (B in the middle).

[0081] Example 5: Clinical samples were tested using the detection method of the present invention.

[0082] The bone marrow puncture materials of 6 AML patients (the DNMT3A gene R882C mutation in the bone marrow puncture materials of the patients is detected to be positive) and 4 people without DNMT3A R882C (the DNMT3A gene R882C mutation in the bone marrow puncture materials of the people is detected to be negative) from Yantai Yuhuangding Hospital are selected in the embodiment, genomic DNA is extracted from the bone marrow puncture materials of the 6 AML patients and the 4 people without DNMT3A R882C (all samples are verified by second-generation sequencing, and the second-generation sequencing results are shown in Table 4), the concentration is detected, and then 300 ng of genomic DNA is used as a template to perform detection according to the method in Embodiment 1, the detection results are read by using a gel imaging instrument, and the results are shown in Table 5. Figure 4

[0083] Table 4 Second-generation sequencing results of clinical samples

[0084] Number Mutation rate (next generation sequencing) Number Mutation rate (next generation sequencing) C1 2.40% C6 31.00% C2 14.40% C7 0 C3 16.50% C8 0 C4 26.60% C9 0 C5 28.00% C10 0

[0085] Figure 4 The results show that when the reaction time is 30 min, the 6 positive samples (C1-C6) produce obvious fluorescence signals after being cut by the CRISPR / Cas12 enzyme, the 4 negative samples (C6-C10) do not produce obvious fluorescence signals after being cut by the CRISPR / Cas12 enzyme, the visual detection results are consistent with the second-generation sequencing results (Table 3), and the clinical sample verification for the DNMT3A R882C target point shows that the specificity and the sensitivity of the detection method of the embodiment are both 100%.

[0086] The technical features of the above-described embodiments can be combined in any manner. To make the description brief, all possible combinations of the technical features in the above-described embodiments are not described, but as long as the combinations of the technical features do not exist, they should be considered as the scope of the description.

[0087] The above-described embodiments only express several implementation manners of the embodiment, the description is relatively specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be pointed out that, for ordinary skilled persons in the art, without departing from the concept of the embodiment, several modifications and improvements can be made, which are all within the protection scope of the embodiment. Therefore, the protection scope of the patent of the embodiment should be subject to the appended claims.​

Claims

1. A kit for visualizing detection of a DNMT3A gene R882C mutation, characterized in that, The kit comprises a crRNA with a nucleotide sequence as shown in SEQ ID NO: 3, an amplification primer, and a fluorescent probe, wherein the amplification primer comprises a forward primer with a sequence as shown in SEQ ID NO: 4 and a reverse primer with a sequence as shown in SEQ ID NO:

5. The method for visually detecting the DNMT3A gene R882C mutation comprises the following steps: performing PCR amplification on the genomic DNA of the bone marrow puncture of the sample to be tested using the amplification primer, performing CRISPR / Cas12 enzyme cutting reaction on the PCR amplification product, and naked eye reading the fluorescence result, and when the sample to be tested has obvious fluorescence signal, it is determined that the sample to be tested has DNMT3A gene R882C mutation.

2. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 1, characterized in that, The nucleotide sequence of the fluorescent probe is 5 to 15 random bases, the 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end of the fluorescent probe is labeled with a quencher group.

3. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 2, characterized in that, The fluorescent group is FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE or Texas Red, and the quencher group is TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 or BHQ-3.

4. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 1, characterized in that, The reaction system of the PCR amplification comprises: Master Mix 25 μL, the final concentration of the forward primer and the reverse primer is 20 pmol to 30 pmol, 5 μL to 20 μL template, and nuclease-free water is added to 50 μL.

5. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 4, characterized in that, The reaction program of the PCR amplification is: denaturation at 98℃ for 30 s; denaturation at 98℃ for 10 s, annealing at 60℃ for 10 s, extension at 72℃ for 10 s, 35 cycles; extension at 72℃ for 2 min.

6. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 1, characterized in that, The reaction system of the CRISPR / Cas12 enzyme cutting reaction comprises: NEBuffer 2 μL, the final concentration of Cas12a is 0.05 μM to 0.2 μM, the final concentration of crRNA is 0.05 μM to 0.2 μM, 15 U to 25 U Recombination RNase inhibitor, the fluorescent probe is 0.25 μM to 1 μM, 2 μL to 10 μL PCR amplification product, and nuclease-free water is added to 20 μL.

7. The kit for visualizing detection of DNMT3A gene R882C mutation according to claim 6, characterized in that, The reaction temperature of the CRISPR / Cas12 enzyme cutting reaction is 37℃±2℃, and the reaction time is 25 min to 35 min.

Citation Information

Patent Citations

  • CRISPR / Cas12-based composition for detecting Leber hereditary optic neuropathy through one-step method, kit and application

    CN117887841A

  • Targeted genome editing based on CRISPR / Cas9 system using short linearized double-stranded DNA

    KR1020160133380A