Aspergillus fumigatus for degrading soil microplastics and its application

Abstract

The present invention relates to the technical field of microplastic management. The present invention provides an Aspergillus fumigatus fungus for degrading soil microplastics and its application. The Latin name of the Aspergillus fumigatus fungus is Aspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit date is: September 18, 2024, and the deposit number is: CGMCC NO.41513. The Aspergillus fumigatus F of the present invention can grow in an environment with PE and PET as the only carbon source, and can be used as a biodegradable bacterial agent in the harmless treatment, recycling and environmental remediation of microplastic resources.

Description

Technical Field

[0001] The present invention relates to the technical field of microplastic management, and in particular to an Aspergillus fumigatus fungus for degrading soil microplastics and an application thereof. Background Art

[0002] Due to the excessive use of plastic products and the difficulty in recycling, most plastics enter the natural environment. Under the combined action of biological and non-biological factors, the physical and chemical properties of plastics change. After undergoing physical, chemical and biological aging processes, they are broken into microplastics (MPs) with a particle size of less than 5 mm, which cause serious harm to the atmosphere, water bodies and soil. The soil environment is currently considered to be the main "sink" for microplastics. Its microplastic content is 4 to 23 times that of the water environment. Among them, polyethylene (PE) and polyethylene terephthalate (PET) are two common microplastics in the soil. The harm to the soil is multifaceted. Not only does it destroy the soil structure and affect soil organisms, but the harmful chemicals it contains or adsorbs, such as plasticizers and heavy metals, can accumulate through the food chain and cause long-term negative impacts on soil organisms and the entire ecosystem. There are even reports that microplastics can enter the human body under the action of the food chain, thereby inducing reactions such as inflammation, oxidative stress and tissue damage, causing intestinal barrier dysfunction and affecting the cardiovascular system. Therefore, the removal of microplastics in the soil environment is crucial.

[0003] At present, the degradation of microplastics mainly includes physical, chemical and biological degradation. Microbial degradation technology has attracted wide attention because of its safety and environmental friendliness. The biological degradation of microplastics refers to the microorganisms adsorbing on the surface of microplastics, decomposing microplastics into small molecules that can be used by themselves through related enzymes synthesized by themselves and biological oxidation reactions, and finally converting them into CO 2 and H 2 O. At present, the research on the removal or restoration of microplastics is mainly focused on the water environment. There are problems such as low efficiency of microplastic degradation, difficulty in degrading multiple microplastics at the same time, incomplete degradation of microplastics, difficulty for free microorganisms to adapt to complex environments and fail to play an effective role, and the research on microbial degradation methods of microplastics in soil environments is still shallow. Therefore, screening the core strains of microbial degradation and immobilizing them for application is of great significance for degrading microplastic-contaminated soil. Summary of the invention

[0004] The purpose of the present invention is to provide an Aspergillus fumigatus for degrading soil microplastics and its application, which can achieve efficient degradation of microplastics such as polyethylene and polyethylene terephthalate.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an Aspergillus fumigatus for degrading soil microplastics. The Latin name of the Aspergillus fumigatus isAspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit date is: September 18, 2024, and the deposit number is: CGMCC NO.41513.

[0007] The present invention also provides the use of the Aspergillus fumigatus in the degradation of microplastics.

[0008] Preferably, the types of microplastics include polyethylene (PE) and / or polyethylene terephthalate (PET) microplastics.

[0009] The Aspergillus fumigatus F of the present invention can grow in an environment with PE and PET as the only carbon source. Under experimental conditions, after two months of treatment, the surface structure of the microplastics is damaged, the functional group structure thereof is mutated, the high molecular polymer undergoes a process of decomposition and fracture, and new compounds are formed in the process. The degradation rates of the F-1 group (normal group) are 9.48% and 9.13%, and the degradation rates of the F-2 group (high salt group) are 9.49% and 9.28%. When the Aspergillus fumigatus F is applied to the in-situ biodegradation of soil microplastics, the degradation rates reach 8.15% and 8.26% within 50 days. The microplastics can be used as a biodegradable bacterial agent in the harmless treatment, recycling and environmental restoration of microplastic resources.

[0010] Collection Instructions

[0011] Aspergillus fumigatus, Latin name Aspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is: September 18, 2024, and the deposit number is: CGMCC NO.41513. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the change of liquid micro-carbon inorganic salt culture medium after 30 days of cultivation.

[0013] Figure 2 This is the change of liquid inorganic salt culture medium after 90 days of cultivation.

[0014] Figure 3 The absorbance value change of liquid inorganic salt culture medium after 90 days of cultivation.

[0015] Figure 4 Aspergillus fumigatus ( Aspergillus fumigatus )F morphology, where a is the colony morphology on solid culture medium, and b is the single bacterial morphology under scanning electron microscope.

[0016] Figure 5 Aspergillus fumigatus ( Aspergillus fumigatus) F physiological and biochemical experiments, a is a carbon source utilization experiment; b is a starch utilization experiment; c is a salt tolerance experiment.

[0017] Figure 6 Aspergillus fumigatus ( Aspergillus fumigatus ) Phylogenetic tree of F.

[0018] Figure 7 Aspergillus fumigatus ( Aspergillus fumigatus )FWeight loss rate of microplastics after 60 days of degradation.

[0019] Figure 8 Aspergillus fumigatus ( Aspergillus fumigatus ) Changes in the surface morphology of microplastics after 60 days of degradation, where a is PET particles and b is PE film. DETAILED DESCRIPTION

[0020] The present invention provides an Aspergillus fumigatus for degrading soil microplastics. The Latin name of the Aspergillus fumigatus is Aspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit date is: September 18, 2024, and the deposit number is: CGMCC NO.41513.

[0021] The present invention also provides the use of the Aspergillus fumigatus in the degradation of microplastics.

[0022] In the present invention, the types of microplastics include polyethylene (PE) microplastics and / or polyethylene terephthalate (PET) microplastics.

[0023] In the present invention, the strain Aspergillus fumigatus ( Aspergillus fumigatus )F has the following characteristics:

[0024] (1) The colony color of this strain on the solid inorganic salt plate with microplastics as the only carbon source is gray velvety, with neat edges and forming colonies of 50 mm;

[0025] (2) Under a scanning electron microscope (2K times), a large number of conidiophores were found in the matrix. They were unbranched, colorless, non-septate, smooth, erect, and clustered. The top of the conidiophores was swollen to form an apical capsule, which was flask-shaped and 19 μm to 22 μm in diameter.

[0026] (3) Glucose, sucrose, fructose, starch, etc. can be widely used as carbon sources;

[0027] (4) It grows well in a solid inorganic salt medium with a salt concentration of 12%;

[0028] (5) The optimum growth temperature is 28~37℃;

[0029] (6) It can grow in an environment with PE or PET as the only carbon source, and within 60 days, the surface structure of the microplastics will be damaged, the functional group structure will change, the macromolecular polymers will depolymerize or break, and new products will be produced.

[0030] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0031] Example 1 Aspergillus fumigatus ( Aspergillus fumigatus ) Isolation and screening of F

[0032] PE films with a diameter of less than 5 mm and PET particles with a particle size of 0.75 μm were rinsed with deionized water to remove surface dust, added to a 2.5% by mass SDS solution for 15 minutes, and then soaked in a 75% by mass ethanol solution and a 95% by mass ethanol solution for 3 hours. After being rinsed with sterile water three times on a clean bench to remove residual solvents, they were dried and sterilized at 28°C to obtain the microplastics to be used, which were sterilized by ultraviolet irradiation for 3 hours before use;

[0033] 1 g of soil sample that had been contaminated by microplastics such as PE and PET for a long time was added to a sterile centrifuge tube together with 9 mL of normal saline. The sample was centrifuged at 3000 rpm for 5 minutes to remove soil particles and large pieces of matter. The supernatant was transferred to another sterile centrifuge tube. The sample was centrifuged at 8000 rpm for 15 minutes to remove the supernatant and then normal saline was added to prepare a soil bacterial suspension.

[0034] 0.5 g of prepared PE and PET were added to 50 mL of liquid trace carbon source culture medium as carbon sources, and 1 mL of soil bacteria suspension was inoculated. The first enrichment culture was carried out at 28 ° C and 150 rpm to improve the survival rate of microorganisms; the liquid trace carbon source culture medium without microplastics was used as the control group;

[0035] The composition of the liquid trace carbon source medium is: 0.5g Yeast extract, 2.0g NH 4 SO 4 , 100 mL trace element mother solution (1.0 g FeSO 4 7H 2 O, 1.0 g MgSO 4 7H 2 O, 0.1 g CuSO 4 ·5H 2 O, 0.1 g MnSO 4 ·H 2 O, 0.1 g ZnSO 4 7H 2O, constant volume to 100 mL), water 1000 mL, pH 7, sterilized at 121 ° C for 20 min;

[0036] After 30 days of enrichment culture, the culture medium changed from clear to turbid ( Figure 1 ). In the inorganic salt liquid enrichment culture, 1 mL of the bacterial liquid from the first trace carbon source liquid enrichment culture for 30 days was added to 100 mL of inorganic salt liquid culture medium, and 0.5 g PE + 0.5 g PET microplastics were added, and the culture was shaken at 28°C and 150 rpm for 90 days. At the same time, under the same conditions, the inorganic salt liquid culture medium without bacterial liquid but with polyethylene microplastics was used as the blank control group.

[0037] By observing the turbidity changes of the liquid culture medium and measuring OD600, it was found that the liquid culture medium became turbid after 90 days and the turbidity level corresponded to the growth stage of the strain, with the most turbidity in the logarithmic phase (e.g. Figure 2 , Figure 3 Take 100 μL of bacterial solution and dilute it to 10 -4 , 10 -5 , 10 -6 After the concentration is reached, it is coated on a solid inorganic salt culture medium with PE and PET as carbon sources to separate and purify bacteria that can degrade PE and PET microplastics;

[0038] Among them, the composition of the inorganic salt medium is: 0.70g KH 2 PO 4 , 0.70g K 2 HPO 4 , 0.70 g MgSO 4 7H 2 O, 1.00 g NH 4 NO 3 , 0.005 g NaCl, 0.002 g FeSO 4 7H 2 O, 0.002g ZnSO 4 7H 2 O and 0.001 g MnSO 4 ·H 2 O, dilute to 1 L, adjust pH to 7 (add 20 g agar to the solid medium), and sterilize by high pressure at 120 °C for 20 min.

[0039] Example 2 Aspergillus fumigatus ( Aspergillus fumigatus )Performance measurement and identification of F

[0040] 1. The degradation bacteria F obtained by separation and screening were subjected to the following physiological and biochemical experiments:

[0041] (1) Observe the characteristics of the colony size, shape, color, etc. of the degrading bacterium F on a solid inorganic salt medium with PE and PET as carbon sources;

[0042] (2) After the degrading bacterium F is rinsed, fixed, rinsed, dehydrated, dried, gold-plated, etc., observe it through a scanning electron microscope;

[0043] (3) Explore the physiological and biochemical characteristics through carbon source utilization experiments, starch utilization experiments, and salt tolerance experiments. In the carbon source utilization experiment, an inorganic salt medium inoculated with microorganisms but without adding three carbon sources is used as the control group. In the starch utilization experiment, an agar medium for starch hydrolysis determination without iodine solution is used as the control group. In the salt tolerance experiment, an inorganic salt medium with a salt content of 0% is used as the control group.

[0044] The results show that (1) the colony color of the degrading bacterium F on a solid inorganic salt plate with microplastics as the sole carbon source is gray velvet-like, with a neat edge, and a 50-mm colony is formed (the result is as shown in Figure 4 a); (2) under a scanning electron microscope (2K times), a large number of conidiophores occur in the substrate, are unbranched, colorless, septate-free, smooth, upright, tufted, and the top of the conidiophore expands to form a vesicle. The vesicle is flask-shaped, with a diameter of 19 μm - 22 μm, round, with a smooth surface, a neat edge, and is moist (the result is as shown in Figure 4 b); (3) the degrading bacterium F can widely utilize glucose, sucrose, fructose, starch, etc. as carbon sources, has a higher utilization rate for fructose, a 2-mm transparent degradation zone can be seen in the starch utilization experiment, and it can grow well in a solid inorganic salt medium with a salt concentration of 12% (as shown in Figure 5 ).

[0045] Specifically, the specific steps of the physiological and biochemical experiments are as follows:

[0046] (1) Carbon source utilization experiment: When the medium of the inorganic salt medium after sterilization cools to a semi-solid state, quickly place 3 sterilized circular filter papers with a diameter of 1 cm in the medium in a "field" shape, and then let it stand until the medium completely solidifies. Use a marker pen to draw 3 grids corresponding to the filter papers at the bottom of the petri dish and mark the corresponding numbers. Sterilize the 3 carbon sources of glucose, fructose, and sucrose under ultraviolet light for 4 h, and then prepare solutions with a concentration of 10 g / L respectively with sterile distilled water. Finally, dip a sterilized glass rod into these 3 solutions and spread them on the corresponding filter papers respectively. After 30 min, inoculate the strains on the 3 filter papers respectively and incubate them at a constant temperature of 28 °C for 7 days. Observe the colony growth situation.

[0047] (2) Starch hydrolysis experiment: The strain was inoculated on the culture medium by the spot planting method and cultured at a constant temperature of 28°C. After 4 days, iodine solution was poured on the surface of the culture medium. If the iodine solution around the colony did not turn blue but formed a transparent circle, it indicated that the starch was degraded, that is, amylase was produced.

[0048] (3) Salt tolerance test: Add 0%, 4%, 8%, 12% and 16% NaCl to the inorganic salt culture medium. Use an inoculation loop to scrape different types of colonies on the solid culture medium and place them in different centrifuge tubes containing 1 mL of sterile water to make a bacterial suspension. Take 100 μL and inoculate it into culture medium with different salinities and culture at a constant temperature of 28°C. Observe the growth of the colonies.

[0049] The culture medium composition involved in the physiological and biochemical experiments is as follows:

[0050] (1) Inorganic salt culture medium (g·L -1 ): 2.64 g ammonium sulfate, 2.38 g potassium dihydrogen phosphate, 5.65 g dipotassium hydrogen phosphate, 10 g magnesium sulfate heptahydrate, 0.0064 g copper sulfate pentahydrate, 0.0011 g ferrous sulfate heptahydrate, 0.0079 g manganese chloride tetrahydrate, 0.0015 g zinc sulfate heptahydrate, make up to 1L, adjust pH to 6.9, add 18 g agar, and sterilize at 120℃ for 20 min.

[0051] (2) Starch hydrolysis assay agar medium (g·L -1 ): 10.0 g soluble starch, 1.0 g potassium nitrate, 0.3 g dipotassium hydrogen phosphate, 1.0 g magnesium carbonate, 0.5 g sodium chloride, dilute to 1L, pH 7.3, add 18 g agar, and sterilize at 120℃ for 20 min.

[0052] 2. Shanghai Meiji Biopharmaceutical Technology Co., Ltd. completed the extraction, PCR amplification and sequencing of the F gene of the strain isolated and screened above. Specific primers were used for PCR amplification:

[0053] 16SrRNA-F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 1);

[0054] 16S rRNA-R: TACGGCTACCTTGTTACGACTT (SEQ ID NO. 2).

[0055] The sequencing results were compared with the gene sequences in GenBank on the NCBI website using Blast to determine the species of the bacteria. MEGA5.0 software (Molecula Evolutionary Genetics Analysis) was used to calculate the genetic distance, and the phylogenetic tree was constructed using neighbor-joining, and the stability of the tree was evaluated using Bootstrap analysis. Figure 6 ).

[0056] The results of 16S rDNA sequence comparison showed that strain F was similar to Aspergillus fumigatus ( Aspergillus fumigatus ) with a natural clustering of 16S rDNA sequences, with a similarity of 98%, indicating that strain F is similar to Aspergillus fumigatus ( Aspergillus fumigatus ) is very close in genetic status. Combined with its physiological and biochemical characteristics, it was identified as Aspergillus fumigatus ( Aspergillus fumigatus ), deposited in the General Microbiological Culture Collection Center of China General Microbiological Culture Collection Committee, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCCNO.41513.

[0057] Example 3 Application of Aspergillus fumigatus F in microplastic degradation

[0058] The Aspergillus fumigatus F screened and identified in Example 1 and Example 2 was used for microplastic biodegradation. Since Aspergillus fumigatus F was screened from a high-salt environment and has high salt tolerance, ① microplastic-liquid inorganic salt culture medium (hereinafter referred to as F-1) and ② microplastic-high salt (12%) liquid inorganic salt culture medium (hereinafter referred to as F-2) were set up respectively to analyze the microplastic degradation efficiency under different salinity conditions.

[0059] The specific degradation steps are as follows:

[0060] ① Microplastic-liquid inorganic salt culture medium composition: inorganic salt culture medium + 0.5mm PE film + 0.75μm PET particles; the specific composition is as follows: 0.70g KH 2 PO 4 , 0.70g K 2 HPO 4 , 0.70 g MgSO 4 7H 2 O, 1.00 g NH 4 NO 3 , 0.005 g NaCl, 0.002 g FeSO 4 7H 2 O, 0.002g ZnSO 4 7H 2O and 0.001 g MnSO 4 ·H 2 O, 2g PE film, 2g PET granules.

[0061] ② Microplastic-high salt (12%) liquid inorganic salt medium composition: inorganic salt medium + 0.5mm PE film + 0.75μm PET particles + NaCl (final concentration 12%); the specific composition is as follows: 0.70g KH 2 PO 4 , 0.70g K 2 HPO 4 , 0.70 g MgSO 4 7H 2 O, 1.00 g NH 4 NO 3 , 0.005 g NaCl, 0.002 g FeSO 4 7H 2 O, 0.002g ZnSO 4 7H 2 O and 0.001 g MnSO 4 ·H 2 O, 2g PE film, 2g PET particles, NaCl 120g.

[0062] F-1: 1 mL of Aspergillus fumigatus obtained by screening in Example 1 ( Aspergillus fumigatus ) F was prepared into a PBS bacterial suspension with an OD600 of 0.9, and inoculated into a conical flask containing 50 mL of microplastic-liquid inorganic salt culture medium at a volume ratio of 1:10;

[0063] F-2: 1 mL of Aspergillus fumigatus obtained by screening in Example 1 ( Aspergillus fumigatus ) F was prepared into a PBS bacterial suspension with an OD600 of 0.9, and inoculated into a conical flask containing 50 mL of microplastic-high salt (12%) liquid inorganic salt medium at a volume ratio of 1:10;

[0064] Control group: Liquid inorganic salt culture medium without inoculation of microorganisms was used as the control group;

[0065] The above groups were cultured at 28°C and 150 rpm in the dark. After 60 days of culture, the microplastic particles degraded by strain F were separated from the culture medium by suction filtration, and the particles were washed with 75% ethanol to remove the microorganisms attached to the microplastic particles, and then dried. The dried microplastics were weighed with an analytical balance, and the weight loss rate of the microplastics after degradation by the degradation strain F was calculated. The lost weight was the degradation rate of the microplastic degradation strain F. In addition, a scanning electron microscope was used to observe the microscopic features of the surface of the microplastic particles before and after degradation, and to observe whether pits, wrinkles and other features appeared on the surface of the microplastics. The changes in functional groups before and after degradation were analyzed by Fourier transform infrared spectrometer. The results showed that:

[0066] (1) If Figure 7 As shown, after 60 days of microplastic treatment, the PE film and PET particles degraded by Aspergillus fumigatus F were recovered by sieving method, washed, dried and weighed. It can be calculated by formula 1 that compared with the blank control group (inorganic salt culture medium without inoculation of bacterial solution but containing microplastics), the degradation rate of inorganic salt microplastic culture medium inoculated with strain F was significantly higher than that of the control group after 60 days of culture under the same conditions. The degradation rates of PE film and PET particles in F-1 after 60 days were 9.48% and 9.13%, respectively, and the degradation rates of PE film and PET particles in F-2 after 60 days were 9.49% and 9.28%, respectively. Compared with the F-1 group, the degradation rates of PE film and PET particles under high salt conditions (F-2 group) were improved;

[0067] Formula 1:

[0068] Microplastic weight loss rate (%) = [(original mass of microplastics - mass of microplastics after degradation) / original mass of microplastics] × 100%;

[0069] (2) If Figure 8 As shown in the figure, the surface of PE and PET microplastics before degradation was relatively flat and smooth. After inoculation with Aspergillus fumigatus F, the surface of the film and particles became rougher, with local unevenness, obvious gullies, grooves, pits and wrinkles, and the degree of damage was significantly greater than that of the microplastics before degradation.

[0070] It can be seen from the above embodiments that the present invention provides an Aspergillus fumigatus for degrading soil microplastics and its application. The Latin name of the Aspergillus fumigatus is Aspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit date is: September 18, 2024, and the deposit number is CGMCCNO.41513. The Aspergillus fumigatus F of the present invention can grow in an environment with PE and PET as the only carbon source, and can be used as a biodegradable bacterial agent in the harmless treatment, recycling and environmental remediation of microplastic resources.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An Aspergillus fumigatus, characterized in that The Latin name of Aspergillus fumigatus is Aspergillus fumigatus , the deposit name is: Aspergillus fumigatus F, the deposit location is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit date is: September 18, 2024, and the deposit number is: CGMCC NO.41513.

2. The use of Aspergillus fumigatus in microplastic degradation according to claim 1, characterized in that: The types of microplastics are polyethylene microplastics and / or polyethylene terephthalate microplastics.

Images