A rice fertility evaluation method and its application
By designing multiple KASP primer combinations and scoring evaluation methods, the problem of inaccurate identification of fertility resilience ability of rice materials in the prior art is solved, and rapid and accurate identification of fertility resilience ability is achieved, and detection efficiency and accuracy are improved.
Patent Information
- Application Number
- CN202411308104.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2044-09-19
AI Technical Summary
The prior art lacks KASP detection markers for simultaneously detecting Rf3 and Rf4 genes in rice materials, resulting in inaccurate identification of fertility recovery ability and affecting the breeding process of hybrid rice.
Multiple KASP primer combinations are designed to combine the theoretical phenotype of the material, and multi-site detection of rice materials is carried out through KASP detection technology, and the detection accuracy is evaluated using a scoring system, including the degree of consistency of the detection results of the primer combination with the theoretical phenotype, improving detection efficiency and accuracy.
It has achieved rapid and accurate identification of the fertility recovery ability of rice materials, and can distinguish between fertility-free, semi-recovery and full-recovery materials, improve detection efficiency and accuracy, and shorten the breeding process.
Smart Images

Figure CN119020528B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of rice breeding, and in particular relates to a rice fertility evaluation method and application thereof. Background Art
[0002] The three-line rice breeding method significantly improves hybrid rice yield and quality by utilizing a cytoplasmic male sterile (CMS) line, a maintainer line, and a restorer line. However, the three-line breeding process requires accurate identification of the fertility recovery capacity of the breeding material to ensure that the maintainer line has no recovery ability and the restorer line has strong recovery ability.
[0003] Among various CMS germplasm resources, wild-type cytoplasmic male sterile lines (WA-CMS) are widely used. Studies have found that fertility restoration in WA-CMS is primarily regulated by two independent dominant genes, Rf3 and Rf4, but there is still controversy over which gene is most effective in fertility restoration (Cai Jian et al., 2014). Therefore, simultaneous testing of WA-CMS materials for the presence of both Rf3 and Rf4 genes can more accurately determine their fertility restoration capacity, thereby reducing field testing and accelerating breeding efforts.
[0004] Competitive allele-specific PCR (KASP) is a SNP marker detection technology that uses competitive allele-specific PCR to perform biallelic typing of target SNPs and indels in DNA samples. It offers advantages such as excellent stability, high detection efficiency, and high accuracy (Zhao Chuanchao et al., 2023). Currently, there are few KASP detection markers for Rf3 and Rf4, and even fewer technologies for simultaneously detecting multiple KASP markers on both genes. Therefore, developing a technology that can simultaneously detect multiple KASP key sites in Rf3 and Rf4 and scientifically score and evaluate the materials is of great significance for rapidly identifying the retention capacity of maintainer lines and the resilience of restorer lines. Summary of the Invention
[0005] One of the objects of the present invention is to provide a method for evaluating rice fertility, the method comprising the following steps:
[0006] (1) Classify the tested rice materials according to their theoretical phenotypes, where + represents "full fertility recovery", H represents "partial fertility recovery", and - represents "no fertility recovery";
[0007] (2) performing KASP detection on rice materials using primer sets 1, 2, and 3, respectively, wherein the nucleotide sequences of primer sets 1, 2, and 3 are shown as SEQ ID NOs. 1-3, 4-6, and 7-9, respectively; the rice materials include test rice materials and control rice materials;
[0008] (3) The detection result of each primer set KASP is recorded as +, H or -, and the meaning of + / H / - is the same as step (1). The "detection score" of primer sets 1, 2, and 3 is the degree of consistency between the detection result of the corresponding primer set and the theoretical phenotype. The scoring rules are as follows: ① If the theoretical phenotype is -, the detection result is 1 point for -, 0.5 points for H, and 0 points for +; ② If the theoretical phenotype is +, the detection result is 0 point for -, 0.5 points for H, and 1 point for +; ③ If the theoretical phenotype is H, the detection result is 0 point for -, 2 points for H, and 0 points for +. 1 point; the total test score is the sum of the scores of the three primer sets, and the theoretical total score is determined according to the theoretical phenotype of the material: ① If the theoretical phenotype is + or -, the theoretical total score is 3 points, with each primer set corresponding to 1 point; ② If the theoretical phenotype is H, the theoretical total score is 6 points, with each primer set corresponding to 2 points; ③ If there is a "not detected" result, the corresponding primer is not included in the total test score and theoretical total score; the material score rate is used to measure the accuracy of this primer combination in detecting a certain material. Material score rate = sum of the test scores of the three primer sets / theoretical total score × 100%;
[0009] The detection results of the corresponding primer set are obtained by comparing with the control rice material.
[0010] Preferably, the step (2) further includes extracting DNA from the rice material before the KASP detection.
[0011] More preferably, DNA extraction is performed on rice leaves.
[0012] More preferably, the DNA extraction process is as follows: grind the rice leaves, add 2×CTAB, then add chloroform and isoamyl alcohol, shake, collect the supernatant, add NaCl, isopropanol and magnetic bead solution to the supernatant, and extract to obtain DNA.
[0013] More preferably, the reaction system of the KASP is as follows: 10 μL PCR system: 5 μL Max, 0.1 μL of each of the two specific primers, 0.3 μL of the universal primer, 3.5 μL DEPC water, and 1 μL of sample DNA.
[0014] More preferably, the PCR program is: pre-denaturation at 95°C for 10 min; cycle 2: denaturation at 95°C for 20 s, annealing / extension at 61°C-55°C for 40 s, performed 10 times; cycle 3: denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, performed 27 times.
[0015] More preferably, the detection results of the corresponding primer set are obtained by cluster analysis and comparison with control rice materials.
[0016] A second object of the present invention is to provide an application of the above evaluation method in the identification of rice fertility recovery ability.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] The present invention targets the key rice fertility genes Rf3 and Rf4. Based on the existing KASP primers for detecting fertility recovery ability, the method expands the concept and uses multiple KASP primers to form a primer combination to detect multiple sites on the gene at one time, thereby improving detection efficiency and increasing detection accuracy.
[0019] Based on multi-locus (primer combination) testing, this paper creatively proposes combining theoretical material phenotypes with a scoring system to evaluate the accuracy of primer combinations in material testing (measured by the "material score rate"). This test accuracy can not only determine the suitability of the primer combination for testing a batch of materials, but also verify the accuracy of the theoretical phenotype of a particular material, thereby quickly screening out materials that do not meet the requirements for fertility recovery.
[0020] Considering that rice semi-fertility restoration materials contain a variety of genotype combinations and are difficult to detect (Chen Letian et al., 2023), when designing the test effect scoring system, the present invention appropriately increased the "theoretical total score" (6 points) for semi-fertility restoration materials compared to the "theoretical total score" (3 points) for fertility non-restoration and fertility full restoration materials. Primers with a test result of H (i.e., completely correct) for this type of material were scored 2 points, and primers with a test result of + (incompletely correct) were scored 1 point to distinguish them. This refined scoring system is conducive to more accurately distinguishing the fertility restoration ability of rice materials and also provides ideas and references for other studies using KASP primer combinations to evaluate test effects.
[0021] The "KASP primer combination for rice fertility restoration detection" proposed in this invention is highly effective in detecting the fertility restoration ability of rice materials, especially for identifying materials with no fertility restoration and those with full fertility restoration. Furthermore, this primer combination can distinguish materials with partial fertility restoration from those with no fertility restoration, ensuring that maintainer lines without fertility restoration have reliable sterility maintenance capabilities.
[0022] This paper, using the design of Rf4 KASP primers as an example, discloses a method for designing KASP primers and verifying their specificity and typing efficacy. This method, combined with the online websites Primer3 and Primer-BLAST, utilizes agarose gel electrophoresis, high-throughput DNA extraction, and KASP detection technology. It details the entire process for obtaining a pair of KASP primers with excellent detection efficacy. This method has strong practical significance and helps beginners quickly obtain new KASP primers based on target traits.
[0023] The invention has clear technical indicators, strong operability and certain technical innovation, and provides a technical system for rapidly detecting and evaluating the fertility recovery ability of rice materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is a cluster diagram of KASP genotyping of 21 materials in Table 3 (including 14 test materials and 7 control materials) using primer combinations 1-3 in Example 3, wherein black dots represent blank controls, blue / green / red dots represent the above 21 materials, and are numbered. The numbers represent the following materials: 1, M-626; 2, M-628; 3, M-632; 4, M-625; 5, M-627; 6, M-631; 7, M-694; 8, M-695; 9, M-696; 10, M-697; 11, M-698; 12, M-604; 13, M-612; 14, M-678; 15, Taifeng B; 16, Nipponbare; 17, IR24; 18, Jiuxiangnian; 19, Huanghuazhan; 20, Minghui 63; 21(1) and 21(2) are both Zhonghui 261, which are considered as 2 replicates. 1a-1b are the test results of primer set 1, a and b are the same test results, left Figure 1 a Use color to identify the theoretical phenotype of the material, right Figure 1 b uses color to identify each material according to the actual clustering results. Figure 1 c-1d are the detection results of primer set 2, Figure 1 e-1f are the detection results of primer set 3, and the left and right figures have the same meanings as before. Figure 1 In a, 1c, and 1e, blue indicates that the theoretical phenotype of the material is "no fertility recovery," green indicates "half fertility recovery," and red indicates "full fertility recovery." Figure 1 In b, 1d, and 1f, blue indicates that the actual test result phenotype of the material is "fertility not restored", green indicates "fertility half restored", and red indicates "fertility fully restored". DETAILED DESCRIPTION
[0025] Example 1
[0026] This embodiment provides a method for KASP multi-locus detection and evaluation of rice fertility, the specific steps are as follows:
[0027] 1. Formation of KASP primer combination for rice fertility restoration detection
[0028] A pair of KASP primers was designed for the Rf4 gene (National Rice Data Center: https: / / www.ricedata.cn / gene / list / 147.htm), and combined with an existing pair of Rf3 gene (National Rice Data Center: https: / / www.ricedata.cn / gene / list / 146.htm) and a pair of Rf4 gene KASP primers to form a "rice fertility restoration detection KASP primer combination" consisting of three pairs of rice fertility restoration-related genes (Rf).
[0029] (1) Known Rf3 and Rf4 KASP primer sets
[0030] a. Primer set 1: Rf3 KASP primers (Zheng Taotao, 2021)
[0031] Specific primer F1 (SEQ ID NO.1):
[0032] GAAGGTGACCAAGTTCATGCTGCTTCGGGTGACGGCGGCGGC A ;
[0033] Specific primer H1 (SEQ ID NO.2):
[0034] GAAGGTCGGAGTCAACGGATTGCTCTGGTGACGGCGGCGGC G ;
[0035] Universal primer C1 (SEQ ID NO.3):
[0036] GTGAAGTTTCCTCGGAATC.
[0037] b. Primer set 2: Rf4 KASP primers (Chen et al., 2017)
[0038] Specific primer F2 (SEQ ID NO.4):
[0039] GAAGGTGACCAAGTTCATGCTCGCAGAATGACCGAGCTCGG A ;
[0040] Specific primer H2 (SEQ ID NO.5):
[0041] GAAGGTCGGAGTCAACGGATTGCAGAATGACCGAGCTCGGC ;
[0042] Universal primer C2 (SEQ ID NO.6):
[0043] AGACCCTTGAGAAGAWTATTGTAGGAGAA.
[0044] (2) Primer set 3: Design a pair of KASP primers for the Rf4 gene and verify the specificity and typing effect
[0045] The japonica rice genome IRGSP-1.0 of Nipponbare was used as the reference genome, and the SNP at 18835456bp on chromosome 10 was the site of the designed primers (T represents wild type, without resilience / A represents mutant type, with resilience). The SNP is also located at 503bp on the positive strand of the Rf4 CDS sequence.
[0046] The design method of this pair of primers is shown in "2. Design of new Rf4 KASP primers, specificity and typing effect verification steps."
[0047] The primer sequences are as follows:
[0048] Specific primer F3 (SEQ ID NO.7):
[0049] GAAGGTGACCAAGTTCATGCTTCATCACACAGACCCTTGAGAAGA T ;
[0050] Specific primer H3 (SEQ ID NO.8):
[0051] GAAGGTCGGAGTCAACGGATTTCATCACACAGACCCTTGAGAAGA A ;
[0052] Universal primer C3 (SEQ ID NO.9):
[0053] TGCATACCAGATGTCTTCTCCTACA.
[0054] 2. Design of new Rf4 KASP primers, and verification of their specificity and typing effect:
[0055] ("Primer Set 3: A pair of KASP primers designed for the Rf4 gene" was verified by the following steps)
[0056] a. KASP primer online design
[0057] A pair of KASP primers consists of two upstream primers and one downstream primer. KASP primers were designed using the Primer3 website (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The design parameters were set as follows: the target sequence was the SNP site (enclosed in parentheses) and its upstream and downstream 100 bp sequence, totaling 201 bp, the amplicon length was 70-150 bp, the primer length was 18-28 bp (optimum 24 bp), and the primer T was 100 bp. m The optimal temperature was 62-64°C (63°C). FAM (SEQ ID NO. 10: 5'-GAAGGTGACCAAGTTCATGCT-3') and HEX (SEQ ID NO. 11: 5'-GAAGGTCGGAGTCAACGGATT-3') fluorescent sequences were added to the 5' ends of the two upstream primers designed on the website (represented by F and H, respectively, and the common downstream primer was represented by C).
[0058] b. Primer-BLAST detection of KASP primer specificity
[0059] Enter the KASP upstream and downstream primers without the fluorescent sequence in the Primer Parameters section of the Primer-BLAST website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi). Follow the instructions on the website to test the specificity of the designed primers on the rice reference genome. In the specificity test results, check whether the Product target templates are on the intended chromosome, whether the template site is correct, whether there are identical sequences or similar sequences with only 1-2 base differences, and whether the different base is the last base at the 3' end of the primer. If any of these conditions are present, the primers have poor specificity and are not suitable for KASP primers. Adjust the primer sequence or select a new site.
[0060] c. Electrophoresis detection of KASP primer specificity
[0061] Using DNA from the rice cultivar corresponding to the rice reference genome used for primer design as a template, synthesized primers specific for KASP identified by Primer-BLAST were used for PCR amplification using the upstream and downstream primer combinations F+C and H+C, respectively. An agarose gel (1.1-1.2% agarose, dissolved in 1×TAE) was prepared and electrophoresed at 160-180V in 1×TAE. If the band size was as expected and the specificity was high (single, non-smearing, no tailing), the primers were suitable for KASP detection. Otherwise, the amplification specificity was poor and primer redesign was necessary. Since only a single SNP at the 3' end differed, both primer pairs generally amplified a band.
[0062] d. Collect positive and negative control materials with known phenotypes
[0063] Identify the trait regulated by the gene at the SNP site and designate the phenotype that meets the breeding goal as positive (e.g., disease resistance). Materials exhibiting a positive phenotype are designated as positive controls, while those exhibiting a negative phenotype are designated as negative controls (e.g., disease susceptibility). Materials exhibiting a phenotype that falls between the two are considered heterozygous.
[0064] e. High-throughput extraction of DNA from control materials
[0065] The leaves of the yin and yang control materials were folded neatly, and circular leaves were punched out using a 6 mm circular puncher (Ningbo Tianhong Stationery Company) and placed in a 96-well deep-well plate (the well depth was 2 mm, and the wells used for grinding samples had 3 mm diameter steel balls placed in them), and the deep-well plate was covered with a silicone cover.
[0066] Grind at 1200 rpm for 2 min using a grinder (Geno / Grinder, SPEX SamplePrep 2010), add 800 μL of 2×CTAB (preheated in a 65°C water bath) using an automatic liquid dispensing workstation (Gene Zephyr automatic workstation, hereinafter referred to as the “workstation”), invert, and place in a 65°C water bath for 15-20 min.
[0067] 2×CTAB formula (for 1L):
[0068] Mix 700 mL of deionized water, 81.86 g of NaCl, 20 g of CTAB powder, 10 g of PVP-40, 100 mL of 1 M Tris-HCl (12.11 g of Tris in 80 mL of ddH₂O, adjust the pH to 8.0 with concentrated HCl), and 0.5 M EDTA (16.81 g of Na₂EDTA·2H₂O in 80 mL of ddH₂O, adjust the pH to 8.0 with concentrated NaOH). After dissolving, autoclave at 121°C for 20 min. Add 2 mL of β-mercaptoethanol in a fume hood.
[0069] Use a workstation to add 800 μL of chloroform-isoamyl alcohol (24:1 volume ratio), shake well, and centrifuge until completely separated. Use a workstation to aspirate 400 μL of the supernatant into a new deep-well plate. Use the workstation to sequentially add 200 μL of 5M NaCl and 400 μL of isopropanol. Then, add 10 μL of magnetic bead solution (Silica-Based Magnetic Beads, Luoyang Huier Nanotechnology Co., Ltd., Catalog No. HRCZ-02N200, 100 mg / mL) to each well. Invert to mix thoroughly and incubate at -20°C for 20-30 min.
[0070] Subsequent extraction was completed using an H9600 nucleic acid extractor (Chengdu Hanchen Guangyi Technology Co., Ltd.), and the concentration of the extracted DNA solution was measured using a DNA concentration meter (Thermo SCIENTIFIC NANODROP 1000 Spectrophotometer) and adjusted to 50 ng / μL.
[0071] f. Testing the typing effect of KASP primers
[0072] A 2× Master Mix for ASPCR kit (Chengdu Hanchen Guangyi Technology Co., Ltd.) was used to prepare a 10 μL PCR system (5 μL Mix, 0.1 μL each of F and H, 0.3 μL of C, 3.5 μL DEPC water; 1 μL of 50 ng / μL sample DNA). The PCR program was as follows: pre-denaturation at 95°C for 10 min; cycle 2 (denaturation at 95°C for 20 s, annealing / extension at 61°C-55°C (-0.6°C / cycle) for 40 s) for 10 times; cycle 3 (denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s) for 27 times (if clustering is not obvious enough, 1-3 more times can be used); fluorescence scanning at 30°C for 30 s.
[0073] The typing results of the control materials were analyzed using a KASP microplate reader (POLARstar Omega fully automatic multifunctional microplate reader) and KlusterCaller software. If the positive and negative control materials were clustered individually (the accuracy of clustering materials with the same phenotype was greater than 80%) and clearly clustered (with clear boundaries and large distances between different clusters), they could be preliminarily used for genotyping.
[0074] 3. Use the "fertility recovery detection KASP primer combination" to detect the genotype of the test material
[0075] a. KASP typing test
[0076] After confirming that KASP primer typing is effective, select 3-5 samples from each of the positive and negative control materials that appear closest to the outermost point in the clustering graph (i.e., the point with the largest or smallest x / y value) as controls for typing with these primers. When extracting DNA from the test material for KASP typing, follow the same steps as in step f. However, at least three blank control points (replace the DNA in the 5 μL PCR system prepared in the KASP kit with DEPC water; this point should be located at the lower left of the cluster graph) and three positive and negative control points should be set up to determine the genotype of the test material during clustering and, subsequently, infer its phenotype.
[0077] b. Calculate the test score for each material
[0078] A table is made as shown in Table 1 (the table contains sample data), in which the higher the "material score rate", the higher the detection accuracy of the primer combination for the material.
[0079] The meaning and scoring rules of each column in the table are as follows:
[0080] Material type, classified according to the fertility restoration ability of the material being tested, includes sterile lines, maintainer lines, semi-fertility restorer lines, and fully fertility restorer lines. Number / Name, the number of a particular type of material being tested, or a recognized material name. Theoretical phenotype is the material's inferred phenotype, with + indicating "full fertility restoration" (the material can fully restore the fertility of the sterile line), H indicating "semi-fertility restoration" (the material can partially restore the fertility of the sterile line), and - indicating "no fertility restoration" (the material cannot restore the fertility of the sterile line).
[0081] The "Result" under Primer Set 1 / 2 / 3 is the KASP test result for that primer pair, with + / H / - having the same meanings as above. The "Score" under Primer Set 1 / 2 / 3 is the degree of agreement between the test result and the theoretical result for that primer pair. The closer the agreement, the higher the score. The scoring rules are as follows: if the theoretical phenotype is -, the test result is scored as 1 point for a -, 0.5 points for an H, and 0 points for a +. If the theoretical phenotype is +, the test result is scored as 0 point for a -, 0.5 points for an H, and 1 point for a +. If the theoretical phenotype is H, the test result is scored as 0 point for a -, 2 points for an H, and 1 point for a +. (Both "Full Fertility Recovery" and "Partial Fertility Recovery" indicate resilient phenotypes, making it difficult to distinguish between them through genotyping. Therefore, test results with a higher degree of agreement with the theoretical value of H are given a higher score.)
[0082] The total test score is the sum of the scores of the three primer pairs. The theoretical total score is determined based on the theoretical phenotype of the material, which is either + or -, with a maximum score of 3, and H being 6. If a "Not Detected" result occurs, the corresponding primer is not included in the total test score or the theoretical total score. The material score rate measures the accuracy of this primer combination for detecting a particular material: material score rate = total test score of the three primer pairs / theoretical total score × 100%.
[0083] Table 1. Detection score table of KASP primer combinations for fertility recovery detection (the data filled in this table refer to Table 3 as an example)
[0084]
[0085] Example 2 Observation of the field fertility recovery phenotype of the material to be tested
[0086] The following materials are all from: National Plant Space Breeding Engineering Technology Research Center, South China Agricultural University.
[0087] (1) Fertility non-recovery materials: Three sterile line materials were sown in the late 2023 season (numbered M-626, M-628, and M-632 in the late 2023 season). During the flowering period, the three sterile line materials with the "theoretical phenotype" of "fertility non-recovery (-)" were used as female parents, and the maintenance line materials M-625, M-627, and M-631 (numbered M-631 in the late 2023 season) were used as male parents for hybridization with the above female parents, and three hybrid offspring were obtained, namely Z-596 (M-625 / M-626), Z-598 (M-627 / M-628), and Z-600 (M-631 / M-632).
[0088] The three hybrid materials mentioned above were sown in the early season of 2024, and the flowering morphology was observed at the heading stage. It was found that all three hybrid materials were sterile, indicating that the three materials such as M-625 could not restore the fertility of the sterile line and had good sterility maintenance ability.
[0089] (2) Fertility semi-restoration materials: In the late flowering period of 2023, the sterile line material F1-00A was used as the female parent and five restorer line materials with the "theoretical phenotype" of "fertility semi-restoration (H)" (numbered M-694, M-695, M-696, M-697, and M-698 in the late flowering period of 2023) were used as the male parents for hybridization, and six hybrid offspring were obtained, namely Z-742 (F1-00A / M-694), Z-743 (F1-00A / M-695), Z-744 (F1-00A / M-696), Z-745 (F1-00A / M-697), and Z-746 (F1-00A / M-698).
[0090] The above five hybrid materials were sown in the early season of 2024, and the flowering morphology was observed at the heading stage. It was found that some grains of these five hybrid materials were strong and had a semi-sterile phenotype, indicating that the five materials including material M-694 can restore partial fertility of the sterile line, and the fertility recovery phenotype is indeed "semi-fertility recovery".
[0091] (3) Fertility-recovering materials: In the late flowering period of 2023, the sterile line material F1-00A was used as the female parent and three restorer line materials with the "theoretical phenotype" of "fertility-recovering (+)" (numbered M-604, M-612, and M-678 in the late 2023 crop) were used as the male parents for hybridization, and three hybrid offspring were obtained, namely Z-738 (F1-00A / M-604), Z-739 (F1-00A / M-612), and Z-740 (F1-00A / M-678).
[0092] The three hybrid materials mentioned above were sown in the early season of 2024, and the flowering morphology was observed at the heading stage. It was found that the grains of the three hybrid materials were well-set and showed a fertile phenotype, indicating that the three materials including material M-604 can restore the fertility of the sterile line, and the fertility restoration phenotype is indeed "full fertility recovery".
[0093] Example 3 KASP genotyping detection using the “rice fertility restoration detection KASP primer combination”
[0094] In the late 2023 crop, leaves of 14 materials mentioned in “Example 2 Observation of field fertility recovery phenotypes of the materials to be tested” were taken in the field during the heading period of rice (3 sterile lines, M-626, M-628, and M-632; 3 maintenance lines, M-625, M-627, and M-631; 5 fertility semi-recovery lines, M-694, M-695, M-696, M-697, and M-698; 3 fertility full recovery lines, M-604, M-612, and M-678). DNA from the above materials was extracted using the method in "e. High-throughput extraction of DNA from control materials" in "Steps for designing, validating specificity, and genotyping effects of newly designed Rf4 KASP primers." The genotypes of the materials were detected using the "KASP primer combination for rice fertility restoration" according to the method in "a. KASP typing detection" in "3. Detecting the genotypes of the test materials using the "KASP primer combination for fertility restoration detection."
[0095] At the same time, leaves from two accessions with no fertility restoration ability (Taifeng B and Nipponbare), three accessions with semi-fertility restoration lines (IR24, Jiuxiangnian, and Huanghuazhan), and two accessions with full fertility restoration lines (Minghui 63 and Zhonghui 261) were collected at the heading stage to serve as the "yin-yang control materials" described in "d. Collection of yin-yang control materials with known phenotypes" (Chen Letian et al., 2023). Genotyping was performed using the same method as above. The genotyping results are summarized in Table 2.
[0096] Table 2. Genotyping results of 14 test materials and 7 fertility positive and negative control materials using the "KASP primer combination for rice fertility restoration detection" ("Not detected" indicates that the material could not be successfully typed using this primer combination. Results of "Not detected" are not included in the scoring. Same below.)
[0097]
[0098]
[0099] Example 4 Evaluation of the Genotyping Effect of the “Rice Fertility Restoration Detection KASP Primer Combination”
[0100] According to the method of "b. Calculating the detection score of each material" in "3. Using the "Fertility Restoration Detection KASP Primer Combination" to detect the genotype of the test material", Table 2 in Example 3 was scored to obtain the scoring table Table 3.
[0101] Table 3 Evaluation of genotyping effect of “KASP primer combination for rice fertility restoration detection”
[0102]
[0103]
[0104]
[0105] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art shall fall within the scope of protection defined by the claims of the present invention.
Claims
1. A method for evaluating rice fertility, characterized in that: The evaluation method comprises the following steps: (1) Classify the tested rice materials according to their theoretical phenotypes, where + represents "full fertility recovery", H represents "partial fertility recovery", and - represents "no fertility recovery"; (2) performing KASP detection on rice materials using primer sets 1, 2, and 3, respectively, wherein the nucleotide sequences of primer sets 1, 2, and 3 are shown as SEQ ID NOs. 1-3, 4-6, and 7-9, respectively; the rice materials include test rice materials and control rice materials; (3) The detection result of each primer set KASP is recorded as +, H or -, and the meaning of + / H / - is the same as step (1). The "detection score" of primer sets 1, 2, and 3 is the degree of consistency between the detection result of the corresponding primer set and the theoretical phenotype. The scoring rules are as follows: ① If the theoretical phenotype is -, the detection result is - with 1 point, H with 0.5 points, and + with 0 points; ② If the theoretical phenotype is +, the detection result is - with 0 point, H with 0.5 points, and + with 1 point; ③ If the theoretical phenotype is H, the detection result is - with 0 point, H with 2 points, and + with 0 points. 1 point; the total test score is the sum of the scores of the three primer sets, and the theoretical total score is determined based on the theoretical phenotype of the material: ① If the theoretical phenotype is + or -, the theoretical total score is 3 points, with each primer set corresponding to 1 point; ② If the theoretical phenotype is H, the theoretical total score is 6 points, with each primer set corresponding to 2 points; ③ If there is a "not detected" result, the corresponding primer is not included in the total test score or theoretical total score; the material score rate is used to measure the accuracy of this primer combination in detecting a certain material. Material score rate = sum of the test scores of the three primer sets / theoretical total score × 100%; The detection results of the corresponding primer set are obtained by comparing with the control rice material.
2. The evaluation method according to claim 1, wherein: The step (2) also includes extracting DNA from the rice material before the KASP detection.
3. The evaluation method according to claim 2, wherein: DNA was extracted from rice leaves.
4. The evaluation method according to claim 3, wherein: The DNA extraction process is as follows: after grinding rice leaves, add 2×CTAB, then add chloroform and isoamyl alcohol, shake, collect the supernatant, add NaCl, isopropanol and magnetic bead solution to the supernatant, and extract to obtain DNA.
5. The evaluation method according to claim 4, wherein: The KASP reaction system is as follows: 10 μL PCR system: 5 μL Mix, 0.1 μL of each of the two specific primers, 0.3 μL of the universal primer, 3.5 μL DEPC water, and 1 μL of sample DNA.
6. The evaluation method according to claim 5, characterized in that The PCR program was as follows: pre-denaturation at 95°C for 10 min; cycle 2: denaturation at 95°C for 20 s, annealing / extension at 61°C-55°C for 40 s, performed 10 times; cycle 3: denaturation at 95°C for 20 s, annealing / extension at 55°C for 40 s, performed 27 times.
7. The evaluation method according to any one of claims 1 to 6, characterized in that: The detection results of the corresponding primer group are obtained by cluster analysis and comparison with the control rice material.
8. Use of the evaluation method according to any one of claims 1 to 7 in identifying the fertility recovery ability of rice.
9. Use of the evaluation method according to claim 7 in identifying the fertility recovery ability of rice.
Citation Information
Patent Citations
Rice fertility recovery gene auxiliary breeding molecular marker and application thereof
CN107385024A
Method for identifying and selecting maize plants with cytoplasmic male sterility restoring genes
CN116887669A