An Indel molecular marker tightly linked to the eggplant single-flower-single-fruit trait gene and its application

Abstract

The invention discloses an Indel molecular marker tightly linked to a gene for the single flower and single fruit trait of eggplant and its application, and belongs to the technical field of molecular markers. The invention analyzes the polymorphic sites of the whole genome of single flower and single fruit eggplant and multi-flower and multi-fruit eggplant by a new generation of high-throughput sequencing technology for the first time, screens out the target interval where the trait is located, and obtains two molecular markers P1144B084 (i.e., Indel molecular marker 1) and P1144B087 (i.e., Indel molecular marker 2) that can effectively identify single flower and single fruit eggplant by screening Indel molecular markers. In the present invention, the detection of the tightly linked Indel molecular marker of single flower and single fruit of eggplant is convenient and fast, the result is stable, and it is not affected by the environment. By PCR amplification, PCR product enzyme digestion and electrophoresis detection and analysis, the number of eggplant flowers can be predicted, and then single flower and single fruit eggplant single plants can be accurately and quickly screened.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to an Indel molecular marker tightly linked to a gene for single flower and single fruit trait of eggplant and application thereof. Background Art

[0002] Eggplant is an important nightshade vegetable crop in my country, with a current planting area of ​​more than 13 million mu. Flowers are important organs for plants from vegetative growth to reproductive growth, and are also an important factor affecting the fruiting of plants. Eggplant flowers mainly exist in various forms, including single main flowers and main flowers plus multiple secondary flowers (also called axillary flowers or side flowers). The characteristics of single flower and single fruit of eggplant are mainly reflected in its growth habits and yield control, which are of great significance for the cultivation and management of eggplant. The following is a detailed analysis of the advantages of single flower and single fruit of eggplant: 1. Growth habit advantages: (1) Concentrated nutrient supply: Since eggplant is a single flower and single fruit, each flower only produces one fruit, which enables the plant to more concentratedly supply nutrients to each fruit, which is conducive to the full development and quality improvement of the fruit. (2) Reduced nutrient competition: Compared with crops with multiple flowers and multiple fruits, single flower and single fruit eggplant reduces nutrient competition between fruits, allowing each fruit to obtain sufficient nutrients, thereby improving the overall quality and yield of the fruit. (3) Stable yield: The single-flower-single-fruit growth pattern helps stabilize eggplant yield and reduce the problem of uneven fruit size and quality caused by uneven nutrient distribution. 2. Management convenience: (1) Simplified pruning: During the growth of eggplant, growers can prune as needed, remove excess side branches and flowers, and concentrate nutrients on the main branches and fruits. Since eggplant has a single flower and a single fruit, this pruning work is relatively simple and has clear goals. (2) Pest and disease control: Eggplant with a single flower and a single fruit also has certain advantages in pest and disease control. Since the number of fruits is relatively small, growers can more easily monitor and control pests and diseases, reduce the use of pesticides, reduce production costs and protect the ecological environment. 3. Improve fruit quality, (1) Full fruit development: Due to the concentrated supply of nutrients and reduced nutrient competition, the fruits of eggplants with a single flower and a single fruit can develop more fully, the flesh is thicker and the taste is better. (2) Appearance and taste: Eggplants with single flowers and single fruits are usually more neat, beautiful, and brightly colored in appearance; they taste more delicate and juicy, which meets the needs of consumers.

[0003] In summary, the advantages of single-flower and single-fruit eggplant are mainly reflected in concentrated nutrient supply, reduced nutrient competition, stable yield, management convenience and improved fruit quality. These advantages make eggplant easier to control in planting and management, and can also produce higher quality fruits to meet market demand, enhance the competitiveness of products in the market, and thus improve the economic benefits of farmers. At the same time, the planting of single-flower eggplant helps to reduce production costs, improve the commerciality of eggplant, and also increase effective yield, simplify field management, and increase economic benefits. Therefore, when planting eggplant, the rational use of single-flower and single-fruit eggplant varieties is one of the effective ways to increase yield and quality. Therefore, the study of single-flower and single-fruit eggplant is of great significance to eggplant breeding and production practice. Summary of the invention

[0004] One of the purposes of the present invention is to provide an Indel molecular marker tightly linked to a gene for the single-flower-single-fruit trait of eggplant, wherein the Indel molecular marker is Indel molecular marker 1 or Indel molecular marker 2; the nucleotide sequence of the Indel molecular marker 1 is shown in SEQ ID NO.3, wherein positions 49-51 of SEQ ID NO.3 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 49-51 of SEQ ID NO.3 is a single-flower-single-fruit variety; the nucleotide sequence of the Indel molecular marker 2 is shown in SEQ ID NO.6, wherein positions 75-78 of SEQ ID NO.6 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 75-78 of SEQ ID NO.6 is a single-flower-single-fruit variety.

[0005] The second object of the present invention is to provide an application of a substance for detecting the above-mentioned Indel molecular marker in identifying eggplant single-flower single-fruit varieties / eggplant breeding.

[0006] Preferably, the substance contains PCR primers for amplifying the Indel molecular marker.

[0007] More preferably, the PCR primer is a primer pair consisting of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the eggplant genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the eggplant genomic DNA.

[0008] More preferably, the PCR primers for amplifying the Indel molecular marker 1 are shown as SEQ ID NO.1-2; and the PCR primers for amplifying the Indel molecular marker 2 are shown as SEQ ID NO.4-5.

[0009] The third object of the present invention is to provide a method for identifying or assisting in identifying eggplant single-flower single-fruit varieties, the method comprising the following steps:

[0010] The gene type of Indel molecular marker 1 or Indel molecular marker 2 in the genomic DNA of the eggplant to be identified is detected, the nucleotide sequence of the Indel molecular marker 1 is shown in SEQ ID NO.3, wherein the 49th to 51st positions of SEQ ID NO.3 are insertion or deletion variations, and the eggplant containing the insertion sequence of the 49th to 51st positions of SEQ ID NO.3 is a single-flower single-fruit variety; the nucleotide sequence of the Indel molecular marker 2 is shown in SEQ ID NO.6, wherein the 75th to 78th positions of SEQ ID NO.6 are insertion or deletion variations, and the eggplant containing the insertion sequence of the 75th to 78th positions of SEQ ID NO.6 is a single-flower single-fruit variety.

[0011] A fourth object of the present invention is to provide a method for identifying or assisting in identifying eggplant single-flower single-fruit varieties, the method comprising the following steps:

[0012] (1) using the eggplant genomic DNA to be identified as a template, performing PCR amplification using the above primer pair to obtain a PCR product;

[0013] (2) identifying whether the eggplant is a single-flower-single-fruit variety based on the gene type of the InDel molecular marker contained in the PCR product;

[0014] The 49th to 51st positions of the Indel molecular marker 1 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 49th to 51th is a single-flower single-fruit variety; the 75th to 78th positions of the Indel molecular marker 2 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 75th to 78th is a single-flower single-fruit variety.

[0015] Preferably, in step (1), the system for PCR amplification of SEQ ID NO.1-2 or SEQ ID NO.4-5 using primers is as follows:

[0016]

[0017] More preferably, the procedure for PCR amplification of SEQ ID NO.1-2 or SEQ ID NO.4-5 using primers in step (1) is as follows:

[0018]

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention analyzes the polymorphic sites of the whole genome of single-flower single-fruit eggplant and multi-flower multi-fruit eggplant by a new generation of high-throughput sequencing technology for the first time, screens out the target interval where the trait is located, and obtains two molecular markers P1144B084 and P1144B087 that can effectively identify single-flower single-fruit eggplant by screening Indel molecular markers. In conventional breeding methods, the phenotypic identification of the number of eggplant flowering and fruiting must wait until flowering and fruiting, which is time-consuming, labor-intensive and inefficient. By detecting the tightly linked genes of the single-flower single-fruit trait of eggplant, it can be eliminated in the seedling stage, which not only saves production costs, but also greatly improves the selection efficiency. In the present invention, the detection of the tightly linked Indel molecular markers of single-flower single-fruit of eggplant is convenient and fast, and the results are stable and not affected by the environment. Through PCR amplification, PCR product enzyme digestion and electrophoresis detection and analysis, the number of eggplant flowering can be predicted, and then the single-flower single-fruit eggplant individual plant can be accurately and quickly screened. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the extreme individual plant phenotype of the eggplant single inflorescence F2 segregating population in Example 1.

[0022] Figure 2 The results of screening molecular markers for 36 eggplants in Example 5, where M1 represents multiple flowers and S1 represents single flower. DETAILED DESCRIPTION

[0023] Example 1 Construction of single-flower-single-fruit genetic population of eggplant and DNA extraction

[0024] (1) Screen parents with extreme phenotypes, determine genetic dominance and recessiveness, and construct segregating populations.

[0025] In order to study the single-flower-single-fruit phenotype of eggplant, the parental material with this trait (WHS19 green-calyx stick eggplant, single flower and single fruit) with stable inheritance was screened, and the stable inheritance of multiple-flower and multiple-fruit materials were screened as control parents (WHS1 black stick, multiple flowers and multiple fruits) to determine its genetic characteristics. First, the forward and reverse hybridization experiments were carried out to determine the dominant and recessive relationship of the trait. The study found that compared with the single inflorescence of eggplant, multiple inflorescences were dominant. The F1 generation was obtained by hybridization with WHS19 as the male parent and WHS1 as the female parent. At the same time, the F1 self-pollination obtained the extreme segregation population F2, and the trait was determined to be quality shape. There were 48 and 152 single-flower and multiple-flower and multiple-fruit plants in the F2 segregation population, respectively. Conventional cultivation management, the eggplants of the two parents and the genetic population were identified after flowering and fruiting, which was in line with the 3:1 Mendel single gene control theory, and then BSA sequencing was performed through the parent and F2 extreme segregation material pool. According to the separation performance of the number of flowers and fruits of the parents and F2 population of the tested materials, there are mainly single flower and single fruit, multiple flowers and multiple fruits, and heterozygous types with intermediate numbers. For eggplant pairs that meet the characteristics of the strain and develop normally, take photos of the number of eggplant flowers and fruits on a dark background board.

[0026] (2) DNA extraction

[0027] DNA was extracted from 10 mixed samples of the parent single-flower and single-fruit eggplant WHS19 and the multi-flower and multi-fruit eggplant WHS1 respectively; 30 single-flower and single-fruit plants were randomly selected from the F2 generation to form the single-flower and single-fruit mixed pool SF2, and 30 multi-flower and multi-fruit eggplants were randomly selected from the F2 generation to form the multi-flower and multi-fruit eggplant progeny mixed pool MF2; a total of 4 sample pools.

[0028] The total DNA of the leaves of the above four sample pools was extracted using the CTAB method. The specific steps are as follows: 0.1 g of fresh cotyledons were taken, ground with liquid nitrogen or crushed with steel beads, lysed with 2×CTAB lysate, extracted with chloroform, precipitated with isopropanol, and washed with 70% ethanol. The final DNA precipitate was dissolved in 20 μL TE solution. The DNA concentration was measured with a UV spectrophotometer and stored in a -20°C refrigerator for later use.

[0029] Example 2 High-throughput sequencing to find the associated region of single-flower single-fruit eggplant

[0030] (1) High-throughput sequencing: screening of single-flower-single-fruit related SNPs: The HiSeq2500 sequencing platform was used to perform high-throughput sequencing on the extracted eggplant parents WHS1 and WHS19, as well as the eggplant single-flower-single-fruit mixed pool SF2 and the eggplant multi-flower-multi-fruit mixed pool MF2.

[0031] (2) Processing of raw sequencing sequences: The raw image data files obtained by high-throughput sequencing are converted into raw sequencing sequences (raw data) through base calling analysis. Then, the raw sequencing sequences obtained by sequencing are filtered according to certain rules. The main criteria are: 1) Remove reads with adapters; 2) When the proportion of N in the single-end sequencing read is greater than 10%, this pair of reads needs to be removed; 3) When the number of low-quality (less than 5) bases in the single-end sequencing read exceeds 50% of the length of the read, this pair of reads needs to be removed. The sequences obtained after filtering are clean reads.

[0032] (3) SNP site detection: The clean reads obtained after filtering were aligned to the reference genome (version: Eggplant genome consortiumV4.1 https: / / solgenomics.net / ftp / genomes / Solanum_melongena_V4.1 / ), and the four samples (WHS1, WHS19, SF2 and MF2) were tested for SNP using GATK software, and then the position information and type of the SNP sites detected in the four samples were annotated using ANNOVAR software. Similarly, the InDels of the four samples were detected using GATK software, and the position information and type of the InDel sites detected in the four samples were annotated using ANNOVAR software.

[0033] (4) Localization of target trait region: First, filter the SNP sites detected in the mixed pool samples SF2 and MF2: 1) remove sites with read support number less than 5 in any mixed pool; 2) filter sites with heterozygous parental SNP type. In this way, high-quality reliable SNP sites are obtained, and then the QTL-seq method is used to associate the target trait with the relevant region of the genome based on the sites with significant differences in SNP-index between the two mixed pool samples. The calculation method of SNP-index is: the signature of reads supporting the mutant base at a certain site on the genome / the total number of reads at the site, and then calculate the SNP sites with differences between the two mixed pools. The difference in SNP sites can be measured by Δ(SNP-index), and the calculation method is: Δ(SNP-index) = SNP-index(SF2)-SNP-index(MF2).

[0034] (5) Determination of the target trait association region: The latest reference genome of eggplant was used for analysis, and the candidate intervals were calculated using SNP molecular markers and Indel molecular markers respectively. Then, the two molecular markers were used for joint analysis to determine that the target trait association region was between 5.25 Mb at 92,950,000 and 98,200,000 on chromosome 1.

[0035] Example 3 Design and synthesis of polymorphic primers

[0036] The target trait association region obtained by high-throughput sequencing is 5.25Mb between 92,950,000 and 98,200,000 on chromosome 1. Then 120 Indel molecular markers were set in this interval according to the differences. The DNA of the two parents was amplified by PCR, and the amplified products were detected by SDS-PAGE gel. The band size was judged and the morphological molecular markers were screened. The primer sequences were synthesized by Beijing Oak Biotechnology Co., Ltd.

[0037] Example 4 Screening and Detection Methods for Indel Molecular Marker Primers

[0038] (1) Randomly select 10 DNAs from each parent and mix them in equal amounts to serve as templates for screening primers. After the primers are dissolved, PCR amplification is performed on the parent DNA. The reaction system is:

[0039] Table 1

[0040]

[0041] Among them, 2×PCR Mix is ​​a product of Novozymes.

[0042] (2) The PCR amplification procedure is:

[0043] Table 2

[0044]

[0045] (3) Polyacrylamide gel electrophoresis, imaging and analysis:

[0046] First add about 100ml PAGE gel (two plates) to the beaker, then add 360ul 10% AP and 36ul TEMED and mix quickly, then inject the mixture into the gel tank, try to avoid bubbles during the gel filling process; insert the spotting comb, about 3mm deep; let it stand for about 10-20min and the gel will solidify. After the gel solidifies, remove the clamp, wash the surface, and clamp it on the electrophoresis tank; add 0.5×TBE to the upper and lower layers of the electrophoresis tank until all the spotting holes and electrode wires or the lower end of the glass are submerged; slowly pull out the comb, spot according to the rules, the rise volume is 0.8-1.5ul, and keep a record; start electrophoresis, single electrophoresis tank parameters: 300V, 200mA, 60W, 30min. After the electrophoresis is completed, slowly pry open the glass plate, take out the gel, rinse with distilled water, transfer to 0.01% nucleic acid dye for 10-20min; photograph the gel on the gel imager, and take a photo to save.

[0047] (4) Primer polymorphism identification: First, the DNA of the parents WHS1 and WHS19 was used as templates for PCR amplification. All 120 pairs of primers synthesized were able to amplify bands. Then, electrophoresis was performed and it was found that the enzyme digestion products of the amplified fragments of 15 pairs of primers showed polymorphism.

[0048] (5) Determination of Indel molecular markers for single flower and single fruit in eggplant: The population parents single flower WHS19 and multi-flower WHS1 were used as materials to further verify the 15 pairs of primers showing polymorphism to determine whether the amplified products are related to the single flower and single fruit trait of eggplant. It was finally found that the polymorphism of the enzyme digestion products of the amplified fragments of primers P1144B084 and P1144B087 was well linked to the single flower and single fruit of eggplant. The primer sequences were F (SEQ ID NO.1): AGATGTAGTAGAGGTAAAAATGAT and R (SEQ ID NO.2): ATAAAACATGTGTGTTACACGGGC, and the length of the amplified fragment was 105 bp (SEQ ID NO.3: AGATGTAGTAGAGGTAAAAATGATAATTCAAGTCTTTTTTACTGTTGA ATT TTTTTTTTTA AAAAAAAAAAACACTCACGCGCCCGTGTAACACACATGTTTTAT), the amplified product of single flower and single fruit has 3 more bases (ATT) than that of multiple flower and multiple fruit phenotype materials; another marker is P1144B087, the sequence is F (SEQ ID NO.4): TGCAAAATAAGCAGCCCAACATAA, R (SEQ ID NO.5): TGAATCATTCTCAGAGACCTCCAT, the amplified fragment length is 119bp (SEQ ID NO.6: TGCAAAATAAGCAGCCCAACATAAATCTTTTTTTCCCGAGGGGATAGTTGTGGATGATAT GTTTTTTATTTTAA CAAG AAGGAAGTTCTTAATTAATGGAGGTCTCTGAGAATGATTCA), the amplification products of single-flower-single-fruit and multiple-flower-multiple-fruit phenotype materials have 4 more bases (CAAG). Therefore, P1144B084 and P1144B087 were finally determined to be molecular markers related to single-flower-single-fruit in eggplant.

[0049] Example 5 Applicability Identification of Indel Markers P1144B084 and P1144B087 in Identifying Single Flower and Single Fruit in Eggplant

[0050] A total of 36 eggplant materials with different numbers of eggplant flowers and fruits were selected. These materials were all variety resources collected by the laboratory from different places. These materials have different local sources from the parent materials in the present invention. These materials can be used as test materials to test whether the primers are generally applicable. The Indel molecular marker of the present invention was verified. The genomic DNA of the above-mentioned eggplant leaves was extracted using the CTAB method. The primers corresponding to the P1144B084 and P1144B087 Indel molecular markers were used for PCR amplification, and the fragment size was identified by SDS-PAGE electrophoresis (see Example 4 for the experimental process). The results are shown in Figure 2 As shown in Table 3, the results showed that the molecular marker P1144B084 could detect single flower and single fruit with an accuracy of 88%, and the molecular marker P1144B087 could detect single flower and single fruit with an accuracy of 97%.

[0051] Table 3 Eggplant materials with different numbers of eggplant flowers and fruits

[0052] Serial number serial number Types of Eggplant Number of inflorescences Serial number serial number Types of Eggplant Number of inflorescences 1 WHS1 Black Stick Multi-flower 19 WHS19 Solanum oleiferum Single flower 2 WHS2 Solanum oleiferum Multi-flower 20 WHS20 Solanum oleiferum Single flower 3 WHS3 Black Stick Multi-flower 21 WHS21 Solanum oleiferum Single flower 4 WHS4 Black Line Multi-flower 22 WHS22 Solanum oleiferum Single flower 5 WHS5 Solanum oleiferum Multi-flower 23 WHS23 Black Line Single flower 6 WHS6 Red tomato Multi-flower 24 WHS24 Solanum oleiferum Single flower 7 WHS7 Solanum oleiferum Multi-flower 25 WHS25 Solanum oleiferum Single flower 8 WHS8 Bamboo Eggplant Multi-flower 26 WHS26 Solanum oleiferum Single flower 9 WHS9 Black Stick Multi-flower 27 WHS27 Solanum oleiferum Single flower 10 WHS10 Black Stick Multi-flower 28 WHS28 Black Line Single flower 11 WHS11 Black Line Multi-flower 29 WHS29 Solanum oleiferum Single flower 12 WHS12 Black Line Multi-flower 30 WHS30 Solanum oleiferum Single flower 13 WHS13 Black Stick Multi-flower 31 WHS31 Solanum oleiferum Single flower 14 WHS14 Red Line Multi-flower 32 WHS32 Solanum oleiferum Single flower 15 WHS15 Red Line Multi-flower 33 WHS33 Solanum oleiferum Single flower 16 WHS16 Black Line Multi-flower 34 WHS34 Solanum oleiferum Single flower 17 WHS17 Solanum oleiferum Multi-flower 35 WHS35 Solanum oleiferum Single flower 18 WHS18 Red tomato Multi-flower 36 WHS36 Solanum oleiferum Single flower

[0053] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An Indel molecular marker tightly linked to a gene for the single flower and single fruit trait of eggplant, characterized in that: The Indel molecular marker is Indel molecular marker 1 or Indel molecular marker 2; the nucleotide sequence of the Indel molecular marker 1 is shown in SEQ ID NO.3, wherein positions 49-51 of SEQ ID NO.3 are insertion or deletion variations, and the eggplant containing the insertion sequence of positions 49-51 of SEQ ID NO.3 is a single-flower single-fruit variety; the nucleotide sequence of the Indel molecular marker 2 is shown in SEQ ID NO.6, wherein positions 75-78 of SEQ ID NO.6 are insertion or deletion variations, and the eggplant containing the insertion sequence of positions 75-78 of SEQ ID NO.6 is a single-flower single-fruit variety.

2. Use of PCR primers for detecting the Indel molecular marker according to claim 1 in identifying eggplant single-flower-single-fruit varieties or breeding related to eggplant single-flower-single-fruit traits.

3. The use according to claim 2, characterized in that: The PCR primers are a primer pair, which consists of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the eggplant genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the eggplant genomic DNA.

4. The use according to claim 3, characterized in that: The PCR primers for amplifying the Indel molecular marker 1 are shown as SEQ ID NO.1-2; the PCR primers for amplifying the Indel molecular marker 2 are shown as SEQ ID NO.4-5.

5. A method for identifying or assisting in identifying eggplant single-flower single-fruit varieties, characterized in that: The method comprises the following steps: The gene type of Indel molecular marker 1 or Indel molecular marker 2 in the genomic DNA of the eggplant to be identified is detected, the nucleotide sequence of the Indel molecular marker 1 is shown in SEQ ID NO.3, wherein the 49th to 51st positions of SEQ ID NO.3 are insertion or deletion variations, and the eggplant containing the insertion sequence of the 49th to 51st positions of SEQ ID NO.3 is a single-flower single-fruit variety; the nucleotide sequence of the Indel molecular marker 2 is shown in SEQ ID NO.6, wherein the 75th to 78th positions of SEQ ID NO.6 are insertion or deletion variations, and the eggplant containing the insertion sequence of the 75th to 78th positions of SEQ ID NO.6 is a single-flower single-fruit variety.

6. A method for identifying or assisting in identifying eggplant single-flower single-fruit varieties, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the eggplant to be identified as a template, and performing PCR amplification using the primer pair described in claim 3 or 4 to obtain a PCR product; (2) identifying whether the eggplant is a single-flower-single-fruit variety based on the gene type of the InDel molecular marker contained in the PCR product according to claim 1; The 49th to 51st positions of the Indel molecular marker 1 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 49th to 51th is a single-flower single-fruit variety; the 75th to 78th positions of the Indel molecular marker 2 are insertion or deletion variations, and the eggplant containing the insertion sequence at positions 75th to 78th is a single-flower single-fruit variety.

7. The method according to claim 6, characterized in that The system for performing PCR amplification using the primer pair described in claim 4 in step (1) is as follows:

8. The method according to claim 7, characterized in that The procedure for PCR amplification using the primer pair described in claim 4 in step (1) is as follows: 。

Images