A Ganoderma lucidum strain L4966 with a bright cap, its cultivation method and application

Abstract

The present invention relates to a Ganoderma lucidum strain L4966 and its cultivation method and application, belonging to the technical field of microbiology. The Ganoderma lucidum strain L4966 ( Ganoderma sp.) was deposited at the Guangdong Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097. The Ganoderma lucidum strain L4966 of the present invention has thick mycelia, fast mycelial growth, less contamination, and strong anti-contamination ability; the fruiting body is yellowish-brown and has stable traits; the mushroom shape is small, with many branches, the fruiting body has a thin texture and is light brownish-brown; it has a strong mushroom fragrance, a high polysaccharide content, rich nutrients, and more unique agronomic traits compared with the control. It resembles Ganoderma lucidum in the shape of antlers, has high application value for developing potted Ganoderma lucidum and ornamental Ganoderma lucidum, has good ornamental value, and has a good market prospect.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a Ganoderma lucidum strain L4966, its cultivation method and application. Background Art

[0002] Ganoderma spp. belongs to the kingdom Fungi, phylum Basidiomycota, class Agaricomycetes, order Polyporales, family Ganodermataceae, genus Ganoderma Ganoderma ). Broadly defined, Ganoderma includes many species of the genus Ganoderma, such as: Ganoderma lucidum Ganoderma lingzhi ), Ganoderma sinense Ganoderma sinense ), Ganoderma tsugae Ganoderma tsugae ), Ganoderma lucidum Genoderma lucidum ), etc. Narrowly defined, Ganoderma specifically refers to the species with medicinal value and widely cultivated. Ganoderma has been used to promote health, extend lifespan, and prevent diseases for thousands of years. Its shape is like an umbrella, the cap is woody and corky, and is generally kidney-shaped, semi-circular or nearly circular.

[0003] In the actual production process, the quality of the strains varies, resulting in the frequent occurrence of the phenomenon that mushrooms cannot grow normally after cultivation, and the yield of the fruiting bodies is not stable enough. In recent years, there have been many studies on Ganoderma in Yunnan, and the cultivation technology has gradually matured. However, the introduction of mature Ganoderma varieties and technologies from other provinces for cultivation in Yunnan with diverse and stereoscopic climates has unstable adaptability, yield, and biological conversion rate, which has hindered the large-scale promotion of Ganoderma cultivation using substitute materials. At present, there is only one identified Ganoderma lucidum variety, Yunling No. 2 [Dianjian (Edible Fungi) 2023041] in Yunnan Province, and its current agronomic traits are excellent, but there has been no reported Ganoderma variety that can be used for ornamental purposes. By further enriching the Ganoderma varieties, the Ganoderma industry will have a huge market prospect.

[0004] Therefore, how to overcome the deficiencies of the existing technology is an urgent problem to be solved in the field of microbial technology at present. Summary of the Invention

[0005] The purpose of the present invention is to solve the deficiencies of the existing technology and provide a Ganoderma lucidum strain L4966, its cultivation method and application.

[0006] To achieve the above purpose, the technical scheme adopted by the present invention is as follows:

[0007] In the first aspect of the present invention, a Ganoderma lucidum strain L4966 is provided, and the Ganoderma lucidum strain L4966 ( Ganoderma sp.) was deposited at the Guangdong Provincial Culture Collection of Microorganisms on September 4, 2024, with the deposit number GDMCC No: 65097.

[0008] The second aspect of the present invention provides a cultivation method for the above-mentioned Ganoderma lucidum strain L4966 with a bright cap, comprising the following steps:

[0009] Step A, mother spawn propagation: Under sterile conditions, inoculate the Ganoderma lucidum strain L4966 with a bright cap onto a mother spawn PDA medium, and place it in a constant temperature incubator at 22 °C for 7 - 10 d to obtain mycelial blocks;

[0010] The mother spawn PDA medium comprises the following raw materials by weight parts: 200 parts of potato, 19 - 21 parts of glucose, 19 - 21 parts of agar powder, and 990 - 1010 parts of water;

[0011] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into a sterilized shake flask seed medium, and culture it on a shaker at 21.5 - 22.5 °C for 7 - 10 d to obtain a seed liquid;

[0012] Among them, the shake flask seed medium comprises the following raw materials by weight parts: 200 parts of potato, 19 - 21 parts of glucose, 1.9 - 2.1 parts of peptone, 0.39 - 0.41 parts of potassium dihydrogen phosphate, 0.19 - 0.21 parts of ferric trichloride, 990 - 1010 parts of water, and the pH is 6.3 - 6.7;

[0013] Step C, liquid fermentation tank fermentation culture: Inoculate the seed liquid obtained in Step B into a fermentation broth medium, and culture it at 21.5 - 22.5 °C for 8 - 11 d to obtain a liquid spawn;

[0014] Among them, the fermentation broth medium comprises the following raw materials by weight parts: 600 parts of soluble starch, 2350 - 2450 parts of glucose, 190 - 210 parts of peptone, 115 - 125 parts of potassium dihydrogen phosphate, 59 - 61 parts of ferric trichloride, 99000 - 101000 parts of water, and the pH value is 6.3 - 6.7;

[0015] Step D, cultivation spawn preparation: Inoculate the liquid spawn cultured in Step C into a cultivation bag, and place it in a constant temperature incubator at 24 °C for 33 - 38 d;

[0016] The cultivation substrate in the cultivation bag comprises the following raw materials by weight parts: 75 - 77 parts of miscellaneous sawdust, 1.8 - 2.2 parts of cottonseed hulls, 17 - 19 parts of wheat bran, 1.9 - 2.1 parts of soybean cake powder, 0.9 - 1.1 parts of gypsum powder, 0.9 - 1.1 parts of lime powder; the pH value is 6 - 8, and the water content is 55 - 65%;

[0017] Step E, soil covering cultivation and harvesting: After the mycelium in the cultivation bag is fully grown, it is transported to the cultivation base, stacked on the ground in the shaded greenhouse for further ripening for 5 - 7 days, and then the bags are opened with small holes and planted horizontally with soil covering. The light intensity is adjusted through the shading net. The light intensity is controlled at 500 - 800 Lux during the mycelial bud stage and the stipe differentiation stage. When the stipe grows to 10 - 15 cm and enters the pileus differentiation stage, the light intensity is controlled at 1800 - 2200 Lux; maintain the soil humidity at 20 - 30%, the air humidity at 70 - 90%, the temperature at 18 - 28 °C, and the CO 2 concentration is less than 0.06%; when the light yellow growth ring at the edge of the pileus disappears and spore ejection occurs, the fruiting bodies can be harvested.

[0018] Furthermore, in step E, the cultivation base is a greenhouse, and 5000 - 6000 bags are planted per mu of the greenhouse.

[0019] Furthermore, in step E, the stacking height does not exceed 3 layers.

[0020] Furthermore, in step E, if the bright - cap Ganoderma lucidum strain L4966 is planted as a bonsai of ornamental Ganoderma lucidum, when using potted plants, 1 - 5 fungus rods can be planted in each pot.

[0021] Furthermore, in step E, after 95 - 97 days of planting with soil covering, harvesting can be carried out.

[0022] The third aspect of the present invention provides the application of the mycelium, fermentation broth or fruiting bodies of the above - mentioned bright - cap Ganoderma lucidum strain L4966 in the preparation of anti - tumor drugs or sedative and sleep - promoting drugs.

[0023] The bright - cap Ganoderma lucidum strain L4966 of the present invention contains relatively high contents of Ganoderma polysaccharides and Ganoderma triterpenoids. Using the detection methods for Ganoderma polysaccharide determination and Ganoderma triterpenoid determination (calculated as oleanolic acid) on page 196 of Ganoderma lucidum in the first part of the Chinese Pharmacopoeia 2020 edition, the polysaccharide content of the wild bright - cap Ganoderma lucidum strain L4966 is 1.48%, and the triterpenoid content is 2.57%. The polysaccharide and triterpenoid contents of the cultivated bright - cap Ganoderma lucidum strain L4966 have been significantly improved. Its polysaccharide content is 1.68%, and the triterpenoid content is 2.84%. Ganoderma polysaccharides have a wide range of pharmacological activities, such as reducing blood sugar, reducing blood lipids, anti - thrombosis, antioxidant, scavenging free radicals, anti - aging, anti - radiation, anti - tumor, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human umbilical cord blood LAK cells. Ganoderma triterpenoids have anti - inflammatory, analgesic, sedative, anti - aging, tumor cell poisoning, anti - hypoxia and other effects.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] (1) For the bright - cap Ganoderma lucidum strain L4966 of the present invention, the mycelium is thick, the mycelium growth is fast, the pollution is less, and the anti - contamination ability is strong;

[0026] (2)The fruiting bodies of the Ganoderma lucidum strain L4966 of the present invention are yellowish-brown in color and have stable characteristics. The mushroom shape is fan-shaped, semi-circular or circular, with many branches. Each strain has 5 - 12 branches. During the stipe differentiation period, it resembles Ganoderma lucidum carnosum, with a slender stipe that is reddish-brown. The surface of the cap is reddish-brown, with a thin texture, and the flesh is light brownish-brown. At maturity, it resembles a cluster of flowers, with strong ornamental value, having high application value for developing potted Ganoderma lucidum and ornamental Ganoderma lucidum, and a good market prospect;

[0027] (3)The Ganoderma lucidum strain L4966 of the present invention has a strong mushroom fragrance, a high polysaccharide content, rich nutrients, and the fruiting bodies have a wide range of uses. Moreover, compared with the control, it has a longer growth period, which means a longer ornamental period as an ornamental Ganoderma lucidum.

[0028] The average growth cycle of the Ganoderma lucidum strain L4966 of the present invention is 96 days, while most other Ganoderma lucidum strains are 60 - 85 days. It grows slowly and matures relatively slowly, so the ornamental period as an ornamental Ganoderma lucidum is relatively long. Secondly, during the stipe differentiation period of the Ganoderma lucidum strain L4966 of the present invention, it resembles Ganoderma lucidum carnosum, and many Ganoderma lucidum carnosum can be used for ornamental purposes. During the cap differentiation period and maturity period, it resembles a cluster of flowers, with a unique and beautiful shape, significantly different from other Ganoderma lucidum (see Figure 12 ). Description of the Drawings

[0029] Figure 1 Phylogenetic tree of multiple genes of Ganoderma lucidum strain L4966 based on ITS + nrLSU + TEF1 -α + RPB 2 sequences;

[0030] Figure 2 Results of the antagonism test;

[0031] Figure 3 Polyacrylamide gel diagram of SSR molecular markers of Ganoderma lucidum strain L4966;

[0032] Figure 4 Morphological identification pictures of Ganoderma lucidum strain L4966; among them, a - c: fruiting bodies; d: pore surface; e: cap section; f: cap cortex; g: flesh skeletal hyphae; h: connecting hyphae; i: stipe cortex cells; j: stipe skeletal hyphae; k - n: basidiospores; scale bar: f - j is 20 mm; k - n is 10 µm;

[0033] Figure 5 Results diagram of multi-point demonstration cultivation of Ganoderma lucidum strain L4966; among them, A is the demonstration cultivation diagram in Songming County, Kunming City, with an altitude of 1853 m; B is the demonstration cultivation diagram in Panlong District, Kunming City, with an altitude of 2048 m; C is the demonstration cultivation diagram in Wuding County, Chuxiong Prefecture, with an altitude of 2376 m; D is the demonstration cultivation diagram in Xundian County, Kunming City, with an altitude of 2165 m;

[0034] Figure 6 It is a figure showing the antagonistic culture results of Ganoderma lucidum and Aspergillus fumigatus. Among them, (a) shows the antagonistic results of Ganoderma lucidum strain L4966 and Aspergillus fumigatus, and (b) shows the antagonistic results of Ganoderma lucidum strain L4914 and Aspergillus fumigatus;

[0035] Figure 7 It is a figure showing the influence of carbon source on the mycelial growth rate;

[0036] Figure 8 It is a figure showing the influence of nitrogen source on the mycelial growth rate;

[0037] Figure 9 It is a figure showing the influence of inorganic salts on the mycelial growth rate;

[0038] Figure 10 It is a figure showing the influence of temperature on the mycelial growth rate;

[0039] Figure 11 It is a figure showing the influence of pH on the mycelial growth rate;

[0040] Figure 12 It is a picture of different growth stages of Ganoderma lucidum L4966. Among them, A is the stipe stage, BC is the pileus differentiation stage, and D is the stage of shooting spore powder.

[0041] Figures 7 - 11 Among them, different lowercase letters indicate significant differences between the two (P < 0.05), and the same lowercase letters indicate no significant differences between the two (P > 0.05).

[0042] The Ganoderma lucidum strain L4966 of the present invention ( Ganoderma sp.) was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097. The deposit address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. Detailed implementation manners

[0043] The present invention will be further described in detail below in conjunction with the embodiments.

[0044] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For those materials or equipment not specified in terms of the manufacturer, they are all conventional products that can be obtained by purchase.

[0045] Example 1

[0046] A Ganoderma lucidum strain L4966, the Ganoderma lucidum strain L4966 (Ganoderma sp. was deposited at the Guangdong Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097.

[0047] The cultivation method of Ganoderma lucidum strain L4966 in this example includes the following steps:

[0048] Step A, mother spawn propagation: Under aseptic conditions, inoculate Ganoderma lucidum strain L4966 onto the mother spawn PDA medium and incubate it at a constant temperature of 22 °C for 8 d to obtain mycelium blocks.

[0049] The mother spawn PDA medium includes the following raw materials by weight: 200 parts of potato, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water.

[0050] Step B, liquid shake flask culture: Inoculate the mycelium blocks cultured in Step A into the sterilized shake flask seed medium and culture them on a shaker at 22 °C for 8 d to obtain the seed liquid.

[0051] Among them, the shake flask seed medium includes the following raw materials by weight: 200 parts of potato, 20 parts of glucose, 2 parts of peptone, 0.4 part of potassium dihydrogen phosphate, 0.2 part of ferric trichloride, 1000 parts of water, and the pH is 6.5.

[0052] Step C, liquid fermentation tank fermentation culture: Inoculate the seed liquid obtained in Step B into the fermentation broth medium and culture it at 22 °C for 10 d to obtain the liquid spawn.

[0053] Among them, the fermentation broth medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 60 parts of ferric trichloride, 100000 parts of water, and the pH value is 6.5.

[0054] Step D, preparation of cultivation spawn: Inoculate the liquid spawn cultured in Step C into the cultivation bag and incubate it at a constant temperature of 24 °C in the cultivation room for 35 d.

[0055] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 76 parts of miscellaneous sawdust, 2 parts of cottonseed hulls, 18 parts of wheat bran, 2 parts of soybean cake powder, 1 part of gypsum powder, 1 part of lime powder; pH value 7, water content 60%.

[0056] Step E, soil covering cultivation and harvesting: After the mycelium in the cultivation bag is fully grown, it is transported to the cultivation base and stacked on the ground in the shaded greenhouse for further ripening for 6 days. Then, the bags are opened with small holes and planted horizontally with soil covering. The light intensity is adjusted through the shading net. The light intensity is controlled at 500 - 800 Lux during the primordium stage and the stipe differentiation stage. When the stipe grows to 11 - 14 cm and enters the pileus differentiation stage, the light intensity is controlled at 1800 - 2200 Lux; maintain the soil humidity at 20 - 30%, the air humidity at 70 - 90%, the temperature at 20 - 25 °C, and the CO 2 concentration is less than 0.06%; when the pale yellow growth ring at the edge of the pileus disappears and spore ejection occurs, the fruiting bodies can be harvested.

[0057] Example 2

[0058] A Ganoderma lucidum strain L4966 with a bright pileus, the Ganoderma lucidum strain L4966 ( Ganoderma sp.) was deposited at the Guangdong Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097.

[0059] The cultivation method of the Ganoderma lucidum strain L4966 in this example includes the following steps:

[0060] Step A, mother spawn propagation: Under sterile conditions, inoculate the Ganoderma lucidum strain L4966 onto the mother spawn PDA medium and incubate it at a constant temperature of 22 °C for 7 days to obtain mycelium blocks;

[0061] The mother spawn PDA medium includes the following raw materials by weight: 200 parts of potato, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water;

[0062] Step B, liquid shake flask culture: Inoculate the mycelium blocks cultured in Step A into the sterilized shake flask seed medium and culture them on a shaker at 21.5 °C for 7 days to obtain the seed liquid;

[0063] Among them, the shake flask seed medium includes the following raw materials by weight: 200 parts of potato, 19 parts of glucose, 1.9 parts of peptone, 0.39 parts of potassium dihydrogen phosphate, 0.19 parts of ferric trichloride, and 990 parts of water, with a pH of 6.3;

[0064] Step C, liquid fermentation tank fermentation culture: Inoculate the seed liquid obtained in Step B into the fermentation broth medium and culture it at 21.5 °C for 8 days to obtain the liquid spawn;

[0065] Among them, the fermentation broth medium includes the following raw materials by weight: 600 parts of soluble starch, 2350 parts of glucose, 190 parts of peptone, 115 parts of potassium dihydrogen phosphate, 59 parts of ferric trichloride, and 99000 parts of water, with a pH value of 6.3;

[0066] Step D, Cultivated spawn preparation: Inoculate the liquid spawn cultured in Step C into the cultivation bags and place them in a constant temperature cultivation room at 24 °C for 33 days of cultivation.

[0067] The cultivation substrate in the cultivation bags includes the following raw materials by weight: 7 parts of miscellaneous sawdust, 1.8 parts of cottonseed hulls, 17 parts of wheat bran, 1.9 parts of soybean cake powder, 0.9 part of gypsum powder, 0.9 part of lime powder; pH value is 6, and the water content is 55%.

[0068] Step E, Soil covering cultivation and harvesting: After the mycelium in the cultivation bags is fully grown, transport them to the cultivation base, stack them on the ground in a shaded greenhouse for 5 days of after-ripening, then make small holes in the bags, open the bags horizontally, cover them with soil for planting, adjust the light intensity through a shading net. The light intensity during the mushroom bud stage and the stipe differentiation stage is controlled at 500 - 800 Lux. When the stipe grows to 10 - 12 cm and enters the cap differentiation stage, the light intensity is controlled at 1800 - 2200 Lux; maintain the soil humidity at 20 - 30%, the air humidity at 70 - 90%, the temperature at 18 - 23 °C, and the CO 2 concentration is less than 0.06%; When the light yellow growth ring at the edge of the mushroom cap disappears and there is spore ejection, which is 97 days after planting with soil covering, the fruiting bodies can be harvested.

[0069] In Step E, the cultivation base is a greenhouse, and 5000 bags are planted per mu of the greenhouse.

[0070] In Step E, the stacking height does not exceed 3 layers.

[0071] In Step E, if the Ganoderma lucidum strain L4966 is planted as a bonsai of ornamental Ganoderma lucidum and is planted in a pot, 1 mushroom stick can be planted in each pot.

[0072] Example 3

[0073] A Ganoderma lucidum strain L4966, the Ganoderma lucidum strain L4966 ( Ganoderma sp.) was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097.

[0074] The cultivation method of the Ganoderma lucidum strain L4966 in this example includes the following steps:

[0075] Step A, Mother spawn propagation: Under sterile conditions, inoculate the Ganoderma lucidum strain L4966 onto the mother spawn PDA medium and place it in a constant temperature cultivation at 22 °C for 10 days to obtain mycelium blocks.

[0076] The mother spawn PDA medium includes the following raw materials by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water.

[0077] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into the sterilized shake flask seed medium, and culture them on a shaker at 22.5 °C for 10 days to obtain the seed liquid;

[0078] Among them, the shake flask seed medium includes the following raw materials by weight: 200 parts of potato, 21 parts of glucose, 2.1 parts of peptone, 0.41 parts of potassium dihydrogen phosphate, 0.21 parts of ferric trichloride, 1010 parts of water, and the pH is 6.7;

[0079] Step C, liquid fermentation tank fermentation culture: Inoculate the seed liquid obtained in Step B into the fermentation broth medium, and culture it at 22.5 °C for 11 days to obtain the liquid strain;

[0080] Among them, the fermentation broth medium includes the following raw materials by weight: 600 parts of soluble starch, 2450 parts of glucose, 210 parts of peptone, 125 parts of potassium dihydrogen phosphate, 61 parts of ferric trichloride, 101000 parts of water, and the pH value is 6.7;

[0081] Step D, preparation of cultivated species: Inoculate the liquid strain cultured in Step C into the cultivation bags and place them in a constant temperature cultivation room at 24 °C for 38 days;

[0082] The cultivation substrate in the said cultivation bags includes the following raw materials by weight: 77 parts of miscellaneous wood chips, 2.2 parts of cottonseed hulls, 19 parts of wheat bran, 2.1 parts of soybean cake powder, 1.1 parts of gypsum powder, 1.1 parts of lime powder; the pH value is 8, and the water content is 65%;

[0083] Step E, soil covering cultivation and harvesting: After the mycelia in the cultivation bags are fully grown, transport them to the cultivation base, stack them on the ground in the shaded greenhouse for further ripening for 7 days, then open the bags with small holes and cover them with soil horizontally, adjust the light intensity through the shading net, control the light intensity at 500 - 800 Lux during the mycelial button stage and stipe differentiation stage, and when the stipe grows to 13 - 15 cm and enters the pileus differentiation stage, control the light intensity at 1800 - 2200 Lux; keep the soil humidity at 20 - 30%, the air humidity at 70 - 90%, the temperature at 25 - 28 °C, and the CO 2 concentration less than 0.06%; when the light yellow growth ring at the edge of the pileus disappears and there is spore ejection, which is 95 days after planting with soil covering, the fruiting bodies can be harvested.

[0084] In Step E, the cultivation base is a greenhouse, and 6000 bags are planted per mu of the greenhouse.

[0085] In Step E, the stacking height does not exceed 3 layers.

[0086] In Step E, if the Ganoderma lucidum strain L4966 is used for bonsai cultivation of ornamental Ganoderma lucidum and is planted in pots, 5 mushroom sticks can be planted in each pot.

[0087] Example 4

[0088] A Ganoderma lucidum strain L4966 with a bright cap, the Ganoderma lucidum strain L4966 ( Ganoderma sp.) was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 4, 2024, with the deposit number GDMCC No: 65097.

[0089] The cultivation method of the Ganoderma lucidum strain L4966 in this example includes the following steps:

[0090] Step A, mother spawn propagation: Under aseptic conditions, inoculate the Ganoderma lucidum strain L4966 onto the mother spawn PDA medium and place it in an incubator at 22 °C for 8 d to obtain mycelial blocks;

[0091] The mother spawn PDA medium includes the following raw materials by weight: 200 parts of potato, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water;

[0092] Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into the sterilized shake flask seed medium and culture them on a shaker at 22 °C for 9 d to obtain the seed liquid;

[0093] Among them, the shake flask seed medium includes the following raw materials by weight: 200 parts of potato, 20 parts of glucose, 2 parts of peptone, 0.4 part of potassium dihydrogen phosphate, 0.2 part of ferric trichloride, 1000 parts of water, and the pH is 6.5;

[0094] Step C, liquid fermentation tank fermentation culture: Inoculate the seed liquid obtained in Step B into the fermentation broth medium and culture it at 22 °C for 10 d to obtain the liquid strain;

[0095] Among them, the fermentation broth medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 200 parts of peptone, 120 parts of potassium dihydrogen phosphate, 60 parts of ferric trichloride, 100000 parts of water, and the pH value is 6.5;

[0096] Step D, preparation of cultivation species: Inoculate the liquid strain cultured in Step C into the cultivation bag and place it in an incubator at 24 °C for 35 d;

[0097] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 76 parts of miscellaneous wood chips, 2 parts of cottonseed hulls, 18 parts of wheat bran, 2 parts of soybean cake powder, 1 part of gypsum powder, 1 part of lime powder; pH value 7, water content 60%;

[0098] Step E, soil covering cultivation and harvesting: After the mycelium in the cultivation bags is fully grown, transport them to the cultivation base, stack them on the ground in the shaded greenhouse for further ripening for 6 days, then open the bags with small holes, place them horizontally and cover with soil for planting. Adjust the light intensity through the shading net. The light intensity is controlled at 500 - 800 Lux during the primordium stage and the stipe differentiation stage. When the stipe grows to 11 - 14 cm and enters the pileus differentiation stage, the light intensity is controlled at 1800 - 2200 Lux; maintain the soil humidity at 20 - 30%, the air humidity at 70 - 90%, the temperature at 20 - 26 °C, and the CO 2 concentration is less than 0.06%; when the light yellow growth ring at the edge of the pileus disappears and there is spore ejection, which is 96 days after planting with soil covering, the fruiting bodies can be harvested.

[0099] In step E, the cultivation base is a greenhouse, and 5500 bags are planted per mu of the greenhouse.

[0100] In step E, the stacking height does not exceed 3 layers.

[0101] In step E, if the bright - capped Ganoderma lucidum strain L4966 is planted as a bonsai of ornamental Ganoderma lucidum, when using potted plants, 3 fungus sticks can be planted in each pot.

[0102] Application examples

[0103] 1. Source of the bright - capped Ganoderma lucidum strain L4966

[0104] On August 26, 2019, the breeding group collected from Mengzi County, Honghe Prefecture, Yunnan Province, and obtained the pure strain - bright - capped Ganoderma lucidum strain L4966 through tissue isolation and purification.

[0105] 1.1 Isolation and purification

[0106] Cut small pieces of the internal tissue of wild Ganoderma lucidum near the alcohol lamp and place them on the PDA medium. After germination and purification, obtain pure strains. Under the same culture conditions, compare the mycelial growth trends in terms of growth rate, thickness, and density. Eliminate the strains with weak mycelia, and screen out the effective strain with the best mycelial growth trend that can produce fruiting bodies, obtaining the bright - capped Ganoderma lucidum strain L4966, which is named the bright - capped Ganoderma lucidum strain L4966.

[0107] 1.2 Molecular identification

[0108] Scrape an appropriate amount of pure - cultured mycelia, grind them with liquid nitrogen (or a grinder), and extract the total DNA using the steps of a plant genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd.). Use the polymerase chain reaction (PCR) technique to select four gene fragments: ITS, nLSU, TEF - 1α , RBP2 was amplified. The base composition of the specific primers is shown in Table 1. A 25-μL reaction system was used for the PCR amplification system, which included: 12.5 μL of 2×T5 Super PCR Mix, 1 μL each of the upstream and downstream primers (both at a concentration of 0.1 mmol / μL), 1 μL of DNA template, and 9.5 μL of sterile ddH 2 O. Then PCR amplification was carried out.

[0109] Table 1 Primers and base composition used in PCR amplification

[0110]

[0111] Note: The bases include a, t, c, g. Other letters appearing in the primers represent degenerate bases.

[0112] The PCR reaction procedure for ITS is as follows: Initial denaturation at 94 °C for 5 min; 94 °C for 30 s, 53 °C for 30 s, 72 °C for 50 s, repeated for 35 cycles; finally, extension at 72 °C for 10 min.

[0113] The PCR reaction procedure for nLSU is as follows: Initial denaturation at 94 °C for 5 min; 94 °C for 30 s, 52 °C for 30 s, 72 °C for 1 min, repeated for 35 cycles; finally, extension at 72 °C for 10 min.

[0114] The PCR reaction procedure for TEF1-α is as follows: Initial denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, denaturation at 55 °C for 30 s, denaturation at 72 °C for 50 s, repeated for 35 cycles; extension at 72 °C for 10 min.

[0115] RPB The PCR reaction procedure for 2 is as follows: Initial denaturation at 94 °C for 5 min; 94 °C for 30 s, 50 °C for 30 s, 72 °C for 50 s, repeated for 35 cycles, extension at 72 °C for 10 min.

[0116] The amplified products were stored at 4 °C.

[0117] Weigh 1 g of agarose precisely using an electronic balance and dissolve it in 100 mL of 0.5×TBE buffer (10×TBE is diluted with distilled water) (Tris-borate-EDTA). Place it in a microwave oven and heat it at medium power for 2.0 min until it becomes clear and transparent. When the temperature reaches 65 °C, add 1 μL of nucleic acid dye, shake well, pour it into a silica gel plate, let it cool for later use. Put it into an electrophoresis chamber and use a pipette for sample loading. The sample loading volume is 5 μL. During electrophoresis, the voltage is 160 V, the current is 90 A, and the time is 15 min. After electrophoresis in 1.0×TBE buffer, observe, take pictures and record the results using an ultraviolet gel imager, detect the concentration of the extracted DNA, and send the positive products to Sangon Biotech in Shanghai for sequencing.

[0118] The ITS sequence is: acctgcggaaggatcattatcgagtcctgactgggttgtagctggccttccgaggcacgtgcacgccctgctcatccactctacacctgtgcacttactgtgggtttcagatctgtgaagcgtgccccttgcggggcttcgtgaagcgcgtctgtgcctgcgtttatcacaaactccataaagtattagaatgtgtattgcgatgtracgcatctatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcatgaaatcttcaacctacaagcttttgcggtttgtaggcttggacttggaggcttgtcggccctttgtcggtcggctcctcttaaatgcattagcttgattccttgcggatcggctctcggtgtgataatgtctacgccgcgaccgtgaagcgtttggcgagcttctaaccgtcttcgcttgaagacagctttatgacctctgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagga (SEQ ID NO.9)

[0119] The nrLSU sequence is: ataagcatatcaataagcggaggaaaagaaactaacaaggattcccctagtaactgcgagtgaagcgggaaaagctcaaatttaaaatctggcggtcttcggccgtccgagttgtagtctggagaagtgctttccgcgctggaccgtgtataagtctcttggaacagagcgtcatagagggtgagaatcccgtctttgacacggactaccagtgctttgtgatgcgctctcaaagagtcgagttgtttgggaatgcagctcaaaatgggtggtgaattccatctaaagctaaatattggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagcactttggaaagagagttaaacagtacgtgaaattgctgaaagggaaacgcttgaagtcagtcgcgtcgtccggaactcagccttgcttccgcttggtgcactttccggatgacgggtcagcatcgattttgaccgtcggaaaagggctggagtaatgtggcacctccgggtgtgttatagactctagtcgcatacggcggttgggatcgaggaacgcagcgcgccgcaaggcaggggttcgcccactttcgcgcttaggatgctggcataatggctttaaacgacccgtcttgaaacacggaccaaggagtctaacatacctgcgagtgtttgggtggaaaacccgagcgcgtaatgaaagtgaaagttgagacctctgtcgtggagggcatcgacgcccggacctgacgttctctgaaggatccgcggtagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgtagcgattctgacgtgcaaatcgatcgtcaaatttgggtataggggcgaaagactaatcgaaccatctagtagctggttcctgccgaa (SEQ ID NO.10)

[0120] TEF The 1-a sequence is: tgtcgcttatgtcttgcatatccgtcggcaccctctctgcacccgtcatcgaattcttggaggagtggggcctggagtctctggaggagaatgctcatgcctcaacgccttgcacgaaggtcttcgtgaatggcgtttggatgggcgtccatcgagatcctgtgaagctcgtcagcacgctcaggaagctccgtcgcaaagatgacatcaactgcgaggtatccgtcgtccgtgacattcgagaacgcgagctccgtctctacacggatgctggtcgcgtctgccgaccgctcttcatcgtcgagaaccagcagctccttatccagaagaaacatatcgagagcttggtccgtgccaaggaagacccgacgttgtcctacaactgggacagcctcctcaaggacggtgtcatcgagctgctagatgccgaggaagaggagacggttatgatatgcatgacaccggaggatttggagaattcgaggctccaggctgccggtatcgacccccatgcggacgaggagaacgacccctcagctcgattgaaggcgccgacctccgcgcatacgtggacgcactgcgagattcacccgagtatgatcttgggtgtctgtgccagtatcattccgttccccgatcacaatcaggtagctcaggttaggaagtaaacttcagtcgaagtactaacgtgcgtctagtcgcctcgtaacacgtacca (SEQ ID NO.11)

[0121] RBPThe sequence of 2 is: tgtcgcttatgtcttgcatatccgtcggcaccctctctgcacccgtcatcgaattcttggaggagtggggcctggagtctctggaggagaatgctcatgcctcaacgccttgcacgaaggtcttcgtgaatggcgtttggatgggcgtccatcgagatcctgtgaagctcgtcagcacgctcaggaagctccgtcgcaaagatgacatcaactgcgaggtatccgtcgtccgtgacattcgagaacgcgagctccgtctctacacggatgctggtcgcgtctgccgaccgctcttcatcgtcgagaaccagcagctccttatccagaagaaacatatcgagagcttggtccgtgccaaggaagacccgacgttgtcctacaactgggacagcctcctcaaggacggtgtcatcgagctgctagatgccgaggaagaggagacggttatgatatgcatgacaccggaggatttggagaattcgaggctccaggctgccggtatcgacccccatgcggacgaggagaacgacccctcagctcgattgaaggcgccgacctccgcgcatacgtggacgcactgcgagattcacccgagtatgatcttgggtgtctgtgccagtatcattccgttccccgatcacaatcaggtaagctcaggttaggaagtaaacttcagtcgaagtactaacgtgcgtctagtcgcctcgtaacacgtacca (SEQ ID NO.12)

[0122] Four multi-gene sequences of the mycelium of Ganoderma lucidum strain L4966 were spliced in the forward and reverse directions and compared in the NCBI database. The results showed that the ITS sequence of Ganoderma lucidum strain L4966 was Ganoderma lucidum 99.68% similar to the sequence of (JQ520186); the nLSU sequence was 100.00% similar to the sequence of Ganoderma lucidum (MK995649). TEF The sequence of 1-α was 99.58% similar to the sequence of Ganoderma lucidum (MZ221669); RBP The sequence of 2 was Ganodermalucidum The sequence similarity with (MUCL 35119) reached 100.00%. The Ganoderma lucidum strain L4966 and Ganoderma Ganoderma lucidum had a relatively high similarity rate of 99.53%. According to the fact that the gene similarity rate of macrofungi is greater than 97%, they are generally considered to be the same species. Therefore, it was preliminarily determined that the Ganoderma lucidum strain L4966 was Ganoderma Ganoderma lucidum .

[0123] Based on the Blast alignment results of 4 gene fragments (ITS, nrLSU, TEF1 -α, RPB 2) on the NCBI database, the sequences of 4 gene fragments of 12 species of Ganoderma lucidum were downloaded from GenBank. After alignment using Mafft and splicing with SequenceMatrix, with TomopH value a guscolossus as the outgroup, based on the combined gene sequences of the above 4 fragments, the maximum likelihood tree was constructed using Rax ML with 100 repetitions, and the support rate greater than 70% was marked on the branch nodes. As Figure 1 shown, the results of phylogenetic analysis showed that both the Ganoderma lucidum strain L4966 and the control strain - Yunling No. 2 (Ganoderma lucidum strain L4914 in CN117683645B A Ganoderma lucidum Strain L4914 and Its Cultivation Method and Application) were Ganoderma lucidum ( G. lucidum ) with a support rate of 100%.

[0124] 1.3 Antagonism experiment

[0125] An antagonism test was carried out with the isolated Ganoderma lucidum strain L4966 and the control strain - Ganoderma lucidum strain L4914. The results showed that there was a strong antagonistic reaction between the Ganoderma lucidum strain L4966 and the Ganoderma lucidum strain L4914, and they were not compatible, forming a "bulging type" antagonistic line (as Figure 2 ). This indicates that the two are different strains of Ganoderma lucidum.

[0126] 1.4 SSR molecular marker

[0127] (1) DNA extraction

[0128] The tested strains were transferred to potato dextrose agar solid medium and cultured at 25 °C for 15 d, and then the mycelia were collected; the genomic DNA of the mycelia was extracted using the Jinsa Biology DE711-50 kit, and the purity and concentration of the DNA were detected by agarose gel electrophoresis and biophotometer methods.

[0129] Among them, the potato dextrose agar solid medium: 200 g of potato (peeled), 20 g of glucose, 16 g of agar, 2 g of yeast powder, 2 g of peptone, 0.2 g of potassium dihydrogen phosphate, 0.2 g of magnesium sulfate.

[0130] (2)Genome sequencing

[0131] After DNA extraction, purification, and library construction of the sample, sequencing technology is used to perform sequencing based on a sequencing platform. Search for SSR loci in the genome sequence of Ganoderma lucidum strain L4966.

[0132] (3)Development of SSR primers based on genome sequencing results

[0133] Based on the development and screening of Ganoderma lucidum genome data, 5 pairs of SSR primers: Primer 1, Primer 2, Primer 3, Primer 4, and Primer 5 are used to distinguish Ganoderma lucidum strain L4966 from the control Ganoderma lucidum strain L4914. The detailed information is shown in Table 2.

[0134] Table 2. Information of SSR marker primers

[0135]

[0136] (4)PCR amplification

[0137] Use SSR molecular markers to perform PCR amplification of SSR markers on the extracted DNA.

[0138] The PCR amplification system is as follows: The total volume is 25 μL, including: 12.5 μL of Sangon 2XT5 Super PCR Mix (with Bule Dye); 1 μL each of the forward and reverse primers of the SSR marker (both at a concentration of 0.1 mmol / μL), 1 μL of template DNA, and 9.5 μL of sterile ddH 2 O. PCR reaction conditions: 95 °C for 2 min; 95 °C for 30 s, 53 °C for 30 s, 72 °C for 30 s, for 36 cycles; 72 °C for 5 min. To ensure the accuracy of the identification, three repeated experiments are carried out. Use the above conditions for Ganoderma lucidum strain L4914 and repeat three times as a control.

[0139] (5)Electrophoresis

[0140] Use polyacrylamide gel for electrophoresis. After electrophoresis, silver staining is performed to show bands.

[0141] Mix the following reagents: 48 mL of 1×TBE solution; 12 mL of Acr - Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED;

[0142] Immediately pour the glue after mixing and configuration to expel air bubbles. After the glue solidifies, perform electrophoresis; the sample loading volume is 2 μL per well, and the electrophoresis conditions are a constant voltage of 270 V for 1 h. After electrophoresis is completed, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 min; after silver staining is completed, wash twice with water; add sodium hydroxide and formaldehyde for color development (6 g of NaOH, 400 mL of distilled water, 2 mL of formaldehyde solution).

[0143] Table 3. Comparison of the amplified fragment sizes of primers in Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914

[0144]

[0145] From Figure 3 and Table 3, it can be seen that under the same PCR conditions, after PCR amplification using SSR primers 1, 2, 3, 4, and 5, Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 showed different band patterns, and the two strains of Ganoderma lucidum, strain L4966 and strain L4914, can be distinguished by 5 pairs of SSR primers.

[0146] 2. Morphological characteristics of fruiting bodies

[0147] 2.1 Results of morphological observation

[0148] The morphological observation is as Figure 4 shown. Fruiting body: The basidiocarp is annual, with a stipe. When fresh, it is corky, odorless, and bitter. When dry, it is light and soft. The pileus is shell-shaped, semi-circular to circular, 6.6 - 8.5 cm long, 3.5 - 5 cm wide, and can be up to 1.6 cm thick. The surface of the pileus has a lacquered luster, yellowish-brown to reddish-brown. There are concentric ring grooves of varying depths on the surface of the pileus, and it does not crack. The edge is distinct, sharp or obtuse, sometimes slightly curled, and the color varies. When young, it is light yellow, light yellowish-brown to yellowish-brown. The context can be up to 0.5 cm thick, and the color is usually stratified. The upper layer is milky white or light brown, and the lower layer is light brown or brown, corky to spongy, occasionally with concentric ring patterns, and there is no black crusty line in the mature basidiocarp. The tubes can be up to 0.8 cm long, light brown or brown, corky, not stratified. There are 5 - 8 pores per millimeter, angular, round or angular, with the tube walls slightly thick or thick, and most are entire; the pore surface is white, turning brown after being touched, and sometimes turning light yellow when dry. The stipe is 13 - 17 cm × 1.3 - 2.2 cm, lateral or eccentric, flattened or nearly cylindrical, with a smooth surface, a strong lacquered luster, brown to purple-black.

[0149] Trimitic hyphal system: Generative hyphae 1-2.5 μm in diameter, with clamp connections, thin-walled, colorless, not common; skeletal hyphae 2-6 μm in diameter, thick-walled to sub-solid, mostly dichotomously branched, brownish-yellow, accounting for the vast majority; binding hyphae 2-4 μm in diameter, thick-walled, often intertwined and branched, light brown, thick-walled with a narrow lumen, to sub-solid, rare; all three types of hyphae above are IKI - 、CB + ; the tissue turns black in KOH reagent.

[0150] Pellis cells: 30-40×7-11 μm in length and width, club-shaped, bright yellow, to sub-solid, usually with a strong amyloid reaction in mature basidiocarps.

[0151] Basidiospores: (60 / 3 / 2)(10.0)11.0-12.5-13.5×(7.0)7.5-8.2-9.0 μm, Q=(1.36)1.39-1.71(1.74), Qm=1.53±0.11 (including umbonate projections); elliptical, the apical beak falls off when mature, truncate, light yellowish-brown, KI - ,CB + ,with an amyloid reaction, double-walled, the outer wall is smooth, and the inner wall surface has rough punctate ornamentation. Basidia and basidioles were not seen.

[0152] 3. Cultivation of the strain

[0153] 3.1 Mother culture medium and its preparation

[0154] (1) Mother culture medium

[0155] ① The mother culture PDA medium includes the following raw materials by weight: 200 parts of potato, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water;

[0156] (2) Preparation of the mother culture medium

[0157] ① The production process of the mother culture medium: material selection → accurate weighing (according to the formula) → material treatment → quantitative preparation → tube filling → sterilization and slant placement.

[0158] ② Preparation of the mother culture medium

[0159] A. Boiling: Peel the potato, wash and slice it, weigh 200 g, add 1000 mL of water, heat to boiling until the potato slices are crispy but not mushy, and filter with six-layer gauze;

[0160] B. Ratio: Add 20 g of glucose and 20 g of agar to the filtrate, make up the volume to 1 L with water, and stir to dissolve;

[0161] C. Packaging and sterilization: After dissolving, pack into test tubes while hot. The general amount is 1 / 5-1 / 4 of the length of the test tube. After packing, plug with cotton plugs, 5 in a pack, and wrap one end of the test tube with kraft paper and tie it tightly. After the test tube is wrapped, put it into the autoclave and sterilize at 121℃ for 20 minutes.

[0162] D. Slanted placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slope. Usually the length of the slope is 1 / 2 of the test tube. After it solidifies, place it in a clean and dry place for use.

[0163] ③ The mother strain is separated by tissue separation method, which has the advantages of being simple and convenient, stable genetic traits of strains, and strong regeneration ability. You only need to take the fruiting body tissue block under sterile conditions, put it on the slant culture medium, and promote it to develop into the vegetative growth stage to obtain a good strain.

[0164] A. For the fruiting bodies to be separated from the tissue, choose those that are large, thick, free of pests and diseases, slightly hard in texture, and strong in growth and development.

[0165] B. Collect fresh fruiting bodies and scrape off the impurities at the base with a knife, wipe with a cotton ball squeezed with alcohol solution, put in a culture dish, move to a clean bench, disinfect hands, burn the inoculation needle, tweezers, blade, etc. over the flame of an alcohol lamp for later use. Use a scalpel to cut a suitable size of tissue block and insert it into the culture medium. The separation site should be selected as much as possible at the junction of the stipe and the cap, because the base tissue cells have strong regeneration ability and it is easy to obtain strains with excellent traits.

[0166] C. Wrap the inoculated test tube with sealing film and place it in a constant temperature incubator at 22 ℃ for cultivation. During the cultivation process, check the growth of mycelium every day and remove any foreign bacteria in time. 24 hours after inoculation, short and weak mycelium grows around the inoculation block, which is white. Generally, the test tube can be fully grown in 7 to 10 days.

[0167] 3.2 Liquid culture preparation

[0168] Liquid strains can be inoculated quickly, 10 to 20 days faster than traditional solid strains. Using liquid strains to propagate the culture can shorten the production cycle and cultivate a large number of strains in a short period of time, thereby saving cultivation costs and meeting production needs. Liquid strains have the advantages of good quality, consistent bacterial age, convenient inoculation, and low cost.

[0169] (1) Shake flask culture medium formula (10 L):

[0170] 2000 g potatoes, 200 g glucose, 20 g peptone, 12 g potassium dihydrogen phosphate, 6 g ferric chloride;

[0171] (2) Seed solution preparation:

[0172] Prepare the liquid medium according to the formula, dispense it into 500 mL Erlenmeyer flasks, sterilize at 121 °C for 20 min. After cooling, inoculate the Ganoderma lucidum mycelium blocks into the liquid medium and culture at 22 °C for 7 - 10 d to obtain the seed liquid.

[0173] (3)Fermenter preparation:

[0174] A. The formula for the liquid spawn is (100L): soluble starch 600g, glucose 2400g, peptone 200g, potassium dihydrogen phosphate 120g, ferric trichloride 60g, water 100L, and the pH value is 6.3 - 6.7;

[0175] B. Prepare the fermentation broth according to the formula and cool for standby;

[0176] C. Inoculate the cooled fermentation broth into the fermenter at a ratio of 1% Ganoderma lucidum seed liquid;

[0177] D. After inoculation, culture the fermenter at 22 °C for 8 - 11 d for use.

[0178] 3.3 Cultivation bag preparation

[0179] 3.3.1 Cultivation substrate formula

[0180] The cultivation substrate in the cultivation bag includes the following raw materials by weight parts: miscellaneous sawdust 75 - 77 parts, cottonseed hulls 1.8 - 2.2 parts, wheat bran 17 - 19 parts, soybean cake powder 1.9 - 2.1 parts, gypsum powder 0.9 - 1.1 parts, lime powder 0.9 - 1.1 parts; pH value 6 - 8, water content 55 - 65%;

[0181] 3.3.2 Cultivation bag production

[0182] (1)Ingredient preparation and pretreatment:

[0183] Weigh the ingredients according to the formula. Among them, miscellaneous sawdust, cottonseed hulls, and wheat bran need to be pre - wetted with water 24 h in advance, and then soybean cake powder is mixed in; dissolve the required gypsum and lime in water first, and then sprinkle them on the miscellaneous sawdust, cottonseed hulls, and wheat bran, adding water while stirring, piling up and covering for 1 h, and then stirring again until evenly mixed.

[0184] (2)Bag filling:

[0185] Select polyethylene bags of 17 cm × 35 cm × 0.05 cm for bag filling. When filling, the tightness should be appropriate. Compact the culture material while adding, and the filling should be tight. Then, use a hole - making rod to make an inoculation hole with a diameter of 1.5 - 2.0 cm in the center of the material surface. After bag filling, the height of the bag is about 20 cm, and a collar and a lid are put on. The dry weight of the culture material in each bag is 0.55 kg, and the wet weight is 1.0 - 1.2 kg.

[0186] (3)Sterilization:

[0187] Use atmospheric steam sterilization. Drain the cold air in advance during the heating-up process. After the temperature reaches 100 °C, start timing and maintain this temperature for 10 - 12 h. Or use high-pressure steam sterilization at 121 °C, 0.12 Mpa - 0.15 Mpa for 2.5 - 3.0 h. Then stop heating and let it cool naturally. When the temperature inside the sterilizer drops below 60 °C, the fungus bags can be transferred to the cooling room for natural cooling.

[0188] (4)Inoculation of cultivation bags:

[0189] Put the cultivation bags into the inoculation room and sterilize them with an ultraviolet disinfection lamp for half an hour before inoculation. During the operation, strict aseptic operation procedures should be followed. First, carefully disinfect the hands, cultivation spawn bags, and tools with 75% alcohol cotton balls. Burn and cool the scalpel and forceps on the alcohol lamp, and then transfer with a liquid spawn inoculation amount of 10 mL / bag, and seal with a sterilized sponge. After inoculation, move the cultivation bags into the cultivation room and cultivate them in the dark at a temperature controlled at 22 °C - 26 °C. They can be fully grown in the bags in 33 - 38 d. During the cultivation process, the cultivation bags infected with miscellaneous bacteria should be selected and eliminated in a timely manner.

[0190] 4. Pilot-scale primary screening

[0191] Ganoderma lucidum is cultivated with substituted materials covered with soil. According to the requirements of the breeding specification of edible mushroom varieties GB / T 21125 - 2007, the designed number of cultivated bags for each group in the pilot-scale primary screening test is 12 bags, with 3 replicates. The dry material of the substrate for each fungus bag is 550 g, liquid inoculation is used, the inoculation amount per bag is 10 mL, and the method of cultivating with a small opening, opening the bag horizontally, and covering with soil is adopted. The dry material of the bag cultivation for each group is 6.6 kg.

[0192] 4.1 Pilot-scale primary screening test plan

[0193] There are 12 bags in each group, the liquid spawn inoculation amount for each group is 120 mL, the dry material of the bag cultivation for each group is 6.6 kg, with 3 replicates. The liquid spawn of Ganoderma lucidum strain L4966 is 360 mL, and the dry material of the bag cultivation is 19.8 kg.

[0194] 4.2 Analysis of pilot-scale primary screening results

[0195] Table 4 Statistics of the fruiting body yield and traits of Ganoderma lucidum strain L4966 in pilot-scale primary screening

[0196]

[0197] Note: "M ± SD" represents the mean ± standard deviation. Randomly select 5 bags from each group and measure the average weight of the single fruiting body of the yield. Randomly select 10 fruiting bodies for the fruiting body traits to calculate the average value.

[0198] As can be seen from Table 4, the fruiting of Ganoderma lucidum strain L4966 in the preliminary screening test of small-scale trial was in good condition. The yield measurement results showed that: the average of the first group was 65.2 g / bag, the second group was 69.4 g / bag, the third group was 61.6 g / bag, and the average yield of the three groups was 65.4 g / bag. The experimental results were good, the fruiting was relatively neat, the stipes were slender, multi-branched, the caps were small, thin in texture, fan-shaped, with obvious reddish-brown to pale yellow edges on the surface, and obvious radial longitudinal ridges. Before maturity, it resembled Ganoderma lucidum in the shape of antlers and had strong ornamental value. The average cap length was 9.10 cm and the average width was 5.15 cm; the stipe was long, flat and cylindrical, brownish-red, lateral, with an average length of 14.73 cm; the average fresh weight of a single fruiting body was 65.4 g, and the biological efficiency was 11.89%.

[0199] 5. Small-scale retesting

[0200] For the cultivation of Ganoderma lucidum with substituted materials and soil covering, according to the requirements of the Technical Specification for the Breeding of Edible Fungi Varieties GB / T 21125-2007, the number of cultivation bags designed for each group in the small-scale retesting was 30 bags, with 3 replicates. Each bag contained 550 g of dry material, and liquid inoculation was used, with an inoculation amount of 10 mL per bag. Then the inoculation amount for each group was 300 mL, and the dry material for bag cultivation in each group was 16.5 kg.

[0201] 5.1 Small-scale retesting test plan

[0202] Each group had 30 bags, the inoculation amount of liquid spawn for each group was 300 mL, the dry material for bag cultivation in each group was 16.5 kg, with 3 replicates. The liquid spawn of Ganoderma lucidum strain L4966 was 900 mL, and the dry material for bag cultivation was 49.5 kg.

[0203] 5.2 Analysis of small-scale retesting results

[0204] Table 5 Statistics of fruiting yield and traits of Ganoderma lucidum strain L4966 in small-scale retesting

[0205]

[0206] Note: "M±SD" represents the mean ± standard deviation. 5 bags were randomly selected from each group, and the average weight of a single fruiting body of the yield was measured. For the fruiting body traits, the average value was calculated by randomly selecting 20 fruiting bodies.

[0207] As can be seen from Table 5, the fruiting of Ganoderma lucidum strain L4966 in small-scale retesting was in good condition, the fruiting uniformity was good, the cultivation traits were stable, the fruiting bodies were yellowish-brown, the surface of the caps had a shiny lacquer-like appearance, the caps were small, thin in texture, with obvious annular lines and radial longitudinal ridges, the average cap length was 10.05 cm and the width was 6.05 cm, the fleshy layer was light brownish-brown, with an average thickness of 1.18 cm, the average stipe length was 14.22 cm, the average fresh weight of a single bag of fruiting body was 66.26 g, the average dry weight was 23.95 g, and the average biological efficiency was 12.05%.

[0208] 6. Intermediate test

[0209] Ganoderma lucidum is cultivated by substituting materials and covering with soil. According to the requirements of the Technical Specification for Breeding of Edible Fungi Varieties GB / T 21125-2007, the number of cultivations in each group for the intermediate test design is 1,200 bags, with 3 replicates. Each bag contains 550 g of dry material, and liquid inoculation is used, with an inoculation amount of 10 mL per bag. Then the inoculation amount for each group is 12 L, and the dry material for bag cultivation in each group is 660 kg.

[0210] 6.1 Intermediate test plan

[0211] There are 1,200 bags in each group, the inoculation amount of liquid spawn for each group is 12 L, the dry material for bag cultivation in each group is 660 kg, and there are three replicates. Then for the Ganoderma lucidum strain L4966, the liquid spawn is 36 L, and the dry material for bag cultivation is 1,980 kg.

[0212] 6.2 Analysis of intermediate test results

[0213] Table 6 Statistics of fruiting body yield and traits in the intermediate test of Ganoderma lucidum strain L4966

[0214]

[0215] Note: "M±SD" represents mean ± standard deviation. The yield was measured by random sampling (at three points), with 50 bags at each sampling point. The average weight of the single fruiting body was measured for yield, and the average value was calculated by randomly selecting 20 fruiting bodies for the fruiting body traits.

[0216] As can be seen from Table 6, the yield of Ganoderma lucidum strain L4966 is stable. The fruiting body is yellowish-brown, with an average cap length of 10.19 cm, a width of 6.12 cm; an average thickness of 1.24 cm, and a relatively soft texture; the stipe is reddish-brown, with an average length of 14.37 cm. The average fresh weight of a single mushroom of the fruiting body is 65.72 g, the average dry weight is 25.08 g, and the biological efficiency is 11.95%. From the primary screening in small-scale tests, the secondary screening in small-scale tests to the intermediate test, due to the increasing maturity of artificial domestication and cultivation management techniques, it takes an average of 96 days to grow and mature and start ejecting spores, and the yield has increased steadily. Ganoderma lucidum strain L4966 has good stability, a high fruiting rate, unique traits, and strong ornamental value.

[0217] 7. Multi-year demonstration cultivation

[0218] 7.1 Demonstration cultivation test plan

[0219] The bright-cap Ganoderma lucidum strain L4966 is cultivated in bags with substituted materials and covered with soil. According to the requirements of the Technical Specification for Breeding Edible Fungi Varieties GB / T 21125-2007, the number of cultivation bags in each group of the demonstration cultivation test design is 10,000 bags (3 replicates at each point, and the number of repeated cultivations is about 3,600 bags). Each bag contains 550 g of dry material, liquid inoculation is used, and the inoculation amount per bag is 10 mL. Then the inoculation amount per group is 36.0 L, and the dry material for bag cultivation per group is 1,980 kg. The bright-cap Ganoderma lucidum strain L4914 is used as a control. The same batch of strains and cultivation bags are used at each point to ensure the same amount of strains and consistent demonstration cultivation management techniques.

[0220] 7.2 Selection of demonstration cultivation sites

[0221] Songming County, Kunming City, Yunnan Province (altitude 1,853 m), Panlong District (altitude 2,048 m), Wuding County (altitude 2,376 m), and Xundian County (altitude 2,165 m).

[0222] 7.3 Demonstration cultivation test plan

[0223] 7.3.1 Season selection

[0224] According to natural conditions and the growth characteristics of Ganoderma lucidum, etc., the production of seeds (bags) starts from mid-December to early March of the following year. From early April to mid-June of each year is the cultivation season of Ganoderma lucidum, and from late June to mid-September is the fruiting season. Ganoderma lucidum can be cultivated using the natural (environmental) temperature.

[0225] 7.3.2 Site selection

[0226] Most of the cultivation sites are solar greenhouse sheds. Select sites that face the sun, are sheltered from the wind, dry, hygienic, and close to the water source. The cultivation sites for wild Ganoderma lucidum should be selected where the transportation is convenient, there is no pollution, the forests are dense, the slopes are gentle, the humidity is relatively high, and the soil is deep.

[0227] 7.3.3 Cultivation method

[0228] (1) Cultivation substrate formula

[0229] The cultivation substrate in the cultivation bag includes the following raw materials by weight: 75-77 parts of miscellaneous wood chips, 1.8-2.2 parts of cottonseed hulls, 17-19 parts of wheat bran, 1.9-2.1 parts of soybean cake powder, 0.9-1.1 parts of gypsum powder, 0.9-1.1 parts of lime powder; pH value 6-8, water content 55-65%;

[0230] (2) Preparation of cultivation substrate

[0231] Ingredient preparation: Weigh the ingredients according to the formula. Among them, the miscellaneous wood chips, cottonseed hulls, and wheat bran need to be pre-wetted with water 24 hours in advance, and then the soybean cake powder is added and mixed.

[0232] Mixing materials: Dissolve the required gypsum and lime in water first, then sprinkle them on sawdust, cottonseed hulls and wheat bran, stir while adding water, adjust the pH value to 6 - 8 with quicklime, stack and stuffy for 1 h, and stir again until evenly mixed.

[0233] Bagging: Select polyethylene bags of 17 cm×35 cm×0.05 cm for bagging. When filling the bags, the tightness should be appropriate. Compact the culture material while adding it, and make it tight. Then use a hole - punching rod to punch inoculation holes with a diameter of 1.5 - 2.0 cm in the center of the material surface. After bagging, the height of the bag is about 20 cm, and put on a collar and a lid. The dry weight of the culture material per bag is 0.55 kg, and the wet weight is 1.0 - 1.2 kg.

[0234] Sterilization: Use atmospheric steam sterilization. Discharge the cold air in advance during the heating process. When the temperature reaches 100 ℃, start timing and maintain this temperature for 10 - 12 h. Or use high - pressure steam sterilization at 121℃, 0.12 Mpa - 0.15 Mpa for 2.5 - 3.0 h. Then stop heating and let it cool naturally. When the temperature inside the sterilizer drops below 60 ℃, the fungus bags can be transferred to the cooling room for natural cooling.

[0235] Cooling: After sterilization, take out and put it into the pre - cooling room or inoculation room for cooling.

[0236] (3)Inoculation

[0237] When the temperature of the fungus bag cools to about 25 ℃, move it to the inoculation table. Follow aseptic operation. One person is responsible for opening the plastic cover, removing the collar cover and pulling out the inoculation rod, and another person uses an inoculator to inoculate the strain, then cover the collar and the lid, make marks for different varieties, and place it in the culture room.

[0238] (4)Mycelium culture

[0239] The inoculated cultivation bags are placed on the culture rack, cultured in the dark at room temperature, keep the air humidity at 60 - 65%, observe once a week, at the same time select the contaminated cultivation bags and discard them, and record the relevant growth conditions.

[0240] (5)Ganoderma lucidum fruiting body management

[0241] Adjust the light intensity through a shading net. Control the light intensity at 500 - 800 Lux during the primordium stage and stipe differentiation stage. When the stipe grows to 10 - 15 cm and enters the pileus differentiation stage, control the light intensity at 1800 - 2200 Lux. The normal growth temperature of Ganoderma lucidum fruiting body is 18 - 28 ℃, and the optimum is 22 - 26 ℃. The primordium can be formed in about 22 d at the optimum temperature. Ganoderma lucidum growth requires relatively high humidity. Spray more water on sunny days, less on cloudy days, and do not spray on rainy days. Keep the soil humidity in the greenhouse at 20 - 30% and the air humidity at 70 - 90%. Ganoderma lucidum belongs to aerobic fungi. Ventilation is the key to ensuring the normal unfolding of Ganoderma lucidum pileus. CO 2The concentration is less than 0.06%.

[0242] (5)Harvesting

[0243] The standard for mature Ganoderma lucidum harvesting is as follows: the growth of the Ganoderma lucidum cap stops, the light yellow or white edge of the cap completely disappears, the single fruiting body changes from light yellow to reddish brown, the cap begins to become leathery, the pores under the cap start to eject basidiospores outward, and it should be harvested in time when the spores are released and the color deepens. When harvesting, a sharp blade can be used to cut the stipe, leaving about 0.5 cm. After harvesting, the culture medium and impurities at the root should be removed in time, and spraying should be persisted within 1 - 2 days after harvesting to strengthen the management of moisture retention and ventilation, so that the mycelium can resume growth as soon as possible and promote the formation of mushroom buds. A total of 1 - 3 batches can be harvested.

[0244] 7.4 Statistical data of demonstration cultivation

[0245] In different years, investigations and data statistics were carried out at each demonstration site respectively. The main traits of the tested strains were mainly observed, and the yields were statistically analyzed. The yields were statistically analyzed respectively after harvesting. At the same time, a qualified testing company was entrusted to determine the contents of main nutrients, heavy metals, agricultural residues, etc.

[0246] 7.5 Result analysis

[0247] The statistical results are shown in Table 7 and Table 8.

[0248] Table 7 Yields and cultivation cycles at demonstration sites

[0249]

[0250] Table 8 Performance of main agronomic traits of Ganoderma lucidum strain L4966 in demonstration

[0251]

[0252] Notes for Table 7 - Table 8: "M±SD" represents the mean ± standard deviation. 30 bags were randomly selected from each group, and the average weight of single fruiting bodies in yield determination was measured. For the fruiting body traits, 30 fruiting bodies were randomly selected to calculate the average value.

[0253] The demonstration results in four places in two years from 2023 to 2024 show that ( Figure 5): The brighter Ganoderma lucidum strain L4914 and Ganoderma lucidum strain L4966 have unique fruiting body traits. When the cap is not yet differentiated, it resembles Ganoderma lucidum carnosum, with a long stipe, high cultivation stability, and high fruiting rate. The fruiting body is yellowish-brown, the cap is fan-shaped, with obvious radial longitudinal ridges. The average cap length is 10.92 cm and the cap width is 8.82 cm; the flesh is light brownish-brown, with an average flesh thickness of 1.23 cm and a relatively soft texture; the stipe is reddish-brown, with an average length of 11.59 cm, darker in color than the cap, with an average diameter of 1.37 cm. The average fresh weight of a single mushroom is 65.26 g, the average dry weight is 23.6 g, the biological conversion rate is 11.87%, and the average cultivation cycle is 96 days. Compared with Ganoderma lucidum strain L4914, Ganoderma lucidum strain L4966 has a better overall fruiting effect, a longer cycle, a unique mushroom shape, strong ornamental value, and a longer stipe; for Ganoderma lucidum strain L4914, the fruiting body of the bag cultivation has a fan-shaped cap, a short stipe, a thicker cap, with an average cap length of 13.06 cm and a cap width of 10.11 cm; the flesh is grayish-white to light brown, with an average flesh thickness of 1.65 cm, and the average fresh weight of a single mushroom of the fruiting body is 101.64 g, the average dry weight is 44.38 g, and the biological efficiency is 18.48%, and the average cultivation cycle is 87 days; Therefore, Ganoderma lucidum strain L4966 can be promoted and applied as a new variety of Ganoderma lucidum, and can be used as ornamental Ganoderma lucidum and potted Ganoderma lucidum for facility cultivation.

[0254] Specificity: Both Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 are obtained by systematic breeding from wild Ganoderma lucidum in Yunnan Province. As they grow, the flesh gradually changes from grayish-white to light brownish-brown, and their abilities to resist high and low temperatures and suitable growth regions are similar. The cap of Ganoderma lucidum strain L4966 is mostly small fan-shaped with many branches, and each Ganoderma lucidum has 3 - 8 branches. The cap of Ganoderma lucidum strain L4914 is mostly fan-shaped. The stipe of Ganoderma lucidum strain L4966 is slender, and before the cap is differentiated, it resembles Ganoderma lucidum carnosum. The stipe of Ganoderma lucidum strain L4914 is short and thick. Ganoderma lucidum strain L4966 is rich in nutrients, and its polysaccharide content is higher than that of Ganoderma lucidum strain L4914.

[0255] Consistency: Through two years of cultivation demonstration observations, Ganoderma lucidum strain L4966 has consistency.

[0256] Stability: Ganoderma lucidum strain L4966 has consistency and, in principle, has stability.

[0257] 8. Variety Resistance Identification

[0258] 8.1 Identification Method

[0259] Determination of the growth rate of mycelium at high and low temperatures: The Ganoderma lucidum strain L4966 growing on PDA medium and the control strain - Ganoderma lucidum strain L4914 were punched with a 0.5 cm puncher and placed on a new PDA medium for a temperature gradient growth experiment. Eleven culture temperatures were set, namely 5 °C, 10 °C, 15 °C, 20 °C, 22 °C, 24 °C, 26 °C, 28 °C, 30 °C, 32 °C, 35 °C, with 3 replicates at each temperature. After culturing for 8 days, the growth rate was measured.

[0260] Growth rate =

[0261] where R: the diameter of colony growth (mm); T: the culture time (d);

[0262] PDA medium: 200 g of peeled potatoes, 20 g of glucose, 16 g of agar, 2 g of yeast powder, 2 g of peptone, 0.2 g of potassium dihydrogen phosphate, 0.2 g of magnesium sulfate

[0263] Detection method for Aspergillus fumigatus resistance: First, the Ganoderma lucidum strain L4966, the control Ganoderma lucidum strain L4914, and Aspergillus fumigatus were punched with a 0.5 cm puncher on PDA medium. Then they were placed on a new PDA petri dish. On one side of the new PDA petri dish was the Ganoderma lucidum strain, and on the other side, Aspergillus fumigatus was inoculated. There were 3 replicates for each resistance experiment, and the inhibition rate was calculated.

[0264]

[0265] where R CK : the radius of the normal-growing contaminating bacteria (cm); R 1 : the radius of the contaminating bacteria growth in the two-point confrontation experiment (cm)

[0266] 8.2 Results of the low-temperature resistance test

[0267] Table 9 Mycelium growth rates of Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 (unit: mm / d)

[0268]

[0269] Results of low-temperature tolerance test: As can be seen from Table 9, when cultured at temperatures of 5 °C, 10 °C, 15 °C, 20 °C, 22 °C, and 24 °C for 8 days, the mycelial growth rates of Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 were generally consistent. As the temperature increased, the mycelial growth rate became faster. When cultured at low temperatures of 5 °C and 10 °C for 8 days, it could be seen that the mycelial germination and growth of both were relatively slow. As the temperature gradually increased, the mycelial growth rates of Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 gradually became faster, and the growth patterns were consistent. The overall mycelial growth rate of Ganoderma lucidum strain L4914 was faster than that of Ganoderma lucidum strain L4966. Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 were both relatively easy to germinate under low-temperature conditions and had strong low-temperature tolerance.

[0270] 8.3 Results of high-temperature tolerance test

[0271] Table 10 Mycelial growth rates of Ganoderma lucidum strain L4966 and "CK" (unit: mm / d)

[0272]

[0273] Results of high-temperature tolerance test: As can be seen from Table 10, when cultured at temperatures of 26 °C, 28 °C, 30 °C, 32 °C, and 35 °C for 8 days, the mycelial growth rate of Ganoderma lucidum strain L4966 was consistent with that of Ganoderma lucidum strain L4914. As the temperature increased, there were obvious cases of slow mycelial growth and no growth. Under the temperature conditions of 26 °C to 28 °C, the mycelial growth rate of Ganoderma lucidum strain L4966 was higher than that of Ganoderma lucidum strain L4914, and the mycelia of Ganoderma lucidum strain L4966 were denser and whiter than those of Ganoderma lucidum strain L4914. As the temperature increased, the growth rates of both showed a decreasing trend. Under the conditions of 30 °C and 32 °C, the mycelial growth rate of Ganoderma lucidum strain L4966 slowed down compared to that of Ganoderma lucidum strain L4914. When the temperature reached 35 °C, the mycelia of both Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 did not germinate.

[0274] Combined with the results of the low-temperature tolerance test, it was found that the optimal temperature for mycelial culture of Ganoderma lucidum strain L4966 was 24 °C to 26 °C, and the optimal temperature for mycelial culture of Ganoderma lucidum strain L4914 was also 24 °C to 26 °C. Both Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 were not tolerant to high temperatures.

[0275] 8.4 Results of Aspergillus fumigatus resistance test

[0276] Table 11 Inhibitory rates of Ganoderma lucidum strain L4966 and Ganoderma lucidum strain L4914 against Aspergillus fumigatus

[0277]

[0278] Result: From Figure 6 and Table 11, it can be seen that in the antibacterial test of Ganoderma lucidum against Aspergillus fumigatus, the antibacterial rate of Ganoderma lucidum strain L4966 is higher than that of Ganoderma lucidum strain L4914, indicating that Ganoderma lucidum strain L4966 has stronger anti - contamination ability. In seed production, it has a low contamination rate, a fast mycelium growth rate on the medium and is not easily infected by miscellaneous bacteria, with strong anti - contamination ability; and in multiple batches of breeding and cultivation tests, there are fewer infections by miscellaneous bacteria and occurrences of pests and diseases. Therefore, it is recorded that Ganoderma lucidum strain L4966 has relatively strong disease - resistance ability.

[0279] The mycelium of Ganoderma lucidum strain L4966 has strong growth vigor, fast germination speed, fast growth rate, a higher antibacterial rate against Aspergillus fumigatus than Ganoderma lucidum strain L4914, and strong stress resistance. The mycelium can grow normally between 10~32 °C. The characteristics of the mycelium's resistance to low and high temperatures are consistent with those of Ganoderma lucidum strain L4914. The optimal growth temperature of the mycelium is 24~26 °C, and the mycelium does not germinate when the temperature is lower than 5 °C or higher than 35 °C; in actual cultivation, it is found that the fruiting temperature of the fruiting body is 18~28 °C, and the optimal fruiting temperature is 22~26 °C.

[0280] 9. Distinctive identification

[0281] 9.1 Solid - culture characteristics

[0282] After the mother - culture PDA medium is prepared and mixed evenly, it is sterilized at 121 °C and 0.103 MPa for 30 min, and then poured into 90 - mm petri dishes to make plates. After activating Ganoderma lucidum strain L4966, it is transferred to the mother - culture PDA medium, and after the mycelium fills the petri dish, it is set aside. A single - factor experiment is carried out on the shake - flask seed medium.

[0283] 9.1.1 Single - factor experiment on carbon source

[0284] The basic medium includes the following raw materials by weight parts: 200 parts of potato, 20 parts of glucose, 2 parts of peptone, 0.2 part of magnesium sulfate, and 1000 parts of water;

[0285] On the basis of the basal medium, glucose was not added as a blank control, and maltose, lactose, sucrose, and soluble starch were added respectively to replace glucose as the test media. A puncher with a diameter of 7 mm was used to punch holes, and the bacterial blocks were inoculated in the center of the solid medium and placed in a constant temperature incubator at 22 °C for dark cultivation. Five replicates were set for each group of experiments. The cross-streaking method was used to measure the colony diameter once every 24 h; the mycelial morphology and growth vigor were observed and recorded, and the Duncan method of SPSS 20.0 software was used to compare the significant differences (P<0.05), and the column chart of mycelial growth rate was made using Excel 2019. The formula for the mycelial growth rate (V) is:

[0286] (1)

[0287] In the formula:

[0288] L: Colony diameter (cm);

[0289] D: Number of culture days (d);

[0290] 7: The diameter of the inoculated bacterial block is 7 mm.

[0291] 9.1.2 Single-factor experiment on nitrogen source

[0292] On the basis of the basal medium, peptone was not added as a blank control, and ammonium chloride, ammonium sulfate, yeast powder, and urea were used to replace peptone as the test media respectively. The methods of inoculation, cultivation, setting replicates, and data processing were the same as those in 9.1.1.

[0293] 9.1.3 Single-factor experiment on inorganic salts

[0294] On the basis of the basal medium, magnesium sulfate was not added as a blank control, and ferric chloride, calcium carbonate, zinc sulfate heptahydrate, and sodium chloride were used to replace magnesium sulfate as the test media respectively. The methods of inoculation, cultivation, setting replicates, and data processing were the same as those in 9.1.1.

[0295] 9.1.4 Single-factor experiment on temperature

[0296] The bacterial blocks were inoculated into the basal medium and placed in a constant temperature incubator at 20 °C, 22 °C, 24 °C, 26 °C, and 28 °C respectively for dark cultivation. The methods of inoculation, cultivation, setting replicates, and data processing were the same as those in 9.1.1.

[0297] 9.1.5 Single-factor experiment on pH value

[0298] Adjust the pH values of the basal medium to 5.0, 5.5, 6.0, 6.5, and 7.0 using HCl (1 mol·L-1) and NaOH (1 mol·L-1) as the test media. The methods of inoculation, cultivation, setting replicates, and data processing are the same as in 9.1.1.

[0299] 9.1.6 Result Analysis

[0300] (1) Carbon Source

[0301] The effects of different carbon sources on the mycelial growth rate are as follows Figure 7 .

[0302] As Figure 7 can be seen, when glucose is used as the carbon source, the mycelial growth rate is the fastest at (6.20 ± 0.15) mm / d, and when soluble starch is used as the carbon source, the mycelial growth rate is the slowest at (4.61 ± 0.47) mm / d. There are significant differences between the two and other carbon sources (p < 0.05).

[0303] (2) Nitrogen Source

[0304] The effects of different nitrogen sources on the mycelial growth rate are as follows Figure 8 .

[0305] As Figure 8 can be seen, when peptone is used as the nitrogen source, the mycelial growth rate is the fastest at (6.30 ± 0.0.37) mm / d, and there is no significant difference from ammonium chloride and ammonium sulfate. When urea is used as the nitrogen source, the mycelial growth rate is the slowest at (0.77 ± 0.45) mm / d, and there is no significant difference from yeast powder, but there are significant differences from other nitrogen source conditions (P < 0.05).

[0306] (5) Inorganic Salts

[0307] The effects of different inorganic salts on the mycelial growth rate are as follows Figure 9 .

[0308] As Figure 9 can be seen, when ferric chloride is used as the inorganic salt, the growth rate is the fastest at (7.02 ± 0.24) mm / d, and there is no significant difference from sodium chloride and magnesium sulfate, but there are significant differences from other inorganic salts (P < 0.05). When ferrous sulfate is used as the inorganic salt, the mycelial growth rate is the slowest at (3.64 ± 0.42) mm / d.

[0309] (4) Temperature

[0310] The effects of different temperatures on the mycelial growth rate are as follows Figure 10 .

[0311] As Figure 10It can be seen that as the temperature gradually increases, the mycelial growth rate shows a trend of first increasing and then decreasing; when the temperature is 22 °C, the mycelial growth rate is the fastest at (6.72 ± 0.28) mm / d. When the temperature is 18 °C - 20 °C, the growth rate is relatively slow, showing a significant difference from 24 °C - 26 °C.

[0312] (5)pH value

[0313] The effects of different pH values on the mycelial growth rate are as follows Figure 11 .

[0314] It can be seen from Figure 11 that when the pH value is 6.5, the mycelial growth rate is the fastest, at (6.57 ± 0.14) mm / d, showing a significant difference from other pH value conditions. When the pH value is 5.0, the growth rate is the slowest, at (4.37 ± 0.12) mm / d, showing no significant difference from the pH value conditions of 5.5 and 6.0, but showing a significant difference from the remaining pH value conditions (P < 0.05).

[0315] 10. Quality analysis

[0316] Statistical analysis of the nutrients and functional components of Ganoderma lucidum strain L4966 with bright caps and the control Ganoderma lucidum strain L4914. The quality analysis report is shown in Table 12.

[0317] Table 12 Composition statistics of Ganoderma lucidum strain L4966 with bright caps and the control Ganoderma lucidum strain L4914

[0318]

[0319] Note: * Essential amino acids

[0320] After the Ganoderma lucidum strain L4966 and "Ganoderma lucidum strain L4914" sampled during the growth to maturity stage in 2023 were dried at low temperature, the dried products were sent to the Guangdong Provincial Microbial Analysis and Testing Center for determination. The total amount of 16 amino acids in Ganoderma lucidum strain L4966 was 12.10 g / 100 g, and the total amount of 16 amino acids in Ganoderma lucidum strain L4914 was 11.80 g / 100 g; the protein in Ganoderma lucidum strain L4966 was 17.00 g / 100 g, and the protein in Ganoderma lucidum strain L4914 was 12.80 g / 100 g; the fat in Ganoderma lucidum strain L4966 was 0.80 g / 100 g, and the fat content in Ganoderma lucidum strain L4914 was 1.30 g / 100 g; the polysaccharide in Ganoderma lucidum strain L4966 was 1.68%, and the polysaccharide in Ganoderma lucidum strain L4914 was 1.20%; the triterpenoids and sterols in Ganoderma lucidum strain L4966 were 2.83%, and the triterpenoids and sterols in Ganoderma lucidum strain L4914 were 2.90%; the fat content of Ganoderma lucidum strain L4966 was lower than that of Ganoderma lucidum strain L4914; the contents of total amino acids, protein, and Ganoderma lucidum polysaccharide were higher than those of Ganoderma lucidum strain L4914; the contents of triterpenoids and sterols were basically the same as those of Ganoderma lucidum strain L4914, slightly lower than those of Ganoderma lucidum strain L4914.

[0321] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A strain of Ganoderma lucidum ( Ganoderma lucidum ) A cultivation method of L4966, characterized in that, The Ganoderma lucidum strain L4966 was deposited in the Guangdong Provincial Microbiological Culture Collection Center of China on September 11, 2024, with the deposit number GDMCC No: 65097.

2. The cultivation method of the Ganoderma lucidum strain L4966 according to claim 1, characterized in that: The steps include: Step A, mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4966 and inoculate it on the mother culture PDA medium, place it in a constant temperature culture at 22°C for 7-10 days to obtain mycelium blocks; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 21.5-22.5°C for 7-10 days to obtain seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts of potato, 19-21 parts of glucose, 1.9-2.1 parts of peptone, 0.39-0.41 parts of potassium dihydrogen phosphate, 0.19-0.21 parts of ferric chloride, 990-1010 parts of water, and the pH is 6.3-6.7; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 21.5-22.5° C. for 8-11 days, to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of glucose, 190-210 parts of peptone, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of ferric chloride, 99000-101000 parts of water, and the pH value is 6.3-6.7; Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place the bag in a culture room at 24°C for 33-38 days; The cultivation matrix in the cultivation bag includes the following raw materials by weight: 75-77 parts of sawdust, 1.8-2.2 parts of cottonseed hulls, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.9-1.1 parts of lime powder; pH value 6-8, water content 55-65%; Step E, soil covering cultivation and harvesting: after the cultivation bags are full of mycelium, they are transported to the cultivation base, piled on the ground of the shaded greenhouse for further ripening for 5-7 days, and then the bags are opened with small holes and covered with soil for planting. The light intensity is adjusted through the shade net. The light intensity is controlled at 500-800 Lux during the bud stage and the stipe differentiation stage. When the stipe grows to 10-15 cm and enters the cap differentiation stage, the light intensity is controlled at 1800-2200 Lux. The soil moisture is maintained at 20-30%, the air humidity is 70-90%, the temperature is 18-28° C., and the CO2 concentration is less than 0.06%. When the light yellow growth circle on the edge of the cap disappears and spores are ejected, the fruiting body can be harvested.

3. The cultivation method of the Ganoderma lucidum strain L4966 according to claim 2, characterized in that: In step E, the cultivation base is a greenhouse, and 5,000 to 6,000 bags are planted per acre in the greenhouse.

4. The cultivation method of the Ganoderma lucidum strain L4966 according to claim 2, characterized in that: In step E, the stacking layer height does not exceed 3 layers.

5. The cultivation method of the Ganoderma lucidum strain L4966 according to claim 2, characterized in that: In step E, if the Ganoderma lucidum strain L4966 is planted as a bonsai of ornamental Ganoderma lucidum, 1 to 5 fungus sticks can be planted in each pot.

6. The cultivation method of the Ganoderma lucidum strain L4966 according to claim 2, characterized in that: In step E, the seeds can be harvested 95-97 days after planting and covering with soil.

Images