dsRNA targeting the key regulatory gene RTB-JHEH of juvenile hormone of Dendroctonus rubrum and its preparation method and application

Abstract

The invention belongs to the field of forestry biotechnology and provides a method for targeting the key regulatory gene of juvenile hormone of red beetle. RTB-JHEH The present invention utilizes RNA interference technology to interfere with the key regulatory genes of pests. RTB-JHEH The expression of proteins can affect the growth and development of pests, thereby achieving control of pest populations. Compared with traditional chemical pesticides, it has higher precision and environmental friendliness and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the field of forestry biotechnology, and specifically relates to a method for targeting the key regulatory gene of juvenile hormone of red beetle RTB-JHEH dsRNA and its preparation method and application. Background Art

[0002] Dendroctonus rubrum Dendroctonus valens LeConte, also known as the powerful beetle, English name Red Turpentine Beetle (RTB), belongs to the order Coleoptera, family Curculionidae, subfamily Scolytinae, genus Scolytinae ( Dendroctonus ), with larvae and adults feeding on phloem at the base and roots of the affected tree trunks, causing the host phloem to be cut off from nutrient transport and die. The red lip beetle was introduced to my country from North America in 1998. It is a harmless secondary pest in its native habitat, but it is extremely harmful to Chinese pine in its newly invaded areas. It is the most destructive Chinese pine pest and poses a serious threat to China's forest ecological security.

[0003] RNA interference (RNAi) technology is a gene silencing method that studies the function of specific genes by inhibiting their expression. The basic principle is to use double-stranded RNA (dsRNA, Double-stranded RNA) to complement and bind to specific mRNA sequences and mediate their degradation or inhibit their translation, thereby inhibiting the expression of target genes. In forest pest control, RNAi technology can be used to create insect-resistant tree species or directly applied to pest management. By designing specific RNA molecules, pest genes can be silenced in a targeted manner, thereby interfering with the normal physiological processes of pests or increasing their sensitivity to pesticides. RNAi technology has higher specificity and environmental friendliness, can reduce the impact on non-target organisms, and is expected to reduce the excessive use of pesticides. Therefore, RNAi technology has great potential in forest pest control and provides a new solution for achieving sustainable forestry development. Summary of the invention

[0004] The purpose of the present invention is to provide a method for targeting the key regulatory gene of juvenile hormone of Dendroctonus rubrum RTB-JHEH dsRNA and its preparation method and application.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a method for targeting the key regulatory gene of juvenile hormone of Dendroctonus rubrum RTB-JHEH (Gene RTB-JHEHThe dsRNA of the present invention is shown in SEQ ID NO:6, and the nucleotide sequence encoding the dsRNA is shown in SEQ ID NO:9.

[0006] In a second aspect, the present invention provides biological materials containing the dsRNA or a nucleotide sequence encoding the dsRNA, wherein the biological materials include but are not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria or transgenic cell lines.

[0007] In a third aspect, the present invention provides a method for preparing the dsRNA, the method comprising the following steps:

[0008] 1) Extract total RNA from Dendroctonus rubrum and reverse transcribe it into cDNA;

[0009] 2) using cDNA as a template, performing PCR amplification using primers shown in SEQ ID NOs: 1 and 3 and primers shown in SEQ ID NOs: 2 and 4 respectively;

[0010] 3) Using the two amplified products obtained in 2) as forward template and reverse template, respectively, dsRNA was synthesized in vitro.

[0011] In a fourth aspect, the present invention provides the use of the dsRNA or the nucleotide sequence encoding the dsRNA or the biological material containing them in the preparation of a preparation for controlling Dendroctonus rubrum.

[0012] In a fifth aspect, the present invention provides a preparation or a kit for controlling Dendroctonus rubrum, wherein the preparation or the kit comprises the dsRNA or a nucleotide sequence encoding the dsRNA or a biological material containing them.

[0013] In a sixth aspect, the present invention provides a method for controlling Dendroctonus erythrorhizon, using the dsRNA or the nucleotide sequence encoding the dsRNA or the biological material containing them, and adopting injection method, spraying method or feeding method to control Dendroctonus erythrorhizon.

[0014] Furthermore, the effective dose of the dsRNA is ≥2.5 μg per mouse.

[0015] In the present invention, the control objects include the larvae of Dendroctonus rubrum.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0017] (I) The present invention interferes with the key regulatory gene of juvenile hormone in pests RTB-JHEH The expression of can affect the growth and development of pests, thereby achieving control of pest populations, and has lower non-target effects than traditional pesticides.

[0018] (ii) Due to the high specificity of the present invention, the pollution and impact of chemical pesticides on the environment and non-target organisms can be reduced, which helps to protect the health of the ecological environment.

[0019] (III) The present invention may cause long-term growth and reproduction stunting of pest populations through gene interference, which may have a more lasting effect than chemical pesticides, reduce the need for frequent application of pesticides, save costs, and reduce potential risks to the environment and human health.

[0020] (iv) dsRNA is highly targeted and can accurately act on juvenile hormone-related genes or signal pathways in the target organism, achieving precise biological regulation, thereby improving the regulatory effect.

[0021] (V) Since the dsRNA of the present invention can be prepared by biosynthesis, its production process may be sustainable, reducing dependence on chemical synthesis raw materials, which is conducive to the goal of sustainable development. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The red lipid beetle injected with dsRNA in the preferred embodiment of the present invention RTB-JHEH Gene expression levels.

[0023] Figure 2 The red beetle sprayed with dsRNA in a preferred embodiment of the present invention RTB-JHEH Gene expression levels.

[0024] Figure 3 The red fat beetle fed with dsRNA in the preferred embodiment of the present invention RTB-JHEH Gene expression levels.

[0025] Figure 4 This is a morphological diagram of the abnormal emergence of Dendroctonus rubrum after injection of dsRNA in a preferred embodiment of the present invention.

[0026] DETAILED DESCRIPTION

[0027] The invention provides a new method for improving the control effect of Dendroctonus rubrum.

[0028] The present invention adopts the following technical solution:

[0029] The present invention provides a key regulatory gene for juvenile hormone targeting the gene of Dendroctonus rubrum RTB-JHEH The dsRNA is composed of a first RNA molecule and a second RNA molecule that are complementary to each other.

[0030] The present invention provides a primer set for preparing the dsRNA ( RTB-JHEHA primer set), wherein the primer set comprises a first primer pair and a second primer pair;

[0031] The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO: 1, and is specifically as follows:

[0032] 5′-GGATCCTAATACGACTCACTATAGGGGGGCCTACGTTGGCATGTACT-3′;

[0033] The nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO: 3, and is specifically as follows: 5′-TTAAGTTGGGGTGCTGTTCC-3′;

[0034] The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO: 2, and is as follows:

[0035] 5′-GGCCTACGTTGGCATGTACT-3′;

[0036] The nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO: 4, and is specifically as follows: 5′-GGATCCTAATACGACTCACTATAGGGTTAAGTTGGGGTGCTGTTCC-3′.

[0037] Among them, GGATCCTAATACGACTCACTATAGGG (SEQ ID NO: 5) is the T7 promoter.

[0038] The present invention provides a method for preparing the dsRNA, comprising the following steps:

[0039] (1) using the cDNA of Dendroctonus rubrum as a template and using the first primer pair to perform a first PCR amplification to obtain a first synthetic template;

[0040] (2) using the cDNA of Dendroctonus rubrum as a template and using the second primer pair to perform a second PCR amplification to obtain a second synthetic template;

[0041] (3) using the first synthetic template and the second synthetic template to obtain the first RNA molecule and the second RNA molecule;

[0042] (4) renaturing the first RNA molecule and the second RNA molecule to obtain the RTB-JHEH dsRNA.

[0043] In the present invention, the reaction procedures of the first PCR amplification and the second PCR amplification preferably include: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0044] The present invention has no special requirements for the method of dsRNA synthesis, and a method known to those skilled in the art can be used. In the embodiment of the present invention, the Vazyme T7 RNAi Transcription Kit is preferably used to synthesize dsRNA.

[0045] The present invention also provides use of the dsRNA or the primer set or the dsRNA prepared according to the method in preventing and controlling Dendroctonus rubrum.

[0046] The dsRNA provided by the present invention can effectively silence Dendroctonus rubrum RTB-JHEH Gene. 12h after injection of dsJHEH RTB- JHEH The relative expression of the gene decreased by 98.64%, and the silencing effect remained as time went by; 24 h after spraying dsJHEH RTB-JHEH The relative expression of the gene decreased by 75.38% after 48 h of feeding dsJHEH RTB-JHEH The relative expression level of the gene was reduced by 92.04%, which can restrict the growth and development of the red lipid beetle and affect the further life activities of the larvae, ultimately achieving the effect of prevention and control, and providing new ideas for the green prevention and control of forestry pests.

[0047] The present invention also provides the use of the dsRNA or the primer set or the dsRNA prepared according to the method in preparing a preparation for preventing and controlling Dendroctonus rubrum.

[0048] The present invention provides a preparation for preventing and controlling Dendroctonus rubrum. The preparation comprises the dsRNA, or the dsRNA prepared by the primer combination, or the dsRNA prepared by the method. In the present invention, the recommended effective dose of the dsRNA is ≥2.5 μg per beetle.

[0049] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0050] Example 1 RTB-JHEH Cloning and dsRNA synthesis

[0051] Dendroctonus rubrum RTB-JHEH Gene sequence (SEQ ID NO:6), designed and synthesized Dendroctonus rubrum RTB-JHEH The forward primer (SEQ ID NO: 7) and the reverse primer (SEQ ID NO: 8) of SEQ ID NO: 1 were used to amplify the full-length sequence of 3179 bp (SEQ ID NO: 6). The target sequence (SEQ ID NO: 9) with a fragment length of 473 bp was amplified by the first primer pair and the second primer pair, and the target sequence (SEQ ID NO: 10) with a fragment length of 473 bp was obtained by an in vitro dsRNA synthesis kit. RTB-JHEH dsRNA of the gene.

[0052] The specific synthesis steps are as follows: a T7 promoter sequence (SEQ ID NO: 5) is added to the 5′ end of the specific primer, and two amplification products are obtained by cross-pairing PCR amplification with primers with T7 and primers without T7 (i.e., PCR amplification is performed with two pairs of primers shown in SEQ ID NOs: 1 to 4, respectively); the template for PCR amplification is the total RNA of Dendroctonus rubrum larvae extracted using the Yeasen total RNA extraction kit (refer to the reagent instructions of the cell / tissue total RNA extraction kit), and then the total RNA of Dendroctonus rubrum larvae is extracted using the Hifair RNA extraction kit of Yeasen Company. ® Ⅱ 1st Strand cDNA Synthesis Kit was used for reverse transcription into cDNA; the PCR amplification system was as follows: PCR 2 × Phanta Max Buffer (Novozyme) 25 μl, forward and reverse primers 2 μl each (concentration 10 μM), cDNA template 1 μl, ddH 2 O to 50 μl; the reaction procedure is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min. The two amplification products obtained can be used as forward template and reverse template to synthesize dsRNA respectively after electrophoresis detection and confirmation (refer to the instructions of the Novozyme T7 RNAi Transcription Kit), and the dsRNA concentration is detected by a micro-spectrophotometer, and 1 μL of dsRNA is taken for confirmation by 1% agarose gel electrophoresis detection and stored at -80℃ for future use.

[0053] The control used dsRNA of EGFP gene, and the synthesis method was as mentioned above. RTB-JHEH The template is a plasmid containing an EGFP gene fragment. The forward primer of the first primer set is: 5′-GGATCCTAATACGACTCACTATAGGGATGGTGAGCAAGGGCGAGG-3′ (SEQ ID NO: 10),

[0054] The reverse primer is: 5′-

[0055] CTTGTACAGCTCGTCCATGC-3' (SEQ ID NO: 11).

[0056] The second primer set forward primer is: 5'-ATGGTGAGCAAGGGCGAGG-3' (SEQ ID NO: 12)

[0057] The reverse primer is: 5′-GGATCCTAATACGACTCACTATAGGGCTTGTACAGCTCGTCCATGC-3′ (SEQ ID NO: 13)

[0058] Example 2 Dendroctonus rubrum RTB-JHEH Detection of gene silencing effects

[0059] The synthesized RTB-JHEH The dsRNA of the EGFP gene synthesized in Example 1 (denoted as dsEGFP, 2.5 μg / mouse) and ddH 2 O (1.5 μL / bird), spraying and feeding experiments were carried out on Dendroctonus rubrum larvae, and microinjection was performed into the second intersegmental membrane of the abdomen of different Dendroctonus rubrum larvae. At 12h, 24h, and 48h after spraying, feeding, and injection, the whole larvae were quickly frozen in liquid nitrogen and placed at -80℃ for later use.

[0060] The total RNA of Dendroctonus rubrum larvae was extracted using Yeasen total RNA extraction reagent (refer to the instructions of the cell / tissue total RNA extraction kit reagent), and then the total RNA of Dendroctonus rubrum larvae was extracted using Yeasen's Hifair ® Ⅱ 1st Strand cDNA Synthesis Kit was reverse transcribed into cDNA, which was used as a template for quantitative RT-PCR detection after injection. RTB-JHEH The expression level of the gene. The JHEH primer sequences involved in qRT-PCR are F: 5'-CCGCTTGCCCAGGTAGGATT-3' (SEQ ID NO: 14), R: 5'-TGTAATGAGGTCCACGCT-3' (SEQ ID NO: 15). Amplification program: 95℃ pre-denaturation for 1min; 94℃ denaturation for 100s, 60℃ annealing for 20s, 35 cycles.

[0061] Dendroctonus rubrum injected with dsRNA RTB-JHEH Gene expression levels Figure 1 shown.

[0062] Dendroctonus rubrum sprayed with dsRNA RTB-JHEH Gene expression levels Figure 2 shown.

[0063] Dendroctonus rubrum fed dsRNA RTB-JHEH Gene expression levelsFigure 3 shown.

[0064] The abnormal morphology of Dendroctonus rubrum after injection of dsRNA is shown in the figure Figure 4 shown.

[0065] The mortality rate of Dendroctonus rubrum after injection of dsRNA is shown in Table 1.

[0066] The mortality rate of Dendroctonus rubrum after spraying dsRNA is shown in Table 2.

[0067] The mortality rate of Dendroctonus rubrum after feeding dsRNA is shown in Table 3.

[0068] Table 1 Mortality of Dendroctonus rubrum after dsRNA injection

[0069]

[0070] Table 2 Mortality of Dendroctonus rubrum after spraying dsRNA

[0071]

[0072] Table 3 Mortality of Dendroctonus rubrum after feeding dsRNA

[0073]

[0074] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Targeting the key regulatory genes of juvenile hormone in Dendroctonus rubrum RTB-JHEH The dsRNA is characterized in that The nucleotide sequence encoding the dsRNA is shown in SEQ ID NO:

9.

2. A biological material containing the dsRNA according to claim 1 or a nucleotide sequence encoding the dsRNA, characterized in that: The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineering bacteria or transgenic cell line.

3. The method for preparing dsRNA according to claim 1, characterized in that: The following steps are involved: 1) Extract total RNA from Dendroctonus rubrum and reverse transcribe it into cDNA; 2) using cDNA as a template, performing PCR amplification using primers shown in SEQ ID NOs: 1 and 3 and primers shown in SEQ ID NOs: 2 and 4 respectively; 3) Using the two amplified products obtained in 2) as forward template and reverse template, respectively, dsRNA was synthesized in vitro.

4. Use of the dsRNA according to claim 1 or the nucleotide sequence encoding the dsRNA or the biological material according to claim 2 in preparing a preparation for controlling Dendroctonus rubrum.

5. A preparation or kit for controlling Dendroctonus rubrum, characterized in that: The preparation or kit comprises the dsRNA according to claim 1 or a nucleotide sequence encoding the dsRNA or the biological material according to claim 2.

6. A method for preventing and controlling Dendroctonus rubrum, characterized in that: The dsRNA according to claim 1 or the nucleotide sequence encoding the dsRNA or the biological material according to claim 2 is used to control Dendroctonus dendrobatidis by injection, spraying or feeding.

7. The method according to claim 6, characterized in that The effective dose of the dsRNA is ≥2.5 μg per mouse.

8. The method according to claim 6 or 7, characterized in that: The targets of prevention and control include the larvae of red lip beetle.

Images