Application of Trichomonas vaginalis target genes, primer and probe combinations and kits

By designing highly specific primer-probe combinations and combining them with real-time quantitative PCR technology, the problems of long detection time and low sensitivity of Trichomonas vaginalis have been solved, achieving highly sensitive detection of urine samples. It is applicable to urine, urethral swabs, and vaginal swabs, and can be coupled with Mycoplasma genitalium and Mycoplasma hominis for detection, exhibiting high specificity and low cross-reactivity.

CN119040497BActive Publication Date: 2026-04-17AUTOBIO DIAGNOSTICS CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
AUTOBIO DIAGNOSTICS CO LTD
Filing Date
2024-09-20
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies for detecting Trichomonas vaginalis suffer from problems such as long detection time or low sensitivity, especially insufficient sensitivity for urine samples, and most test reagents have problems with cross-reactivity and low sensitivity.

Method used

A highly specific primer-probe combination was designed targeting the Mariner transposase mar1 hypothetical transposase gene, repellent protein 1 family gene, and integrase core domain gene of Trichomonas vaginalis. Combined with real-time quantitative PCR technology, it can achieve highly sensitive detection of urine samples and can be combined with primer-probe combinations for Mycoplasma genitalium and Mycoplasma hominis for joint detection.

Benefits of technology

It enables rapid and accurate detection of Trichomonas vaginalis within 1 hour, with higher detection sensitivity than similar kits. It is compatible with fully automated platforms and can be stored at 2–8℃ for 1 year. It is suitable for urine, urethral swabs, and vaginal swabs, and has high specificity and low cross-reactivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005052004210000031
    Figure BDA0005052004210000031
  • Figure BDA0005052004210000032
    Figure BDA0005052004210000032
  • Figure BDA0005052004210000071
    Figure BDA0005052004210000071
Patent Text Reader

Abstract

This invention relates to the field of molecular detection technology, and particularly to the application of Trichomonas vaginalis target genes, primer-probe combinations, and kits. This invention provides a novel application of Trichomonas vaginalis target genes in the detection of Trichomonas vaginalis, and its specific primer-probe design. The primers and probes described in this invention have high specificity, exhibiting no cross-reactivity with closely related species and common pathogens of the urogenital tract. They also possess advantages such as rapid detection speed and high sensitivity, achieving detection results within 1 hour using real-time fluorescence PCR, and can detect as few as a single Trichomonas vaginalis. This invention also provides a kit with high detection sensitivity, enabling the detection of Trichomonas vaginalis even in urine samples. It can also be combined with primers and probes for Mycoplasma genitalium and / or Mycoplasma hominis to form primer-probe combinations.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology, and in particular to the application of Trichomonas vaginalis target genes, primer-probe combinations, and kits. Background Technology

[0002] Trichomonas vaginalis (TV) is a single-celled protozoan parasite that infests the human urogenital system, primarily the vagina in women and the urethra in men. Infection with Trichomonas vaginalis not only causes inflammatory infections such as vaginitis, urethritis, and pelvic inflammatory disease, but untreated or persistent trichomoniasis in women is associated with infertility and can lead to perinatal complications such as premature rupture of membranes and premature birth. Furthermore, Trichomonas vaginalis infection increases the risk of HIV infection, cervical intraepithelial neoplasia, and post-hysterectomy infection. One study showed a link between maternal Trichomonas vaginalis infection and intellectual disability in children. Trichomonas vaginalis infection is also a significant cause of non-gonococcal urethritis in men. Transmission of Trichomonas vaginalis is primarily through direct sexual intercourse, but can also be indirect through contaminated towels, public baths, swimming pools, toilet seats, bathtubs, and other contaminated items.

[0003] Accurate diagnosis of Trichomonas vaginalis infection is of great significance in preventing the spread of the disease. Commonly used examination methods for diagnosing Trichomonas vaginalis include: (1) Microscopic examination. Active Trichomonas vaginalis can be seen. It has high specificity, but the sensitivity is only 50% to 60%. It is important to keep the tube warm and read it within 10 minutes after collection, because the Trichomonas vaginalis quickly loses its motility. Inactive Trichomonas vaginalis is difficult to distinguish from white blood cells. (2) Culture method. The diagnostic sensitivity is 75% to 96%, and the specificity is as high as 100%. However, due to its long culture cycle and high cost, it is rarely used in clinical practice. (3) Rapid diagnostic techniques. These include immunochromatographic test strips, colloidal gold rapid detection, latex agglutination test, nucleic acid probe hybridization, etc. Although the detection time is short, the sensitivity is low. (4) Nucleic acid amplification test (NAAT), including PCR, qPCR, transcription-mediated amplification (TMA), etc. The diagnostic sensitivity and specificity are both over 95%. It only requires the preservation of nucleic acid, without the need to obtain a living organism, so the requirements for sample storage and processing are low. At the same time, due to its ability to amplify trace amounts of nucleic acid, it can also detect asymptomatic patients with low infection levels.

[0004] Methods for detecting Trichomonas vaginalis using PCR, such as melting curve assays, nested PCR, high-throughput sequencing, microfluidic chip assays, and isothermal amplification methods (LAMP, RPA), suffer from drawbacks such as long detection times or low sensitivity. Real-time quantitative PCR (qPCR) has become the simplest, fastest, and most reliable nucleic acid detection method, and is currently the most widely used in nucleic acid diagnostics both domestically and internationally. Currently, qPCR is used to detect Trichomonas vaginalis in samples including male urinary tract secretions, female vaginal secretions, and urine. However, male urethral sample collection is uncomfortable, and women have poor tolerance for routine posterior vaginal fornix sampling via speculum examination. Urine samples require highly sensitive reagents. Furthermore, most current reagents have low sensitivity; therefore, there is an urgent need to develop a highly sensitive kit that is compatible with urine samples. Summary of the Invention

[0005] In view of this, the present invention provides the application of the target gene of Trichomonas vaginalis, primer-probe combinations, and kits. The present invention provides primer-probe combinations, combination reagents, and kits for the detection of Trichomonas vaginalis. The present invention utilizes a novel Trichomonas vaginalis target gene to design highly sensitive and specific primers-probes, enabling the detection of Trichomonas vaginalis even in urine samples. Furthermore, it can be combined with primers and probes for Mycoplasma genitalium and / or Mycoplasma hominis to form primer-probe combinations.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of one or more of the Mariner transposase mar1 putative transposase gene (Marinertransposase gene), repellent protein1 family gene (repellent gene), and / or integrase core domain gene (int ergase gene) as target genes in the detection of Trichomonas vaginalis.

[0008] The Mariner transposase mar1 hypothesized transposase gene, repellent protein 1 family genes, and genes containing the core domain of the integrase enzyme respectively possess the following characteristics:

[0009] (I) Nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.5, and SEQ ID NO.9; and / or

[0010] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0011] (III) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and which has the same or similar function to the nucleotide sequence shown in (I) or (II); or

[0012] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequences described in (I), (II) or (III).

[0013] This invention also provides a primer-probe combination, comprising:

[0014] (I) Specific primer pairs having nucleotide sequences as shown in SEQ ID NO.(n) and SEQ ID NO.(n+1);

[0015] A specific probe having the nucleotide sequence shown in SEQ ID NO.(n+2); or

[0016] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0017] (III) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and which has the same or similar function to the nucleotide sequence shown in (I) or (II); or

[0018] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequences described in (I), (II) or (III);

[0019] The number n includes any one or more of 2, 6, 10, 39, or 43.

[0020] In some specific embodiments of the present invention, the primer-probe combination further includes primer pairs for amplifying and detecting internal reference genes and specific probes, wherein the internal reference genes include one or more of hemoglobin subunit beta, GAPDH, β-actin, or tubulin.

[0021] In some specific embodiments of the present invention, the primer-probe combination further includes:

[0022] (I) An internal reference primer pair having the nucleotide sequences shown in SEQ ID NO.14 and SEQ ID NO.15;

[0023] Specific probes having the nucleotide sequence shown in SEQ ID NO.16; or

[0024] (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0025] (III) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and which has the same or similar function to the nucleotide sequence shown in (I) or (II); or

[0026] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequences described in (I), (II) or (III).

[0027] In some specific embodiments of the present invention, the target gene amplified by the internal reference primer pair is the hemoglobinsubunit beta gene.

[0028] The present invention also provides the application of the primer-probe combination in the preparation of reagents or kits for detecting and / or identifying Trichomonas vaginalis, Mycoplasma genitalium, and / or Mycoplasma hominis.

[0029] In some specific embodiments of the present invention, the specific probe for amplifying and detecting the internal reference gene and the probe for amplifying and detecting Trichomonas vaginalis, Mycoplasma genitalium and / or Mycoplasma hominis carry fluorescent reporter groups that do not interfere with each other.

[0030] The present invention also provides the application of the primer-probe combination in the preparation of reagents or kits for detecting trichomonal vaginitis.

[0031] The present invention also provides a combination reagent, including the primer-probe combination described above.

[0032] This invention also provides a kit, comprising any of the following and PCR reaction reagents:

[0033] (I) the primer-probe combination; and / or

[0034] (II) The aforementioned combined reagents.

[0035] In some specific embodiments of the present invention, the PCR reaction reagent includes one or more of DNA polymerase, enzyme activator, or dNTPs. Preferably, the PCR reaction reagent further includes PCR buffer (common PCR buffers consist of buffer systems such as Tricine, DMSO, Tween 20, glycerol, betaine, potassium acetate, Tris-HCl, or Triton X-100). Preferably, the DNA polymerase includes Taq polymerase or Tth DNA polymerase; the enzyme activator includes Mg... 2+ and / or Mn2 + .

[0036] In some specific embodiments of the present invention, the PCR reaction reagents described above also include UDG enzyme.

[0037] In some specific embodiments of the present invention, the reaction system of the kit includes:

[0038]

[0039] In some specific embodiments of the present invention, the PCR reaction procedure includes:

[0040]

[0041] This invention also provides a method for detecting Trichomonas vaginalis or trichomonal vaginitis, comprising the following steps:

[0042] Step 1: Obtain the DNA from the sample to be tested;

[0043] Step 2: Amplify the DNA of the sample to be tested using the kit described above in real-time fluorescence quantitative PCR to obtain the Ct value. If the Ct value is ≤39, it is determined that Trichomonas vaginalis is detected; otherwise, it is determined that it is not detected.

[0044] In this invention, the sample type used for detection can be a cervical swab, vaginal swab, urethral swab, urine, etc., but is not limited to these.

[0045] This invention provides, but is not limited to, the following beneficial effects:

[0046] This invention designs primer-probe combinations capable of specifically detecting Trichomonas vaginalis alone, or in combination with Mycoplasma genitalium and / or Mycoplasma hominis, with human genes serving as internal controls. Primers and probes are designed on the following genes: the Mariner transposase mar1 putative transposase gene (a highly repetitive sequence in Trichomonas vaginalis from the Tc1 / Mariner transposon superfamily), the repellent protein 1 family (a gene belonging to the Maverick transposon family), and the gene encoding the integrase core domain containing the protein family; the mgpa gene in Mycoplasma genitalium; and the yidC gene in Mycoplasma hominis. The primers and probes used are highly specific and show no cross-reactivity with closely related species or common pathogens of the urogenital tract. They also offer advantages such as rapid detection and high sensitivity, achieving results within 1 hour using real-time fluorescence PCR detection, and can detect a single Trichomonas vaginalis. This kit has higher detection sensitivity than similar kits, can be stored at 2–8°C for 1 year, and is compatible with fully automated platforms.

[0047] The primer-probe combination described in this invention enables the detection of Trichomonas vaginalis in urine samples. It can also be combined with primers and probes for Mycoplasma genitalium and / or Mycoplasma hominis to form primer-probe combinations. Attached Figure Description

[0048] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0049] Figure 1 The experimental results comparing the detection capabilities of primer-probe combinations for various target genes are shown.

[0050] Figure 2 The results of sensitivity experiments on the MT gene primer-probe combination are shown.

[0051] Figure 3 The results of sensitivity experiments for the Repellent gene primer-probe combination are shown.

[0052] Figure 4 The results of sensitivity experiments for the Intergase gene primer-probe combination are shown.

[0053] Figure 5 The results of the precision experiment of the MT gene primer-probe combination are shown.

[0054] Figure 6 The results of the precision experiment of the Repellent gene primer-probe combination are shown.

[0055] Figure 7 The results of the precision experiment of the Intergase gene primer-probe combination are shown.

[0056] Figure 8 The results of the combined detection of MT, Repellent, and Intergase genes with the mgpa / yidC gene are shown.

[0057] Figure 9 The test results for Scheme 1 are shown in different reaction solutions and reaction procedures.

[0058] Figures 1-9 The FAM channel is represented by blue lines; the HEX channel by green lines; the ROX channel by yellow lines; and the cy5 channel by purple lines. Detailed Implementation

[0059] This invention discloses the application of Trichomonas vaginalis target genes, primer and probe combinations, and kits. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0060] The purpose of this invention is to utilize a novel Trichomonas vaginalis target gene and, through the principle of real-time quantitative PCR, design highly sensitive and specific primers and probes to detect Trichomonas vaginalis in urine samples. This invention is adapted to urine samples, as well as urethral and vaginal swabs, under high sensitivity conditions. It can also be combined with primers and probes for Mycoplasma genitalium and / or Mycoplasma hominis to form primer-probe combinations.

[0061] This invention designs primer-probe combinations capable of specifically detecting Trichomonas vaginalis alone, or in combination with Mycoplasma genitalium and / or Mycoplasma hominis, with human genes serving as internal controls. Primers and probes are designed on the Mariner transposase mar1 putative transposase gene (a highly repetitive sequence in Trichomonas vaginalis - Tc1 / Mariner transposon superfamily), the repellent protein 1 family (a gene belonging to the Maverick transposon family), and the gene encoding the integrase core domain containing the protein family; the mgpa gene in Mycoplasma genitalium; and the yidC gene in Mycoplasma hominis. The primers and probes used have high specificity and no cross-reactivity with closely related species or common pathogens of the urogenital tract. They also possess advantages such as rapid detection speed and high sensitivity, with results available in just 1 hour, detecting a single Trichomonas vaginalis. This kit has higher detection sensitivity than similar kits and can be stored at 2–8℃ for 1 year. It can also achieve fully automated detection. Therefore, the development of this kit has important practical significance.

[0062] 1) The Mariner transposase gene of Trichomonas vaginalis and its primer-probe combination, including:

[0063]

[0064] The forward primer nucleic acid sequence of the Mariner transposase gene (SEQ ID NO.2): GACTGTAAAAAAATCTACGAGACATTGG

[0065] The reverse primer nucleic acid sequence of the Mariner transposase gene (SEQ ID NO.3): AAACACACCTTTGGACACCCT

[0066] The probe nucleic acid sequence of the Mariner transposase gene (SEQ ID NO.4): GCTTGGTATGGATGCTCCTAGCTATTCC

[0067] 2) The repellent gene of Trichomonas vaginalis and its primer-probe combination, including:

[0068] Target gene (SEQ ID NO.5): ATGAGTTCTTCATCAAGCTCTCGTGAACCTTCACCAT CTGTGAAACAAACTTTACCAAACGATTATGGAGCACCTATTGAATATTTCTTACGAGCTGCACAATGGCAAAGAGCAGTCTCACCAAGGTTAGTGTTCCACCAGCTCCTGTCAAAAATAGCATTTGGTCAAGTCCTTATATAAGATATGGTCTCCCACTAGGTTTGCTAGCTACAGCAGGAGCAGTAATGATGTTGAAAAGAAACAAAGCAAATGT TATAAATAATACTGAAGTAGCTGAATTTGAACAAACTCCGACACCATCGCCAAAACCAACGTCAAAACCAACGCCTTCACAAACAACACCTTCAATGACTCCTGAACCTATGAAAGTACAAACTCCTGTTCAAAAGTCAACTCCAAAACCGACTCCAACATTTAAACCAGAACCTACTCCTCAAATAAATCGTAAAACTCCTGCGTTTCCTTACTGA

[0069] The forward primer nucleic acid sequence of the repellent gene (SEQ ID NO.6): ATGAGTTCTTCATCAAGCTC TCG

[0070] The reverse primer nucleic acid sequence of the repellent gene (SEQ ID NO.7): AAACTCCTGCGTTTCCTTAC TGA

[0071] The probe nucleic acid sequence of the repellent gene (SEQ ID NO.8): CCTTCACCATCTGTGAAACAAACTTTACCAAACG

[0072] 3) The Trichomonas vaginalis intergase gene and its primer-probe combination, including:

[0073] Target gene (SEQ ID NO.9): AGGAACTCGTGAAGTGTTAAGAGTTTTACAAAAGTT TGTAGCAGAACATAACCCAAGTACTTTAACATCAGACCAAGACAGTGCATACCTCAGCAACGAAATCACAGAATTTCTCATTAAGCATAACATAACTCACTACACTACTGAAGACCATAACCATAACATACTCGGTATCATTAACCGCTTCATAAGGACTCTCAGAGATTTAAATCAAGAGCGAGACTTTACCGAAGAAACAATGAAACATTTTCTCGAAGTATATAATTCCTCAACACATTCTACAACAGGACATACACCAAATTCAATGACACAACAACAAGAAGAAAAGTATATACAAAAGAAACGAAGCCAAACACAAAATATCAGAAATTCAACACAATTTACCCTCATTCCTGGTACAAAAGTTCGTGTAGTTCTTGACGACAAACCGTTGACAAAGAAACGTTTAAGGTTAAGTCGAAATTATTATATCGTAGACTCTACGCAAGGTAATGGATATCTTATAAAAGCTGCTGACGACTCCATAGCATTTTACCCTCGTCATAAATTAGTCGAAAGTAGTAATGGCAAACTTGCTGAAACCATTGACGAAGCAAAGCGAGGAGTGGTTATTGAAATACTTGGCTACAACATAAACGATGACACTTATAAAGTAAGATATGAAGGAGGTGTTGAAGATGTTATACCATCTAAGAACTTGAGAGAGTCAAAGCCAACACATCTGGGACCATTAGAGCGGGAGTACTGGAAAGATAAAAACATGCCAGAAAGAATAAGAAAATTCTTC

[0074] Forward primer nucleic acid sequence of intergase gene (SEQ ID NO.10): AGGAACTCGTGAAGTGTTAAGAGT

[0075] Reverse primer nucleic acid sequence of intergase gene (SEQ ID NO.11): CATGCCAGAAAGAATAAGAAAATTCTTC

[0076] The probe nucleic acid sequence of the intergase gene (SEQ ID NO.12): ACCATTAGAGCGGGAGTACTG GAAAG

[0077] 4) Internal standard hemoglobin subunit beta (HBB) gene and its primer-probe combination, including:

[0078] Target gene (SEQ ID NO.13): AGACAGAGAAGACTCTTGGGTTTCTGATAGGCACT GACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCT

[0079] The forward primer nucleic acid sequence of the HBB gene (SEQ ID NO.14): AGACAGAGAAGACTCTTGGGTTTC

[0080] The reverse primer nucleic acid sequence of the HBB gene (SEQ ID NO.15): AGCATCAGGAGTGGACAGATC

[0081] HBB gene probe nucleic acid sequence (SEQ ID NO.16): AGGCACTGACTCTCTCTGCCTATTGGTC

[0082] The probe is connected to a fluorescent group and a quenching group, and the fluorescent group includes FAM, HEX, ROX, CY5, CY3, CY5.5, and CY7.

[0083] The quenching groups include BHQ1, BHQ2, and BHQ3. In some specific embodiments of the present invention, the reaction system of the kit includes:

[0084]

[0085] In some specific embodiments of the present invention, the PCR reaction procedure includes:

[0086]

[0087] Unless otherwise specified, the application of the Trichomonas vaginalis target gene, primer and probe combinations, and raw materials and reagents used in the kit provided by this invention can all be purchased commercially.

[0088] The present invention will be further illustrated below with reference to the embodiments:

[0089] Example of RT-PCR Rapid Detection of Trichomonas vaginalis

[0090] 1) By using the NCBI BLAST software to perform sequence alignment and analysis on the nucleic acid sequences of Trichomonas vaginalis existing in the NCBI database, the highly repetitive sequences of Trichomonas vaginalis, namely the Mariner transposase gene, repellent gene, and Integrase gene, were respectively selected as the amplification targets, and polymerase chain reaction (RT-PCR) was used to qualitatively detect Trichomonas vaginalis.

[0091] 2) The detection method for the rapid detection of Trichomonas vaginalis by RT-PCR specifically includes the following steps: (1) Preparation of DNA from urine samples: Use the nucleic acid extraction and purification reagent (No. Yu Zheng Xie Bei 20180037) of Zhengzhou Antu Biological Engineering Co., Ltd. to extract DNA from urine samples. The specific operation is shown in the instruction manual; (2) Two-step RT-PCR amplification of the DNA sample in step (1): The reaction system is 50 μL. In the 50 μL reaction system, the concentration of each primer can be 0.3 mmol / L, the concentration of each probe (target - Reporter: CY5, Quencher: BHQ3; internal standard - Reporter: HEX, Quencher: BHQ1) can be 0.15 mmol / L, UDG enzyme is 0.01 U / mL, Taq enzyme is 0.3 U / mL, MgCl2 is 1.7 mmol / mL, dNTPs is 40 mmol / L, the DNA of the待测样本 (to be determined sample) is 20 μL, and PCR buffer (Tris-HCl with a pH value of 8.6; potassium acetate of 0.1 M) is 10 μL, and water is added to make up to 50 μL. All the above are added to a 0.2 mL reaction tube and mixed well. Then it is placed in a PCR instrument and the following reaction is carried out: 50 °C for 3 min; 95 °C for 3 min; denaturation at 95 °C for 10 s, annealing at 60 °C for 22 s (light collection), for 45 cycles. (3) Result interpretation: 1) Positive for Trichomonas vaginalis: The Ct value of the target ≤ 39, and the Ct value of the internal standard ≤ 40;

[0092] 2) Negative for Trichomonas vaginalis: The Ct value of the target > 39, and the Ct value of the internal standard ≤ 40.

[0093] Effect Example 1 Comparison of the Detection Capabilities of the Composition of the Present Invention with the Compositions in the Authorized / Accepted Patents

[0094] After clinically positive samples of Trichomonas vaginalis were classified, they were serially diluted with negative urine to 100 cells / mL. Using the experimental methods described in the examples, samples containing MT (Mariner transposase), Repellent, Intergase, DUF4106 (DUF4106 family gene, GenBank: XM_051251067.1), 5.8S (5.8S ribosomal RNA gene, GenBank: MT133892.1), 18S (18S ribosomal RNA gene, GenBank: KM603351.1), DNA / RNA polymerase family (DNA / RNA polymerases family, GenBank: XM_051221296.1), AP65 (a dhesin protein AP65, GenBank: XM_001319039.2), and β-Tubulin (beta-tubulin gene, GenB) were analyzed. The reaction solution of primers and probes for genes such as ank:L05468.1 and CRN (coronin gene, GenBank:XM_001581132.2) (the sequences of each target gene primer and probe are shown in Table 1) was used for detection. The detection results are as follows: Figure 1 As shown, the detection Ct values ​​of MT, Repellent, and Intergase were significantly forward compared to other target genes. Therefore, the primer-probe detection capabilities of MT, Repellent, and Intergase genes are superior to those of other target genes, which means that the composition of the present invention can detect lower concentrations of Trichomonas vaginalis, making the detection more sensitive and accurate.

[0095] Table 1 Primer and probe sequences for each target gene in the comparison.

[0096]

[0097] Example 2: Sensitivity Detection

[0098] Clinical TV-positive samples, after being assigned values, were serially diluted with negative urine and detected using reaction systems containing primers and probes for the MT, Repellent, and Intergase genes as described in the examples. Two replicates were performed for each concentration (MT detection concentrations were 0.1, 0.05, and 0.025 cells / mL; Repellent detection concentrations were 0.4, 0.2, and 0.1 cells / mL; and Intergase detection concentrations were 0.8, 0.4, and 0.2 cells / mL). The detection results are as follows: Figure 2 , 3As shown in Figure 4, the results indicate that the lowest detectable concentration of the MT gene is 0.05 cells / mL; the lowest detectable concentration of the Repellent gene is 0.2 cells / mL; and the lowest detectable concentration of the Intergase gene is 0.4 cells / mL. By using the composition of this invention, the positive rate of nucleic acid detection for Trichomonas vaginalis is increased, enabling the detection of Trichomonas vaginalis with higher sensitivity. This has positive significance for preventing the spread of Trichomonas vaginalis and for the treatment of diagnosed patients.

[0099] Example 3: Specificity Detection

[0100] The tube contained common pathogens of the reproductive and urinary systems, as well as other pathogens with similar infection symptoms, such as Escherichia coli, Enterococcus faecalis, Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, Ureaplasma urealyticum, Neisseria gonorrhoeae, Chlamydia trachomatis, Human papillomavirus type 16, Human papillomavirus type 18, Herpes simplex virus type I, Herpes simplex virus type II, Treponema pallidum, Staphylococcus epidermidis, Gardnerella vaginalis, Adenovirus, Cytomegalovirus, Group B Streptococcus, Streptococcus agalactiae, Lactobacillus casei, and white leukemia. Candida albicans and other Trichomonas vaginalis species closely related to Trichomonas vaginalis, such as Trichomonas oralis and Trichomonas vulgaris, were vortexed and mixed. Nucleic acid was extracted and purified using nucleic acid extraction and purification reagents from Zhengzhou Antu Biotechnology Co., Ltd. Amplification was performed using the reaction system containing the MT, Repellent, and Intergase gene primers and probes of the composition of this invention, as described in Example 1. All detection results were negative, indicating that the composition of this invention has no cross-reactivity with common pathogens of the reproductive and urinary systems or other pathogens with similar infection symptoms. Specific results are shown in Table 2.

[0101] Table 2. Specificity results of primer-probe combinations for MT, Repellent, and Intergase genes.

[0102]

[0103]

[0104] Example 4: Anti-interference capability test

[0105] The composition of this invention was used to validate Trichomonas vaginalis samples containing interfering substances according to the method shown in the examples. Testing verified that the interfering substances did not significantly interfere with the detection results of the kit. The experimental results are shown in Table 3; no interference was observed in either of the two repeated experiments.

[0106] Table 3. Experimental results on the anti-interference ability of primer-probe combinations for MT, Repellent, and Intergase genes.

[0107] Interfering substance name concentration Test Results - MT Test Results - Repellent Test Results - Intergase Cervical mucus 10% (v / v) 0 / 2 0 / 2 0 / 2 Human whole blood 5% (v / v) 0 / 2 0 / 2 0 / 2 Vancomycin 250 μg / mL 0 / 2 0 / 2 0 / 2 Roxithromycin 50 μg / mL 0 / 2 0 / 2 0 / 2 Ampicillin 100 μg / mL 0 / 2 0 / 2 0 / 2 Doxycycline 50 μg / mL 0 / 2 0 / 2 0 / 2 Cefixime 20 μg / mL 0 / 2 0 / 2 0 / 2 Minocycline 50 μg / mL 0 / 2 0 / 2 0 / 2 Azithromycin 100 μg / mL 0 / 2 0 / 2 0 / 2 clindamycin 50 μg / mL 0 / 2 0 / 2 0 / 2 Polycresolsulfonate solution 3% (v / v) 0 / 2 0 / 2 0 / 2 Jieeryin Wash 3% (v / v) 0 / 2 0 / 2 0 / 2 urea 100 μg / mL 0 / 2 0 / 2 0 / 2 Heme 10 μg / mL 0 / 2 0 / 2 0 / 2 Ciprofloxacin 50 μg / mL 0 / 2 0 / 2 0 / 2 Metronidazole 200 μg / mL 0 / 2 0 / 2 0 / 2 tinidazole 200 μg / mL 0 / 2 0 / 2 0 / 2

[0108] Example 5: Precision Testing

[0109] Samples at two times the sensitivity level (MT - 0.1 PCRs / mL, Repellent - 0.4 PCRs / mL, Intergase - 0.8 PCRs / mL) were selected, and the precision was determined using the detection method described in Example 1. Each sample was measured 10 times. The results showed that the detection rate of each composition was 100%, and the coefficient of variation (CV) of the detection Ct value was less than 5%, indicating that the compositions of the present invention have excellent detection precision. The results are as follows... Figure 5 , 6 As shown in Figures 7 and 8.

[0110] Example 6: Stability Test

[0111] The reaction solutions of each primer-probe combination included in Example 1 were placed at 2–8°C for 1 year. Samples with 2 times the sensitivity level (MT - 0.1 PCRs / mL, Repellent - 0.4 PCRs / mL, Intergase - 0.8 PCRs / mL) were selected and measured using the detection method in Example 1. Two replicates were used for each concentration. Compared with day 0, the Ct value and signal-to-noise ratio were not significantly different, reflecting the superior stability of the composition of the present invention. The results are shown in Table 4.

[0112] Table 4. Results of accelerated stability experiments on MT, Repellent, and Intergase gene combinations.

[0113]

[0114] Example 7: Combined detection of Trichomonas vaginalis and Mycoplasma genitalium / Mycoplasma hominis

[0115] ①The primer and probe combination for the Mycoplasma genitalium mgpa gene includes:

[0116] Target gene (SEQ ID NO. 38): GTTTGCTGGGTTTGCAGCACTCCCTGCATGGGTGAT CCCTGTATCAGTAGGTTCTTCAGTTGGGATCTTGTTTATCTTGTTAGTCTTAGGACTT GGGATTGGGATCC

[0117] Forward primer sequence of the mgpa gene (SEQ ID NO.39): GTTTGCTGGGTTTGCAGCAC

[0118] The reverse primer sequence for the mgpa gene (SEQ ID NO.40): GGATCCCAATCCCAAGTCCT

[0119] Probe sequence of mgpa gene (SEQ ID NO.41): CTGCATGGGTGATCCCTGTATCAGTA GG (Reporter: FAM, Quencher: BHQ1)

[0120] ②The primer and probe combination for the Mycoplasma hominis yidC gene includes:

[0121] Target gene (SEQ ID NO.42): GGCATTCTTCAACAGGCAATACTATTGAAACAACA CCTTTATTTCCGTGACGACCAGCCATCTTGTCGCCGACTTGAATTTTACG

[0122] Forward primer sequence of the yidC gene (SEQ ID NO.43): CGTAAAATTCAAGTCGGCG

[0123] Reverse primer sequence for the yidC gene (SEQ ID NO.44): GGCATTTCTTCAACAGGC

[0124] The probe sequence for the yidC gene (SEQ ID NO.45): CAAGATGGCTGGTCGTCACGGA (Reporter: ROX, Quencher: BHQ2)

[0125] ③ After the clinical samples of Trichomonas vaginalis, Mycoplasma genitalium, and Mycoplasma hominis were determined, they were diluted with negative urine to prepare mixed positive samples with a 2-fold sensitivity level (MT - 0.1 copies / mL, Repellent - 0.4 copies / mL, Intergase - 0.8 copies / mL, mgpa - 1000 copies / mL, yidC - 1000 copies / mL). These samples were then co-amplified using primers and probes for the MT, Repellent, and Intergase genes, along with primers and probes for the mgpa gene of Mycoplasma genitalium and the yidC gene of Mycoplasma hominis. The results showed that co-detection of the three Trichomonas vaginalis target genes with Mycoplasma genitalium and Mycoplasma hominis did not affect the detection results (positive Ct value ≤ 38 for Mycoplasma genitalium, positive Ct value ≤ 38 for Mycoplasma hominis). Therefore, the composition of this invention can not only be used for single detection but also for co-detection with Mycoplasma genitalium and / or Mycoplasma hominis. The results are as follows. Figure 8 As shown in Table 5:

[0126] Table 5. Results of the combined detection experiments of MT, Repellent, and Intergase genes with mgpa / yidC gene.

[0127]

[0128] Example 8: Comparison of detection results for reaction solutions with different component concentrations and reaction times.

[0129] Samples at two-fold sensitivity levels (MT - 0.1 pc / mL, Repellent - 0.4 pc / mL, Intergase - 0.8 pc / mL) were selected. After DNA extraction, the samples were detected using the reaction solutions and procedures shown in Table 6. Each sample was tested in duplicate. The results showed that the detection results of the three procedures for the same sample were not significantly different, meaning that within the above concentration and procedure ranges, the composition of the present invention has the same detection capability. The results are shown in Table 7. The detection results of Scheme 1 are as follows: Figure 9 As shown.

[0130] Table 6. Composition of reaction solution and reaction procedure in different schemes

[0131]

[0132] Table 73 shows the test results for different methods.

[0133]

[0134] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of reagents for detecting one or more of the Mariner transposase mar1 hypothetical transposase gene, repellent protein 1 family genes, and / or the Integrase core domain in the preparation of products for detecting Trichomonas vaginalis. The nucleotide sequences of the Mariner transposase mar1 hypothetical transposase gene, the repellent protein 1 family gene, and the gene containing the core domain of the integrase are shown in SEQ ID NO.1, SEQ ID NO.5, and SEQ ID NO.9, respectively.

2. Use of a primer probe combination for the manufacture of a reagent or kit for the detection or identification of Trichomonas vaginalis, characterized in that, The primer-probe combination is selected from any of the following: (I) Specific primer pairs having nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3; A specific probe having the nucleotide sequence shown in SEQ ID NO.4; (II) Specific primer pairs having nucleotide sequences as shown in SEQ ID NO.6 and SEQ ID NO.7; A specific probe having the nucleotide sequence shown in SEQ ID NO.8; (III) Specific primer pairs having the nucleotide sequences shown in SEQ ID NO.10 and SEQ ID NO.11; A specific probe having a nucleotide sequence as shown in SEQ ID NO.

12.

3. Use according to claim 2, wherein the compound is ###0002### The primer-probe combination also includes primer pairs for amplifying and detecting internal reference genes and specific probes, wherein the internal reference genes include one or more of the following: hemoglobin subunit beta gene, GAPDH, β-actin, or tubulin.

4. Use of a primer probe combination for the manufacture of a reagent or kit for the detection of trichomonal vaginitis, characterized in that, The primer-probe combination is selected from any of the following: (I) Specific primer pairs having nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3; A specific probe having the nucleotide sequence shown in SEQ ID NO.4; (II) Specific primer pairs having nucleotide sequences as shown in SEQ ID NO.6 and SEQ ID NO.7; A specific probe having the nucleotide sequence shown in SEQ ID NO.8; (III) Specific primer pairs having the nucleotide sequences shown in SEQ ID NO.10 and SEQ ID NO.11; A specific probe having a nucleotide sequence as shown in SEQ ID NO.

12.

5. The use according to claim 4, wherein the compound is ###0002### The primer-probe combination also includes primer pairs for amplifying and detecting internal reference genes and specific probes, wherein the internal reference genes include one or more of the following: hemoglobin subunit beta gene, GAPDH, β-actin, or tubulin.

Citation Information

Patent Citations

  • Pathogen control compositions and uses thereof

    CN112533946A

  • Primer probe combination and kit for multiple detection of candida, gardnebacterium and trichomonas vaginalis and application

    CN117467799A