A colorimetric-sers dual-mode biosensor based on hairpin probe and its use for detecting tetrodotoxin
By constructing a colorimetric-SERS dual-mode biosensor based on a hairpin probe, the problems of high cost, long time and complicated procedures in tetrodotoxin detection were solved, and highly specific and sensitive detection of tetrodotoxin in food was achieved, with detection limits of 1.07 ng/mL and 0.09 ng/mL.
Patent Information
- Application Number
- CN202411085428.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-08
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-08-08
AI Technical Summary
Existing methods for detecting tetrodotoxin in pufferfish are costly, time-consuming, and cumbersome, making it difficult to meet the demand for rapid and highly sensitive detection.
A colorimetric-SERS dual-mode biosensor based on hairpin probes was constructed by preparing Au NPs@4-MPY as the signal output element, designing a hairpin probe of tetrodotoxin Apt as the signal trigger element, and using Au@Ag NPs as the signal amplification element.
It enables rapid, simple, highly sensitive and specific detection of tetrodotoxin, with detection limits of 1.07 ng/mL and 0.09 ng/mL, avoiding the use of expensive instruments and providing faster detection speed.
Smart Images

Figure CN119044141B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of food safety detection, and particularly relates to a preparation method of a colorimetric-SERS bimodal biosensor based on a hairpin probe and application of the colorimetric-SERS bimodal biosensor to detection of tetrodotoxin. BACKGROUND
[0002] Tetrodotoxin (TTX) is a non-protein marine toxin with low molecular weight (319 Da) and extremely strong toxicity, and widely exists in different marine products such as puffer fish, shellfish and algae. After ingesting TTX, it will rapidly act on the nerve endings and central nervous system, mainly showing nerve ending paralysis, and can cause respiratory failure and even death in severe cases. Human consumption of TTX-accumulated food may cause poisoning in adults even at a low dose of 0.5-3 mg. And the relevant national standards stipulate that the content of TTX in fresh-frozen puffer fish cannot exceed 2 mg / kg.
[0003] At present, traditional TTX detection methods such as high-performance liquid chromatography / mass spectrometry and enzyme-linked immunosorbent assay are expensive, time-consuming, complex in pretreatment and require experienced detection personnel, which cannot meet the demand for rapid and high-sensitivity detection of TTX. The present application provides a TTX detection method based on a colorimetric-SERS bimodal biosensor based on a hairpin probe, which overcomes the shortcomings of traditional detection methods and improves the sensitivity and adaptability of TTX detection. SUMMARY
[0004] The present application aims to overcome the technical defects existing in the prior art detection technology, such as high detection cost, long detection time and complicated detection steps, and based on this, the present application provides a preparation method of a colorimetric-SERS bimodal biosensor based on a hairpin probe and its application in detection of tetrodotoxin, which solves the shortcomings of the prior art and improves the high specificity and sensitivity of tetrodotoxin detection in food.
[0005] The present application prepares Au NPs@4-MPY as a signal output element, designs a hairpin probe based on tetrodotoxin Apt as a signal triggering element, constructs a colorimetric-SERS bimodal biosensor based on a hairpin probe, and finally uses Au@Ag NPs as a signal amplification element to realize rapid, simple, high-sensitivity and specific detection of tetrodotoxin in food.
[0006] In order to achieve the above technical purposes, the technical solutions adopted by the present application are as follows:
[0007] A preparation method of a colorimetric-SERS bimodal biosensor based on a hairpin probe, comprising the following steps:
[0008] Step one, preparation of gold nanoparticles: the HAuCl4 solution was heated to boiling under magnetic stirring, then C6H5Na3O7 solution was added to react, after the reaction was completed (the solution changed from gold to purple red), the solution was cooled to room temperature, and gold nanoparticles were obtained;
[0009] Step two, surface modification of gold nanoparticles: the gold nanoparticles obtained in step one were mixed with 4-mercapto pyridine (4-MPY) solution and stirred, then incubated after standing, and then Au NPs@4-MPY incubation solution was obtained after incubation, and then Au NPs@4-MPY solution was obtained by re-dispersing Au NPs@4-MPY incubation solution in HEPES buffer solution;
[0010] Step three, design of hairpin probe (HP): first, the aptamer (Apt) of tetrodotoxin was designed into a hairpin structure according to the principle of base complementary pairing; then the tetrodotoxin freeze-dried powder of the hairpin structure was dissolved in Tris-EDTA buffer solution, and the hairpin probe was formed after reaction, which was recorded as HP solution;
[0011] Step four, establishment of specific detection system: Au NPs@4-MPY is the colorimetric and SERS signal output element, and HP is the specific recognition element;
[0012] The Au NPs@4-MPY solution obtained in step two was added to the HP solution obtained in step three, and then NaCl solution was added after incubation for a period of time, and the mixed solution obtained after reaction was used as the specific detection system, that is, a colorimetric-SERS dual-mode biosensor based on hairpin probe was obtained.
[0013] Further, the concentration of the HAuCl4 solution in step one is 0.1-1M, the concentration of the C6H5Na3O7 solution is 0.1-10wt%, the volume ratio of the HAuCl4 solution to the C6H5Na3O7 solution is 10:1, and the reaction time is 10-60min.
[0014] Further, in the step two, the concentration of the 4-mercapto pyridine solution is 200μM, the pH of the HEPES buffer solution is 7.2, and the molar concentration is 10mM; the amount of gold nanoparticles and 4-mercapto pyridine solution is 3mL:10μL; the mixing and stirring time is 1-10min, the incubation is room temperature incubation, and the incubation time is 5min; the concentration of the Au NPs@4-MPY solution is 1.03×10 -10 M.
[0015] Further, in step three, the sequence of the aptamer (Apt) is:
[0016] TGATAATCAAATTTTCGTCTACTCAATCTTTCTGTCTTATCA;
[0017] Further, in step three, the tetrodotoxin freeze-dried powder is dissolved in Tris-EDTA buffer, and the amount of the two is in the ratio of 33 μg: 46 μL; the reaction conditions are: first react at 95℃ for 5 min, then cool to 25℃, react for 2 h.
[0018] Further, in step four, the incubation is at room temperature, and the incubation time is 0.5-3 h; the volume ratio of the Au NPs@4-MPY solution, the NaCl solution and the HP solution is 30:10:1, the concentration of the HP solution is 0.5-1 μM, and the concentration of the NaCl solution is 200-300 mM; the reaction time of adding the NaCl solution is 0.1-1 h.
[0019] The use of the colorimetric-SERS dual-mode biosensor based on hairpin probes for detecting tetrodotoxin is as follows:
[0020] S1, gold-silver core-shell nanoparticle preparation (Au@Ag NPs): the HAuCl4 solution is heated to boiling, then the C6H5Na3O7 solution is added for continuous reaction, then the ascorbic acid (AA) solution is added, and then the AgNO3 solution is added dropwise until the reaction solution is orange, and then it is naturally cooled to room temperature to obtain Au@Ag NPs;
[0021] S2, establishment of a tetrodotoxin content detection standard curve:
[0022] First, prepare tetrodotoxin standard solutions of different concentrations, and then add the tetrodotoxin standard solutions to the colorimetric-SERS dual-mode biosensor based on hairpin probes, and then add Au@Ag NPs, mix uniformly to obtain a mixed solution;
[0023] First, determine the absorbance characteristic value of the mixed solution, and establish a standard curve between the absorbance characteristic value and the corresponding tetrodotoxin standard solution concentration; then determine the SERS intensity value of the mixed solution, and establish a standard curve between the SERS intensity value and the corresponding tetrodotoxin standard solution concentration;
[0024] S3, detection of the tetrodotoxin content in a food sample: the food is pretreated to extract a solution containing TTX as a test solution; then, according to the operation of step six, the only difference is that the tetrodotoxin standard solution is replaced by the test solution; finally, the absorbance characteristic value and the SERS intensity value are determined, and the standard curve obtained in step six is used to calculate the tetrodotoxin content in the food.
[0025] Furthermore, in step S1, the concentration of the HAuCl4 solution is 0.1-10mM, the concentration of the C6H5Na3O7 solution is 0.1–10wt%, the concentration of the AgNO3 solution is 1-20mM, the concentration of the ascorbic acid solution is 1-20mM, and the reaction time is continued for 10-120min; the volume ratio of the HAuCl4 solution, C6H5Na3O7 solution, AgNO3 solution and ascorbic acid solution is 25:1:1:4.
[0026] Further, in step S2, the concentration range of the tetrodotoxin standard solution is 0.01-100 ng / mL;
[0027] Furthermore, in step S2, the volume ratio of the tetrodotoxin standard solution to the HP solution in the hairpin probe-based colorimetric-SERS dual-mode biosensor is 1:1; the volume ratio of the tetrodotoxin standard solution to Au@Ag NPs is 3:20.
[0028] Furthermore, in step S2, the step of determining the characteristic value of the detection solution is as follows: determining and recording the absorbance A of the specific detection system at 520 nm after adding the tetrodotoxin standard solution. 520 and the absorbance at 680 nm 680 ; Then take the quotient of the two, that is, A 520 / A 680 As the characteristic absorbance value of the detection solution;
[0029] Measure and record the specific detection system after adding tetrodotoxin standard solution at 1096 cm under 785 nm excitation light. -1 The SERS intensity value I0 at , I0 is the characteristic value of the SERS intensity signal of the detection solution.
[0030] Compared with existing detection technologies, the present invention has the following beneficial effects:
[0031] (1) The purpose of the present invention is to overcome the technical defects existing in the existing detection technology, such as: high detection cost, long detection time, cumbersome detection steps, etc. The present invention provides a tetrodotoxin detection method based on a hairpin probe colorimetric-SERS dual-mode biosensor to solve the problems existing in the above-mentioned existing technologies, thereby improving the high specificity and sensitivity of tetrodotoxin detection in food. Au NPs@4-MPY are prepared as the signal output element, and Au@Ag NPs are prepared as the signal amplification element. Finally, a hairpin probe based on tetrodotoxin Apt is designed as the signal trigger element to construct a hairpin probe-based colorimetric-SERS dual-mode biosensor to achieve rapid, simple, highly sensitive and specific detection of tetrodotoxin in food.
[0032] (2) The colorimetric-SERS dual-mode sensor constructed by the application has the surface-enhanced Raman effect and the local surface plasmon resonance effect, can realize the simultaneous output of colorimetric and SERS signals, and can improve the reliability of the detection result.
[0033] (3) The colorimetric-SERS dual-mode sensor constructed by the application has the surface-enhanced Raman effect and the local surface plasmon resonance effect, can realize the simultaneous output of colorimetric and SERS signals, and can improve the reliability of the detection result.
[0034] (4) The colorimetric-SERS dual-mode sensor constructed by the application has the surface-enhanced Raman effect and the local surface plasmon resonance effect, can realize the simultaneous output of colorimetric and SERS signals, and can improve the reliability of the detection result.
[0035] The colorimetric-SERS dual-mode biosensor based on the hairpin probe constructed by the application realizes the high specificity and sensitivity detection of tetrodotoxin in food, and the detection limit of tetrodotoxin can reach 1.07 ng / mL and 0.09 ng / mL, respectively, without the aid of expensive instruments, and the speed is faster than that of the traditional LC-MS, and has a good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 It is a tetrodotoxin detection principle diagram of the colorimetric-SERS dual-mode biosensor based on the hairpin probe.
[0037] Figure 2 It is a transmission electron microscope graph of the prepared Au NPs and Au@Ag NPs; wherein the A graph is a transmission electron microscope graph of the Au NPs; and the B graph is a transmission electron microscope graph of the Au@Ag NPs.
[0038] Figure 3 The A graph in the middle is the feasibility of detecting TTX in the colorimetric mode; and the B graph is the feasibility of detecting TTX in the SERS mode.
[0039] Figure 4 The A graph and the B graph in the middle are the concentration optimization of NaCl in the colorimetric mode and the SERS mode, respectively; the C graph and the D graph are the concentration optimization of 4-MPY in the SERS mode and the colorimetric mode, respectively; the E graph is the volume optimization of the Au@Ag NPs; and the F graph is the concentration optimization of the HP.
[0040] Figure 5Figure A is a UV-visible absorption spectrum of different TTX concentrations in colorimetric mode; Figure B is a standard curve for TTX content detection in colorimetric mode; Figure C is a UV-visible absorption spectrum of different TTX concentrations in SERS mode; and Figure D is a standard curve for TTX content detection in SERS mode. DETAILED DESCRIPTION
[0041] The present application is further illustrated by the following working examples. The following examples are illustrative only and do not limit the present application.
[0042] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0043] Although preferred methods and materials have been described herein, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The practice of this application can employ, unless otherwise indicated herein, conventional methods of chemistry, biochemistry, molecular biology, genetics, microbiology, immunology and pharmacology, within the skill of the art. Such methods are explained fully in the literature.
[0044] Figure 1 Figure 1 is a schematic diagram of the detection principle of the colorimetric-SERS dual-mode biosensor based on hairpin probe for tetrodotoxin, and the specific operation is described in the examples.
[0045] I. Feasibility of detecting TTX:
[0046] The specific method is as follows: four groups of experiments are set up, as follows:
[0047] Group A (Au NPs@4-MPY): the absorbance characteristic value and SERS characteristic value of the Au NPs@4-MPY solution alone are determined;
[0048] Group B (Au NPs@4-MPY+NaCl): the absorbance characteristic value and SERS characteristic value of the mixed solution of Au NPs@4-MPY solution and NaCl solution are determined;
[0049] Group C (Au NPs@4-MPY+NaCl+HP): the absorbance characteristic value and SERS characteristic value of the mixed solution of Au NPs@4-MPY solution, NaCl solution and HP solution are determined;
[0050] Group D (Au NPs@4-MPY + NaCl + HP + TTX): The mixed solution of Au NPs@4-MPY solution, NaCl solution, HP solution and TTX standard solution, and the determination of the absorbance characteristic value and the SERS characteristic value.
[0051] Group A operation: 10 μL of 200 μM 4-MPY was added to 3 mL of Au NPs for surface functionalization, and the mixed solution was stirred for 1 min, then incubated for 5 min, and then 9 mL of HEPES buffer (pH 7.2, 10 mM) was added to the incubation solution to obtain the Au NPs@4-MPY solution. The absorbance characteristic value and the SERS characteristic value were determined.
[0052] Group B operation: 10 μL of 200 mM 4-MPY was added to 3 mL of Au NPs for surface functionalization, and the mixed solution was stirred for 1 min, then incubated for 5 min, and then 9 mL of HEPES buffer (pH 7.2, 10 mM) was added to the incubation solution to obtain the Au NPs@4-MPY solution. 900 μL of the Au NPs@4-MPY solution was reacted with 300 μL of 300 mM NaCl solution for 10 min, and then 200 μL of Au@Ag NPs was added to the mixed solution to obtain the mixed solution. The absorbance characteristic value and the SERS characteristic value were determined. Due to the addition of NaCl solution, the Au NPs@4-MPY agglomerated, so the absorbance characteristic value at 680 nm increased, the absorbance characteristic value at 520 nm decreased, and the SERS characteristic value increased.
[0053] Group C operation: 10 μL of 200 μM 4-MPY was added to 3 mL of Au NPs for surface functionalization, and the mixed solution was stirred for 1 min, then incubated for 5 min, and then 9 mL of HEPES buffer (pH 7.2, 10 mM) was added to the incubation solution to obtain the Au NPs@4-MPY solution. 900 μL of the Au NPs@4-MPY solution was incubated with 30 μL of 0.5 μM HP solution for 30 min, and then 300 μL of 300 mM NaCl solution was added to react for 10 min, and then 200 μL of Au@Ag NPs was added to the mixed solution to obtain the mixed solution. The absorbance characteristic value and the SERS characteristic value were determined. Since the HP solution cannot alleviate the aggregation of nanoparticles caused by the NaCl solution, the absorbance and SERS intensity are the same as those of group B.
[0054] The operation of group D is: 10 μL of 200 μM 4-MPY is added to 3 mL of Au NPs for surface functionalization, the mixed solution is stirred for 1 min, and then incubated for 5 min, and then 9 mL of HEPES buffer (pH 7.2, 10 mM) is added to the incubation solution to obtain an AuNPs@4-MPY solution.
[0055] 30 μL of 0.5 μM HP solution and 30 μL of 10 ng / mL tetrodotoxin standard solution are mixed, incubated for 30 min, then 900 μL of Au NPs@4-MPY solution is added for secondary incubation (30 min), and then 300 μL of 300 mM NaCl solution is added to the incubation solution, and the incubation solution is reacted with 300 μL of 300 mM NaCl solution for 10 min, then 200 μL of Au@Ag NPs is added, and the mixed solution is obtained after mixing; the absorbance characteristic value and the SERS characteristic value of the mixed solution are determined. Since HP is opened, the aggregation of nanoparticles is alleviated, so compared with group C, the absorbance characteristic value at 680 nm is reduced, the absorbance characteristic value at 520 nm is increased, and the SERS characteristic value is reduced. It is proved that the dual-mode biosensor can be used for TTX detection.
[0056] According to the results of the 4th group control experiment, from Figure 3 A and B of the figure, in the presence of TTX, HP is opened to alleviate the aggregation of nanoparticles, and compared with the absence of TTX, the absorbance characteristic value at 680 nm and the SERS intensity value are both decreased, which proves that the dual-mode biosensor can be used for TTX detection.
[0057] II. Optimization and screening of conditions:
[0058] (1) NaCl concentration optimization:
[0059] The Au NPs@4-MPY solution is mixed with 300 μL of 100-500 mM NaCl solution, and then 200 μL of Au@Ag NPs solution is added, and the mixed solution is obtained after mixing. The absorbance characteristic value and the SERS characteristic value of the mixed solution are collected. As shown in Figure 4 A of the figure, the concentration of added NaCl is from 100-500 mM, and 520 / A 680 With the decrease of NaCl concentration, but Figure 4 The SERS characteristic value in B of the figure increases with the increase of NaCl concentration, and from 300 mM to 500 mM, the SERS characteristic value signal decreases with the increase of Au NRs concentration. Therefore, 300 mM is selected as the optimal concentration.
[0060] (2) 4-MPY concentration optimization:
[0061] In 3 mL Au NPs, 10 μL of 100-500 μM 4-MPY was added for surface functionalization, and after stirring the mixed solution for 1 min, it was incubated for 5 min, and then 9 mL of HEPES buffer (pH 7.2, 10 mM) was added to the incubation solution to obtain the AuNPs@4-MPY solution.
[0062] 900 μL of 100-500 μM 4-MPY incubated AuNPs@4-MPY solution was mixed with 300 μL of 300 mM NaCl solution, and after mixing, 200 μL of Au@Ag NPs solution was added, and after mixing, the obtained mixed solution was collected for absorbance characteristic value and SERS characteristic value.
[0063] As shown in C graph of Figure 4 , from 100-500 mM, the SERS characteristic value is constantly increasing, but considering that too high a concentration of 4-MPY will affect the absorbance characteristic value, Figure 4 , as shown in D graph, from 100-200 mM, the absorbance characteristic value is stable, and from 300-500 mM, the 680 nm absorbance characteristic value is constantly increasing, therefore, 200 mM is selected as the optimal concentration.
[0064] (3) Au@Ag NPs volume optimization:
[0065] 900 μL of AuNPs@4-MPY solution was mixed with 300 μL of 300 mM NaCl solution, and after mixing, different volumes of Au@Ag NPs solution (50, 100, 150, 200, 250 μL) were added, and after mixing, the obtained mixed solution was collected for SERS spectrum.
[0066] Figure 4 E graph of
[0067] (4) HP solution concentration optimization:
[0068] Take 30 μL 0.1-10 μM HP solution and 30 μL, 10 ng / mL tetrodotoxin standard solution, incubate for 30 min, then add Au NPs@4-MPY solution, incubate for the second time (30 min), incubate for 30 min, then add NaCl solution (300 μL, 300 mM), incubate the incubation solution with 300 μL 300 mM NaCl solution for 10 min, after the reaction is completed, 200 μL Au@Ag NPs is added, and the mixed solution is obtained after mixing uniformly; the absorbance characteristic value of the mixed solution is determined. Figure 4 The F figure of the application shows that the absorbance characteristic value is continuously enhanced with the continuous increase of the concentration of the HP solution, and when the concentration of the HP solution reaches 0.5 μM, the absorbance characteristic value no longer increases, therefore, the concentration of the HP solution is determined to be 0.5 μM.
[0069] Example 1:
[0070] A preparation method of a colorimetric-SERS dual-mode sensor based on a hairpin probe, comprising the following steps:
[0071] Step one, take 50 mL of HAuCl4 solution with a concentration of 1 mM, and heat it to boiling state; after the solution reaches boiling, immediately add 5 mL of C6H5Na3O7 solution with a concentration of 1 wt% to it, and react for 20 min; after the reaction, the solution is naturally cooled to room temperature to obtain gold nanoparticles, denoted as Au NPs;
[0072] Step two, add 10 μL, 200 μM 4-MPY solution to 3 mL Au NPs for surface functionalization, stir the obtained mixed solution for 1 min, and then stand for incubation for 5 min, and then add HEPES buffer (pH 7.2, 10 mM) to the incubation solution to obtain Au NPs@4-MPY solution (concentration: 1.03×10 -10 M) for use;
[0073] Step three, preparation of HP solution:
[0074] According to the principle of base complementary pairing, the hairpin structure of tetrodotoxin aptamer (Apt) is designed and prepared by GenScript Biotech (Shanghai) Co., Ltd.
[0075] Take 33 μg of the designed hairpin sequence of tetrodotoxin freeze-dried powder, add 46 μL of Tris-EDTA buffer, and dissolve the freeze-dried powder to obtain a mixed solution. Then the mixed solution is reacted at 95℃ for 5 min, and then cooled to 25℃ for 2 h to form a hairpin probe, denoted as HP solution.
[0076] Step four: the establishment of specific detection system: Au NPs@4-MPY as the colorimetric and SERS signal output element, HP as the specific recognition element;
[0077] The Au NPs@4-MPY solution (900 μL) obtained in step two was added to the HP solution (30 μL) obtained in step three, and after incubation at room temperature for 30 min, NaCl solution (300 μL, 300 mM) was added and reacted for 10 min. The obtained mixed solution was used as the specific detection system, and a colorimetric-SERS dual-mode biosensor based on hairpin probe was obtained.
[0078] The use of the colorimetric-SERS dual-mode biosensor based on hairpin probe for detection of tetrodotoxin, the steps are as follows:
[0079] S1, 100 mL of 1 mM HAuCl4 solution was heated to boiling under rapid stirring, then 4 mL of 1 wt% C6H5Na3O7 solution was quickly added to the mixture, and heating and boiling were continued for 30 min; 4 mL of 1 mM AA solution was added, then 16 mL of 1 mM AgNO3 was added dropwise, and the obtained mixture was boiled for 30 min until the color turned orange, then naturally cooled to room temperature to obtain Au@Ag NPs.
[0080] Figure 2 The transmission electron microscopy images of AuNPs and Au@Ag NPs; wherein A is the transmission electron microscopy image of Au NPs; B is the transmission electron microscopy image of Au@Ag NPs; from the figure, it can be seen that Au NPs and Au@Ag NPs are successfully synthesized.
[0081] S2, establishment of tetrodotoxin content detection standard curve: 30 μL of tetrodotoxin standard solution (0.1, 0.5, 1, 5, 10, 50, 100 ng / mL) was added to the colorimetric-SERS dual-mode biosensor based on hairpin probe, then 200 μL of Au@Ag NPs was added, and the mixture was mixed uniformly to obtain a mixed solution; first, the absorbance characteristic value of the mixed solution was determined, and the standard curve between the absorbance characteristic value and the corresponding concentration logarithm was established; then the SERS intensity value of the mixed solution was determined, and the standard curve between the SERS intensity value and the corresponding concentration logarithm was established;
[0082] The absorbance A of the specific detection system at 520 nm after adding the tetrodotoxin standard solution was determined and recorded 520 and the absorbance A at 680 nm 680 . A 520 / A 680 is the absorbance characteristic value of the detection solution.
[0083] Measure and record the specific detection system after adding tetrodotoxin standard solution at 1096 cm under 785 nm excitation light. -1 The SERS intensity value I0 at , I0 is the characteristic value of the SERS intensity signal of the detection solution.
[0084] Figure 5 Figure A is the UV-visible absorption spectra of different TTX concentrations under colorimetric mode; Figure B is the standard curve of TTX content detection under colorimetric mode;
[0085] from Figure 5 As can be seen in Figure A, as the concentration of tetrodotoxin increases, 520 / A 680 The ratio increases continuously; after linear fitting, the standard curve of tetrodotoxin content detection is obtained as A=0.1251log(C TTX )+0.8852( Figure 5 Figure B), correlation coefficient R 2 =0.9907, A in the curve equation is A 520 / A 680 Ratio, C TTX is the concentration of TXX. The detection limit is 1.07 ng / mL. The linear range is 1-100 ng / mL.
[0086] Figure 5 Figure C in the middle is the UV-visible absorption spectra under different TTX concentrations in SERS mode; Figure D is the standard curve of TTX content detection in SERS mode;
[0087] from Figure 5 Figure C shows that as the concentration of tetrodotoxin increases, the SERS intensity decreases. After linear fitting, the standard curve for tetrodotoxin content detection is obtained as I = -1180.86log (C TTX )+4802.44( Figure 5 Figure D), correlation coefficient R 2 =0.9901, where I is the SERS intensity value, C TTX is the concentration of TXX; the detection limit is 0.09 ng / mL and the linear range is 0.5-100 ng / mL.
[0088] S3. Detection of TTX content in fish:
[0089] 5g fish meat (river puffer) was weighed and homogenized, and 11 mL of methanol solution was added and mixed well. Then, the mixture was ultrasonically treated for 10 min, followed by centrifugation for 10 min again, and the supernatant was reserved. In order to extract TTX thoroughly, 11 mL of methanol solution was added to the residue again and the above extraction steps were repeated, and then the supernatants were combined. After adjusting the pH value of the supernatant by NaOH, TTX was further extracted by an immunoaffinity column to obtain an eluate. The eluate was blown dry with nitrogen at 45℃, and the final residue was dissolved in 10 mL of ultrapure water to obtain a test solution.
[0090] 30 μL of the obtained test solution was added to the colorimetric-SERS dual-mode biosensor based on the hairpin probe, and then 200 μL of Au@Ag NPs was added, and after mixing, a mixed solution was obtained; first, the absorbance characteristic value of the mixed solution was determined; then, the SERS intensity value of the mixed solution was determined, and was brought into the standard curve obtained in step six to obtain the detection recovery rate, which is shown in Table 1.
[0091] Table 1: Detection recovery rate of TTX in river puffer samples
[0092]
[0093] It can be seen that the colorimetric-SERS dual-mode biosensor based on the hairpin probe realizes high specificity and sensitivity detection of puffer toxin, and the detection limit of puffer toxin can reach 1.07 ng / mL and 0.09 ng / mL, respectively, without the aid of expensive instruments, and the speed is faster than that of traditional LC-MS, and has good application prospect.
[0094] It is to be understood that the above embodiments are only used to illustrate the technical solutions described in the present application and not to limit the present application; therefore, although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the present application can still be modified or replaced by equivalents; and all technical solutions and improvements which do not deviate from the spirit and scope of the present application should be covered in the scope of the claims of the present application.
Claims
1. A method for preparing a colorimetric-SERS dual-mode biosensor based on a hairpin probe, characterized in that: Here are the steps: Step 1, preparation of gold nanoparticles: heating HAuCl4 solution to boiling under magnetic stirring, then adding C6H5Na3O7 solution to react, after the reaction is completed, cooling the solution to room temperature to obtain gold nanoparticles; Step 2, surface modification of gold nanoparticles: mixing the gold nanoparticles obtained in step 1 with a 4-mercaptopyridine solution, stirring, and then incubating to obtain an Au NPs@4-MPY incubation solution, and then redispersing the Au NPs@4-MPY incubation solution in a HEPES buffer to obtain an Au NPs@4-MPY solution; Step 3, preparation of hairpin probe: The aptamer of tetrodotoxin is designed into a hairpin structure according to the principle of base complementary pairing; then the tetrodotoxin lyophilized powder with the hairpin structure is dissolved in Tris-EDTA buffer to form a hairpin probe after reaction, which is recorded as HP solution; The aptamer sequence is: TGATAATCAATTTTTCGTCTACTCAATCTTTCTGTCTTATCA; the lyophilized powder was dissolved in Tris-EDTA buffer at a ratio of 33 μg:46 μL; the reaction conditions were: first react at 95°C for 5 min, then cool to 25°C and react for 2 h; Step 4: Establishment of a specific detection system: The AuNPs@4-MPY solution obtained in step 2 was added to the HP solution obtained in step 3. After incubation, a NaCl solution was added and reacted for a period of time. The resulting mixed solution was used as the specific detection system, thus obtaining a colorimetric-SERS dual-mode biosensor based on a hairpin probe. The incubation is carried out at room temperature for 0.5-3 h. The volume ratio of the Au NPs@4-MPY solution, the NaCl solution and the HP solution is 30:10:1, the concentration of the HP solution is 0.5-1 μM, and the concentration of the NaCl solution is 200-300 mM. The reaction time after adding the NaCl solution is 0.1-1 h.
2. The method for preparing a colorimetric-SERS dual-mode biosensor based on hairpin probes according to claim 1, wherein: In step 1, the concentration of the HAuCl4 solution is 0.1-1 M, the concentration of the C6H5Na3O7 solution is 0.1-10 wt %, the volume ratio of the HAuCl4 solution to the C6H5Na3O7 solution is 10:1, and the reaction time is 10-60 min.
3. The method for preparing a colorimetric-SERS dual-mode biosensor based on hairpin probes according to claim 1, wherein: In the second step, the concentration of the 4-mercaptopyridine solution is 200 μM, the pH of the HEPES buffer is 7.2, and the molar concentration is 10 mM; the amount of gold nanoparticles and 4-mercaptopyridine solution is 3 mL:10 μL; the mixing time is 1-10 min, the incubation is at room temperature, and the incubation time is 5 min; the concentration of the AuNPs@4-MPY solution is 1.03×10 -10 M.
4. Use of a hairpin probe-based colorimetric-SERS dual-mode biosensor prepared according to the method of any one of claims 1 to 3 for tetrodotoxin detection, characterized in that: Here are the steps: S1. Preparation of gold-silver core-shell nanoparticles: HAuCl4 solution was heated to boiling, and then C6H5Na3O7 solution was added to continue the reaction. Then, ascorbic acid solution was added, and AgNO3 solution was added dropwise until the reaction solution turned orange-yellow. The reaction solution was then naturally cooled to room temperature to obtain Au@Ag NPs. S2. First, prepare tetrodotoxin standard solutions of different concentrations, add the tetrodotoxin standard solutions into the hairpin probe-based colorimetric-SERS dual-mode biosensor, and then add Au@Ag NPs and mix well to obtain a mixed solution; First, the absorbance characteristic value of the mixed solution is measured, and a standard curve between the absorbance characteristic value and the corresponding concentration is established; then, the SERS intensity value of the mixed solution is measured, and a standard curve between the SERS intensity value and the corresponding concentration is established; S3. Detection of tetrodotoxin content in food samples: Pretreat the food and extract a solution containing TTX as the test solution. Then, follow the procedures of step 6, except that the tetrodotoxin standard solution is replaced with the test solution. Finally, the absorbance characteristic value and SERS intensity value are measured and applied to the standard curve obtained in step 6 to calculate the tetrodotoxin content in the food.
5. The use according to claim 4, characterized in that In step S1, the concentration of HAuCl4 solution is 0.1-10 mM, the concentration of C6H5Na3O7 solution is 0.1-10 wt%, the concentration of AgNO3 solution is 1-20 mM, the concentration of ascorbic acid solution is 1-20 mM, and the reaction time is 10-120 min; the volume ratio of the HAuCl4 solution, C6H5Na3O7 solution, AgNO3 solution and ascorbic acid solution is 25:1:1:
4.
6. The use according to claim 4, characterized in that In step S2, the concentration range of the tetrodotoxin standard solution is 0.01-100 ng / mL.
7. The use according to claim 4, characterized in that In step S2, the volume ratio of the tetrodotoxin standard solution to the HP solution in the hairpin probe-based colorimetric-SERS dual-mode biosensor is 1:1; the volume ratio of the tetrodotoxin standard solution to Au@Ag NPs is 3:
20.
8. The use according to claim 4, characterized in that In step S2, the step of determining the characteristic value of the mixed solution is as follows: determining and recording the absorbance A of the specific detection system at 520 nm after adding the tetrodotoxin standard solution. 520 and the absorbance at 680 nm 680 ; Then take the quotient of the two, that is, A 520 / A 680 As the characteristic absorbance value of the detection solution; Measure and record the specific detection system after adding tetrodotoxin standard solution at 1096 cm under 785 nm excitation light. -1 The SERS intensity value I0 at , I0 is the characteristic value of the SERS intensity signal of the detection solution.
Citation Information
Patent Citations
Preparation of gold magnetic nano particle and quick detection thereof on tetrodotoxin by combining with surface enhanced raman spectrometry
CN107271423A
Application of noble metal doped metal organic framework composite material in detection of tetrodotoxin and detection method of tetrodotoxin
CN113624730A