Electrochemical DNA sensor based on cryoablation for miR-21 detection

Abstract

The present invention discloses a kind of high-efficiency electrochemical DNA sensor and its preparation and application, belong to the field of electrochemical biosensor technology, by introducing freeze-thaw technology, effectively accelerates the molecular motion and collision frequency during HCR process, thereby significantly shortening the reaction time, so that the whole detection process can be completed within 30 minutes, target miR-21 is combined with capture probe to trigger HCR process, generate long-chain DNA polymer and greatly amplify the detection signal, introduce methylene blue as electrochemical label, utilize its redox reaction on electrode surface to produce measurable electrical signal, realize rapid and sensitive quantitative detection of miR-21. The method shows excellent linearity and sensitivity in the extremely low concentration range of 1×10-9M~2.5×10-14M, with a detection limit as low as 1.0×10-14M, easy to operate, good reproducibility, and provides a new approach for the clinical detection of miR-21, with broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of electrochemical biosensors, and in particular relates to an electrochemical DNA sensor based on a freezing method and the preparation and application thereof. Background Art

[0002] MicroRNA (miRNA) is a small, non-coding, single-stranded RNA with a length of 18-25 nucleotides that is present in biological fluids such as blood, urine, and saliva. As a potential biomarker for tumor diagnosis, miR-21 is associated with a variety of cancers, including breast, lung, liver, brain, pancreatic, and prostate cancers, and its detection is of great significance in clinical applications. However, due to the small number of bases, low abundance, and easy degradation of miR-21, traditional detection methods such as colorimetry, chemiluminescence, fluorescence analysis, and high-performance liquid chromatography have shortcomings such as insufficient sensitivity and specificity, complex procedures, high costs, and prolonged detection times, which seriously restrict its application in clinical diagnosis. Therefore, the development of new methods for sensitive, specific, and stable detection of miR-21 levels is of great clinical significance.

[0003] Electrochemical DNA biosensors based on nucleic acid hybridization can specifically recognize and detect specific nucleic acid sequences, offering advantages such as simple operation, rapid response, high sensitivity, and strong specificity. Such sensors have been widely used for the determination of related substances in fields such as disease diagnosis, environmental monitoring, drug development, and food safety. In recent years, a number of electrochemical DNA biosensors have been developed for the specific and direct determination of miR-21. Due to the extremely low abundance of miR-21 in biological fluids such as blood, conventional electrochemical DNA biosensors require signal amplification to achieve the required sensitivity. Non-enzymatic amplification strategies based on DNA cascade reactions, such as hybridization chain reaction (HCR) and catalytic hairpin assembly (CHA), have become important amplification methods for electrochemical biosensing platforms due to their advantages such as enzyme independence, versatility, and low cost.

[0004] Although strategies based on DNA cascade reactions have advantages in amplification efficiency, they are limited by the slow DNA hybridization kinetics. The incubation time of traditional methods is long, and the incubation time for full reaction usually takes 2-3 hours. Therefore, how to shorten the detection time has become an important research direction. The use of electrochemical DNA biosensor-based methods for rapid and sensitive miR-21 detection remains a challenge. Summary of the Invention

[0005] Given the extremely low abundance of miR-21 in biological fluids, traditional detection methods have difficulty achieving sufficient sensitivity. The DNA cascade reaction-based strategy for detecting miR-21 is limited by slow DNA hybridization kinetics, resulting in long incubation times. The present invention aims to provide an electrochemical DNA sensor for detecting miR-21, as well as its preparation and application.

[0006] In order to achieve the above object, the present invention has formulated the following technical solutions:

[0007] The present invention provides an electrochemical DNA sensor for detecting miR-21. The sensor is a three-electrode system sensor. The working electrode of the sensor is a gold electrode surface modified with a hairpin probe complementary to miR-21 as a capture chain. One end of the hairpin probe is provided with a sequence complementary to miR-21 for specifically capturing miR-21; the other end forms a hairpin structure to maintain the stability of the probe in solution. When a sample to be tested contains miR-21, miR-21 hybridizes with the capture chain, and then hairpin chains H1 and H2 are introduced to form a long-chain double-stranded DNA polymer formed by alternating hybridization of hairpin chains H1 and H2. Methylene blue MB is inserted into the double chain as an electrochemical label.

[0008] The base sequence of the capture chain is shown in SEQ ID NO: 1; the base sequence of miR-21 is shown in SEQ ID NO: 2; the base sequence of the hairpin chain H1 is shown in SEQ ID NO: 3; and the base sequence of the hairpin chain H2 is shown in SEQ ID NO: 4.

[0009] The present invention provides a method for preparing the electrochemical DNA sensor for detecting miR-21, comprising: preparing a reduced thiol miR-21 capture chain; freezing, thawing, washing, and sealing a gold electrode modified with the reduced thiol miR-21 capture chain to obtain an electrochemical DNA sensor modified with the miR-21 capture chain.

[0010] The preparation of the reduced thiolated miR-21 capture chain comprises: mixing the reducing agent tris(2-carboxyethyl)phosphine with the thiolated miR-21 capture chain in a volume ratio of 1 to 2:3, and standing the mixture at room temperature in the dark for 1 to 2 hours.

[0011] Furthermore, the concentration of tris(2-carboxyethyl)phosphine (TCEP) is 100 mM, and the concentration of the thiol-miR-21 capture chain is 100 μM.

[0012] The freezing temperature of the reduced thiol miR-21 capture chain modified gold electrode is -20°C, and the freezing time is 10 to 20 minutes; the blocking agent used is Tris-HCl buffer containing 6-mercaptohexanol (MCH), and the blocking conditions are incubation at room temperature for 1 to 2 hours. The volume of the blocking agent is 200 μL to 400 μL.

[0013] Furthermore, the molar concentration of the Tris-HCl buffer containing MCH is 10 mM to 15 mM, and the molar concentration of MCH is 1 mM to 2 mM.

[0014] At the same time, the present invention provides a method for detecting miR-21 using the electrochemical DNA sensor for detecting miR-21, comprising:

[0015] (1) Processing a sample containing miR-21 to be tested; under freezing conditions, dripping a solution containing the sample to be tested of miR-21 onto the surface of a working electrode of the electrochemical DNA sensor for detecting miR-21 according to claims 1 to 2, performing a hybridization reaction, and after the reaction is completed, washing the working electrode obtained after hybridization reaction with the sample to be tested of miR-21;

[0016] (2) Under freezing conditions, a mixed solution containing hairpin chains H1 and H2 is added dropwise to the surface of the working electrode after hybridization reaction with the miR-21 sample to be tested in step (1) to perform HCR reaction. After the reaction is completed, the working electrode is washed and immersed in a methylene blue MB solution after the HCR reaction;

[0017] (3) The working electrode, counter electrode and reference electrode are placed in a buffer solution, and the electrical signal of the working electrode is collected by differential pulse voltammetry. A standard curve is drawn based on the difference in electrical signals and the concentration of miR-21 to achieve quantitative detection of miR-21.

[0018] The hybridization reaction temperature is -20°C, and the reaction time is 10 to 20 minutes.

[0019] In step (2), the added amount of the mixed solution containing hairpin chains H1 and H2 is in a volume ratio of 1:1 to 2 to the solution containing miR-21 to be tested, the HCR reaction temperature is -20°C, and the reaction time is 10 min to 20 min.

[0020] Furthermore, the concentration of the mixed solution containing the hairpin chains H1 and H2 is 0.01 μM-5 μM, and the volume ratio of the hairpin chain H1 to the hairpin chain H2 is 1:1.

[0021] The working electrode after the HCR reaction is immersed in a methylene blue MB solution for 20 to 40 minutes.

[0022] Furthermore, the methylene blue MB solution is a 1×PBS solution containing 40 μM to 60 μM MB.

[0023] The concentration of the miR-21 test sample was 1.0×10 -9 ~2.5×10 -14 M; the buffer solution is a PB buffer solution containing NaCl with a molar concentration of 150mM, and the molar concentration of the PB buffer solution is 10mM.

[0024] Compared with the prior art, the present invention achieves the following technical effects:

[0025] The electrochemical DNA sensor for detecting miR-21 provided by the present invention achieves highly specific capture of miR-21 by modifying a hairpin probe complementary to miR-21 on the working electrode, reducing interference from nonspecific binding. After the hairpin probe hybridizes with miR-21, it forms a long double-stranded DNA polymer through HCR amplification, significantly amplifying the detection signal and improving the sensitivity of the sensor. The design of the hairpin structure ensures the stability of the probe in solution and prevents nonspecific hybridization and degradation. The entire detection process, including hybridization and HCR amplification, can be completed within 30 minutes, significantly shortening the detection time. The preparation and detection steps of the sensor are relatively simple, requiring no complex instruments and equipment, and is suitable for wide application in laboratories and clinics. The strong binding affinity of MB to the DNA double strand makes the electrochemical signal more stable and easy to detect, further enhancing the sensitivity of the sensor. The sensor can detect the presence of 1.0×10 -14 The detection of miR-21 at extremely low concentrations of M showed extremely high sensitivity; it showed good reproducibility in multiple repeated experiments, ensuring the stability and reliability of the test results, which is of great significance for the identification of trace biomarkers in clinical testing.

[0026] Furthermore, by clearly providing the base sequences of the capture strand, miR-21, and hairpin strands H1 and H2 (SEQ ID NOs: 1-4), the sensor ensures accurate recognition and specific hybridization of miR-21; the specific sequence design optimizes the efficiency of the HCR reaction, enabling the more efficient formation of long-chain, gapped double-stranded DNA polymers and the insertion of more methylene blue electrochemical tags, thereby improving the detection signal intensity.

[0027] The present invention provides a method for preparing an electrochemical DNA sensor for detecting miR-21. The method exposes the sulfhydryl groups of the capture chain through reducing agent treatment, facilitating the formation of stable chemical bonds with gold atoms on the surface of a gold electrode, thereby improving the fixation efficiency and stability of the capture chain on the electrode surface. The freeze-thaw method effectively improves the collision efficiency between miR-21 and the capture probe on the sensing surface, accelerating the recognition reaction. Compared with the traditional room temperature method, the freezing strategy significantly shortens the HCR reaction time from the usual 2-3 hours to 30 minutes, achieving rapid detection. At the same time, an isothermal amplification HCR strategy is introduced, utilizing alternating hybridization between hairpin probes H1 and H2 to form long-chain, gapped double-stranded DNA polymers, significantly amplifying the electrochemical signal and thus improving the sensitivity of detection. As a non-enzymatic amplification strategy, HCR avoids the use of enzymes, reduces costs, and simplifies the operation process.

[0028] Furthermore, by optimizing the ratio of reducing agent to thiolated miR-21 capture chain and reaction time, an efficient reductive thiolation process was achieved; the reaction was carried out at room temperature in the dark, protecting the biological activity of the capture chain and avoiding unnecessary degradation and inactivation; freezing treatment may have accelerated the subsequent hybridization and HCR reaction rates by changing the intermolecular interaction force.

[0029] The electrochemical DNA sensor method for detecting miR-21 provided by the present invention has significant advantages such as high sensitivity, high selectivity, rapidity, simple operation, and low cost. Hybridization and HCR reactions are carried out at -20°C, significantly improving the reaction rate and efficiency, making the detection process faster and more sensitive. Differential pulse voltammetry is used to collect electrical signals, effectively suppressing background noise and interfering signals, improving the accuracy and reliability of detection. By plotting a standard curve between the electrical signal difference and the miR-21 concentration, quantitative detection of miR-21 is achieved, providing a reliable basis for clinical testing. Methylene blue (MB) is inserted into double-stranded DNA polymers as an electrochemical label, significantly enhancing the detection signal. Appropriate immersion time and MB concentration ensure signal stability and repeatability. This method is effective in the miR-21 concentration range of 1.0×10 -9 ~2.5×10 -14 The detection limit was as low as 1.0×10 -14 M, showing extremely high sensitivity, can detect extremely low concentrations of miR-21, and is suitable for the detection of trace disease markers. The electrochemical DNA sensor of the present invention has shown the advantages of high efficiency, high sensitivity, specificity, rapidity, simple operation and good reproducibility in the detection of miR-21, providing a new approach and reliable tool for the clinical detection of miR-21. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a schematic diagram of the HCR reaction of the electrochemical DNA sensor of the present invention.

[0031] Figure 2 The performance comparison of miR-21 hybridization reaction under room temperature and freezing conditions is shown. The apparent density of the sensor capture probe used is medium density (4.32×10 12 molecules / square centimeter).

[0032] Figure 3 Optimization diagram for the concentration of introduced hairpin chains H1 and H2.

[0033] Figure 4 Optimization diagram of capture probe apparent density for constructing electrochemical DNA sensor for miR-21 detection. A is the low-density sensing interface (1.02×10 12 molecules / cm2) before and after recognition of target miR-21 at room temperature and freezing conditions. B is the high-density sensing interface (9.60×10 12 molecules / cm2) before and after recognition of target miR-21 at room temperature and frozen conditions;

[0034] Figure 5 The present invention detects miR-21 reactions at room temperature and under freezing conditions, wherein A is a comparison of the reaction times for detecting miR-21 at room temperature and under freezing conditions; B is a differential pulse voltammetric response graph for the hybridization chain reaction at different time points at room temperature; and C is a differential pulse voltammetric response graph for the hybridization chain reaction at different time points at freezing conditions;

[0035] Figure 6 The linear relationship between the current difference of the electrochemical DNA sensor based on the freezing method and the logarithm of the miR-21 concentration under room temperature and freezing conditions. DETAILED DESCRIPTION

[0036] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0037] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in this field can be used. If the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional reagents.

[0038] Example 1

[0039] The electrochemical DNA sensor based on HCR was used for the detection of miR-21, see Appendix Figure 1 As shown, this embodiment provides the construction of an electrochemical DNA sensor for detecting miR-21

[0040] 1. Gold electrode cleaning

[0041] Before modification, the gold electrode was polished on chamois leather suspended in 0.3 μm alumina powder for 3 minutes and then ultrasonically cleaned in ethanol for 3 minutes. Next, the electrode was further polished on chamois leather suspended in 0.05 μm alumina powder. This step was followed by ultrasonic cleaning in ethanol and water for 3 minutes each. Next, a series of oxidation and reduction cycles were performed using cyclic voltammetry in 0.5 M H2SO4, 0.01 M KCl / 0.1 M H2SO4, and 0.05 M H2SO4, with a potential window of -0.1 V to 1.5 V and a scan rate of 100 mVs. -1 , to further clean the electrode.

[0042] 2. Preparation of reduced thiolated miR-21 capture chain

[0043] TCEP with a molar concentration of 100 mM and thiolated miR-21 capture chain with a molar concentration of 100 μM were mixed in a volume ratio of 3:2; and the mixture was allowed to stand at room temperature in the dark for 1 to 2 hours to obtain the reduced thiolated miR-21 capture chain.

[0044] 3. Preparation of Working Electrode

[0045] The gold electrode was cleaned and dried; 2 μL to 5 μL of reduced thiolated miR-21 capture chain was added dropwise to the surface of the gold electrode, frozen at -20°C for 10 to 20 minutes, and then thawed; the electrode was washed three times with 1xPBS to remove unbound capture chain.

[0046] Block the cells with 200 μL to 400 μL of 10 mM Tris-HCl buffer containing 1 mM 6-mercaptohexanol (MCH) and incubate at room temperature for 1 to 2 hours to prevent nonspecific adsorption.

[0047] 4. miR-21 detection

[0048] 2 μL to 5 μL of the test miR-21 solution of different concentrations were added dropwise to the surface of the modified gold electrode and reacted at -20°C for 15 min. The electrode was removed, dissolved at room temperature, and washed three times with 1×PBS.

[0049] 2 μL to 5 μL of a mixed solution containing hairpin chains H1 and H2 (concentration range 0.01 μM to 5 μM) was added dropwise to the surface of the gold electrode after miR-21 hybridization. The HCR reaction was carried out for 15 minutes at room temperature or frozen (-20°C). The electrode was immersed in 1× PBS containing 50 μM MB and reacted for 30 minutes to allow MB to insert into the formed double-stranded DNA polymer. The electrical signal was collected using differential pulse voltammetry (DPV).

[0050] The base sequence of the capture strand is shown in SEQ ID NO: 1; the base sequence of miR-21 is shown in SEQ ID NO: 2; the base sequence of the hairpin strand H1 is shown in SEQ ID NO: 3; and the base sequence of the hairpin strand H2 is shown in SEQ ID NO: 4. The specific sequences are as follows:

[0051] The base sequence of the capture strand (as shown in SEQ ID NO: 1) is:

[0052] 5′-HS-TCAACATCAGTCTGATAAGCTAGCATCCTAGCTTATCAGACTGA AGCTA;

[0053] The base sequence of miR-21 (as shown in SEQ ID NO: 2) is:

[0054] UAGCUUAUCAGACUGAUGUUGA;

[0055] The base sequence of hairpin strand H1 (as shown in SEQ ID NO: 3) is:

[0056] TATCAGACTGAAGCTATTCAAAGTTAGCTTCAGTCTGATAAGCTAGGA;

[0057] The base sequence of hairpin strand H2 (as shown in SEQ ID NO: 4) is:

[0058] ACTTTGAATAGCTTCAGTCTGATATCCTAGCTTATCAGACTGAAGCTAT T.

[0059] 5. Data Analysis

[0060] The miR-21 samples were tested at different concentrations (1.0×10 -9 ~2.5×10 -14 M) as the abscissa and the corresponding electrical signal difference (compared with the blank control) as the ordinate to draw a standard curve; the quantitative detection of unknown concentration of miR-21 can be achieved through the standard curve.

[0061] Example 2

[0062] This example is based on Example 1, and an optimization experiment is performed on the preparation parameters.

[0063] Preparation of reduced thiolated miR-21 capture chain modified gold electrode: 3 μL of 100 mM TCEP was mixed with 2 μL of 100 μM thiolated miR-21 capture chain and allowed to stand at room temperature in the dark for 1 h to obtain reduced thiolated miR-21 capture chain.

[0064] The gold electrode was cleaned and dried; 2 μL-5 μL of reduced thiolated miR-21 capture chain was added to the gold electrode surface and frozen at -20°C for 15 min; the electrode was washed three times with 1xPBS to remove unbound capture chain; and blocked with 300 μL of 10 mM Tris-HCl buffer containing 1 mM MCH and incubated at room temperature for 1 h to displace any nonspecifically adsorbed DNA and passivate the remaining electrode area.

[0065] By varying the concentration of miR-21 capture strand used during sensor fabrication, the apparent density of the electrode surface can be controlled, with low-density sensing interfaces (1.02×10 12 molecules / cm2), medium density sensing interface (4.32×10 12 molecules / cm2) and high-density sensing interface (9.60×10 12 molecules / square centimeter). The density of capture chains on the surface of the sensing electrode was determined by amperometry. The solution used was 10 mM tris buffer (pH = 7.4) or 10 mM tris buffer (pH = 7.4) containing 50 μM RuHex. Before the experiment, the electrode was immersed in the corresponding solution for 10 minutes. The electrode surface charge was measured using a two-step coulometric method with a potential step range of 0 to -0.350 V and then back to 0 V (relative to Ag / AgCl (3 M KCl)) and a pulse period of 250 ms. The measured charge was obtained by electrostatic binding of RuHex to the negatively charged backbone of the capture chain immobilized on the surface. The apparent density (Γss) of the probe DNA immobilized on the electrode surface was then calculated using formula (1).

[0066] Γ SS =(Q SS N A / nFA)(z / m) (1)

[0067] where n is the number of electrons per molecule used for reduction, F is the Faraday constant, A is the area of ​​the Au electrode, m is the number of bases in the immobilized DNA, z is the charge on the RuHex, and N Ais Avogadro's number.

[0068] Electrochemical Testing: All electrochemical measurements were performed in a three-electrode cell (gold working electrode, platinum counter electrode, and Ag / AgCl reference electrode), and the electrical signals were recorded using a CHI 760E electrochemical workstation. The sampling method used in the experiment was differential pulse voltammetry (DPV), with an amplitude of 50 mV, a step potential of 4 mV, a pulse width of 5 ms, a sample width of 1.67 ms, and a potential window of 0 to -0.5 V (relative to Ag / AgCl (3 M KCl)).

[0069] (1) Detection of miR-21 using HCR strategy based on freezing method

[0070] The isothermal amplification HCR strategy was introduced into the sensing system. Methylene blue (MB) has a strong binding affinity to double-stranded DNA and serves as an electrochemical label. Using miR-21 (100 pM) as an initiator, the capture hairpin probe (hairpin) DNA on the surface of the sensor electrode was opened using both room temperature and freezing methods. Subsequently, the hairpin chains (H1 and H2) were introduced to trigger HCR to form a nicked double helix with several to dozens of repeating units. The signals under different conditions were tested. For details, see the attached figure. Figure 2 shown.

[0071] By the attached Figure 2 The data shows that the freezing method achieves a 786% signal gain within 30 minutes, far exceeding the 458% signal gain achieved by the room temperature method within 180 minutes. This significant difference demonstrates the significant advantages of the freezing method in accelerating the HCR reaction and improving detection sensitivity. The freezing method alters the conformation and kinetic behavior of DNA molecules by lowering the temperature, as the conformation and stability of DNA are significantly affected by temperature. Shorter reaction times mean higher detection efficiency, which is particularly important for applications requiring rapid diagnosis.

[0072] (2) Effect of hairpin chain concentration on HCR reaction

[0073] In the HCR reaction, the concentrations of hairpin chains H1 and H2 have a significant impact on the reaction efficiency and product formation. Therefore, this experiment mainly investigates the effect of the concentrations of hairpin chains H1 and H2 on the HCR reaction. By optimizing the concentrations of these two hairpin chains, the overall efficiency and reliability of the HCR reaction can be improved. For specific results, see the attached Figure 3 shown.

[0074] By the attached Figure 3The data show that with the increase in the concentration of hairpin chains H1 and H2, the signal response of the HCR reaction is usually significantly enhanced. This is because more hairpin chain molecules can be used to form hybrid products, thereby amplifying the detection signal. Under the freezing method, a reaction platform was observed when the hairpin chain concentration reached 1 μM, which means that at this concentration, the efficiency of the HCR reaction has reached saturation or near saturation, and further increasing the concentration will not significantly increase the signal intensity. No obvious platform was observed under the room temperature method. Based on the above analysis, it is reasonable to select a concentration close to but not exceeding the reaction platform as the optimal concentration to optimize the overall efficiency and reliability of the HCR reaction while avoiding waste and potential negative effects (such as nonspecific binding); therefore, the optimal concentration of hairpin chains H1 and H2 used in this experiment is 1 μM.

[0075] (3) Optimization of sensor apparent density

[0076] The performance of the electrochemical DNA sensor is closely related to the apparent density of the sensor. Apparent density optimization is achieved by observing the signal gain at a concentration of 100 pM miR-21 as an indicator. This indicator is calculated based on the difference between the original signal observed in the absence of miR-21 and the peak signal after the addition of miR-21. Specific test data can be found in the attached Figure 4 shown.

[0077] By the attached Figure 4 The data shows that Figure 4 In the figure, A is the low-density sensing interface (1.02×10 12 molecules / cm2) before and after recognition of target miR-21 at room temperature and freezing conditions. B is the high-density sensing interface (9.60×10 12 Differential pulse voltammograms of (molecular weight per square centimeter) before and after recognition of target miR-21 at room temperature and frozen conditions.

[0078] At lower probe densities, the signal gain was relatively low. The room temperature method and the frozen method only showed 492% and 608% signal gains at low-density miR-21 sensors, and the difference between the room temperature method and the frozen method was not obvious.

[0079] At medium density, the freezing method can significantly improve the signal gain compared with the room temperature method. This is because after freezing, accompanied by the formation of ice, miR-21 can be effectively dehydrated and concentrated on the electrode surface, thereby improving the efficiency of the hybridization reaction between the probe and the target miRNA (miR-21). However, as the probe density increases to medium density (4.32×10 12 molecules / cm2), the gain of the freezing method increased significantly to 786%, while that of the room temperature method was only 458%.

[0080] For sensors with higher density, the signal gain of both the room temperature method and the freezing method decreased significantly. This is mainly due to the increase in charge electrostatic repulsion and steric hindrance between probe molecules at high density, which leads to the obstruction of hybridization reaction and reduced signal transmission efficiency.

[0081] Therefore, the signal gain of the freezing method at medium density is significantly higher than that of the room temperature method, while the difference between the two is small at low and high densities or both show a decreasing trend in signal gain.

[0082] (4) HCR reaction kinetics analysis

[0083] This experiment studied the HCR reaction kinetics characteristics of room temperature method and freezing method. The specific results are shown in the attached Figure 5 shown.

[0084] By the attached Figure 5 The data shows that Figure 5 Figure A shows a comparison of the reaction times for miR-21 detection at room temperature and under frozen conditions. Figure B shows the differential pulse voltammetric responses to the hybridization chain reaction at different time points at room temperature. Figure C shows the differential pulse voltammetric responses to the hybridization chain reaction at different time points under frozen conditions. Under frozen conditions, the HCR reaction rapidly reaches a plateau, requiring approximately 30 minutes. At room temperature, the HCR reaction kinetics are significantly slower, requiring longer to reach a similar reaction level. The time-varying electrochemical signals of the HCR reaction at room temperature were recorded using differential pulse voltammetry (DPV). With increasing reaction time, the DPV response gradually increased, but at a slower rate, indicating that the kinetics of the HCR reaction at room temperature are relatively flat, six times slower than those of sensors based on phase change strategies. The electrochemical signals of the HCR reaction under frozen conditions were recorded using DPV. The DPV response rapidly increased within a short period of time and reached a plateau at approximately 30 minutes, indicating that the freezing method significantly accelerated the kinetics of the HCR reaction. The solid-liquid phase transition that occurs during freezing causes the target molecule (miR-21) and the capture probe to be concentrated and squeezed between ice crystals, increasing the probability of collision between them. This physical proximity promotes the hybridization reaction and significantly increases the reaction rate.

[0085] It can be seen that the freezing method shows significant advantages in HCR reaction kinetics and can reach the reaction platform in a shorter time, thereby improving detection efficiency and sensitivity. It is of great significance for the development of fast and efficient electrochemical DNA sensors, especially in application scenarios that require rapid detection of low-concentration target molecules.

[0086] (5) Detection of miR-21

[0087] Under optimal experimental conditions, we used the freezing method to quantify miR-21. The specific results are shown in the attached Figure 6 shown.

[0088] By the attached Figure 6 The data show that under optimal experimental conditions, when using the freezing method to detect miR-21, the current difference ΔI increases with increasing miR-21 concentration. This indicates that the current difference ΔI can serve as a reliable indicator of miR-21 concentration.

[0089] The concentration range of miR-21 was 1×10 -9 M to 2.5×10 -14 When the current difference ΔI was 1.5747mM, the logarithm of the miR-21 concentration showed a good linear relationship. This linear relationship was represented by the fitting equation ΔI = 1236.95 + 88.67c(R 2 =0.990), where R 2 The value is close to 1, indicating that the fit is very high and the linear relationship is very reliable.

[0090] The detection limit of the freezing method reached 1.0×10 -14 M, which is comparable to the detection limit of 2.5×10 -13 M was significantly reduced, indicating that the frozen method has higher sensitivity in detecting low concentrations of miR-21. All error bars are relatively small relative to the average ΔI, showing good reproducibility. Compared with the room temperature method, the detection limit is only 2.5×10 -13 The detection limit of the freezing method is as low as 1.0×10 -14 The cryo-method can achieve such a low detection limit due to its increased reaction rate.

[0091] In addition, compared with the room temperature method, our sensor also exhibits a rapid hybridization reaction. The hybridization reaction speed under the freezing method is significantly accelerated and the detection can be completed in only 30 minutes. This advantage makes the sensor more competitive in application scenarios that require rapid detection.

[0092] Therefore, the electrochemical DNA sensor based on the freezing method of the present invention has achieved remarkable results in the detection of miR-21, which not only improves the sensitivity and speed of detection, but also provides a new technical platform for research and application in related fields, promotes the development of low-cost, high-performance sensing technology, and has huge application potential.

[0093] The above content is only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. An electrochemical DNA sensor for detecting miR-21, the sensor being a three-electrode system sensor, characterized in that: The working electrode of the sensor is a gold electrode surface modified with a hairpin probe complementary to miR-21 as a capture chain. One end of the hairpin probe is provided with a sequence complementary to miR-21 for specifically capturing miR-21; the other end forms a hairpin structure to maintain the stability of the probe in solution. When the sample to be tested contains miR-21, miR-21 hybridizes with the capture chain, and then introduces hairpin chain H1 and hairpin chain H2 to form a long-chain double-stranded DNA polymer formed by alternating hybridization of hairpin chain H1 and hairpin chain H2. Methylene blue MB is inserted into the double chain as an electrochemical label.

2. The electrochemical DNA sensor for detecting miR-21 according to claim 1, characterized in that The base sequence of the capture chain is shown in SEQ ID NO: 1; the base sequence of miR-21 is shown in SEQ ID NO: 2; the base sequence of the hairpin chain H1 is shown in SEQ ID NO: 3; and the base sequence of the hairpin chain H2 is shown in SEQ ID NO:

4.

3. The method for preparing the electrochemical DNA sensor for detecting miR-21 according to any one of claims 1 to 2, characterized in that: A reduced thiol miR-21 capture chain is prepared; a gold electrode modified with the reduced thiol miR-21 capture chain is frozen, thawed, washed, and sealed to obtain an electrochemical DNA sensor modified with the miR-21 capture chain.

4. The method for preparing an electrochemical DNA sensor for detecting miR-21 according to claim 3, characterized in that: The preparation of the reduced thiolated miR-21 capture chain comprises: mixing the reducing agent tris(2-carboxyethyl)phosphine with the thiolated miR-21 capture chain in a volume ratio of 1 to 2:3, and standing the mixture at room temperature in the dark for 1 to 2 hours.

5. The method for preparing an electrochemical DNA sensor for detecting miR-21 according to claim 3, characterized in that: The freezing temperature of the reduced thiol miR-21 capture chain modified gold electrode is -20°C, and the freezing time is 10 to 20 minutes. The blocking agent used in the blocking is Tris-HCl buffer containing MCH, and the blocking condition is incubation at room temperature for 1 to 2 hours.

6. The method for detecting miR-21 using an electrochemical DNA sensor for detecting miR-21 according to any one of claims 1 to 2, characterized in that: include: (1) Processing a sample containing miR-21 to be tested; under freezing conditions, dripping a solution containing the sample to be tested of miR-21 onto the surface of a working electrode of the electrochemical DNA sensor for detecting miR-21 according to claims 1 to 2, performing a hybridization reaction, and after the reaction is completed, washing the working electrode obtained after hybridization reaction with the sample to be tested of miR-21; (2) Under freezing conditions, a mixed solution containing hairpin chains H1 and H2 is added dropwise to the surface of the working electrode after hybridization reaction with the miR-21 sample to be tested in step (1) to perform HCR reaction. After the reaction is completed, the working electrode is washed and immersed in a methylene blue MB solution after the HCR reaction; (3) The working electrode, counter electrode and reference electrode are placed in a buffer solution, and the electrical signal of the working electrode is collected by differential pulse voltammetry. A standard curve is drawn based on the difference in electrical signals and the concentration of miR-21 to achieve quantitative detection of miR-21.

7. The method for detecting miR-21 using an electrochemical DNA sensor according to claim 6, wherein: The hybridization reaction temperature is -20°C, and the reaction time is 10 to 20 minutes.

8. The method for detecting miR-21 using an electrochemical DNA sensor according to claim 6, wherein: In step (2), the added amount of the mixed solution containing hairpin chains H1 and H2 is in a volume ratio of 1:1 to 2 to the solution containing miR-21 to be tested, the HCR reaction temperature is -20°C, and the reaction time is 10 min to 20 min.

9. The method for detecting miR-21 using an electrochemical DNA sensor according to claim 6, wherein: The working electrode after the HCR reaction is immersed in a methylene blue MB solution for 20 to 40 minutes.

10. The method for detecting miR-21 using an electrochemical DNA sensor according to claim 6, wherein: The concentration of the miR-21 test sample was 1.0×10 -9 ~2.5×10 -14 M; the buffer solution is a PB buffer solution containing NaCl with a molar concentration of 150mM, and the molar concentration of the PB buffer solution is 10mM.

Images