A blocking elisa kit and method for detecting antibodies to lawsonia intracellularis

By providing a blocking ELISA kit, using LI-OmpA recombinant antigenic peptide and monoclonal antibody 5F2 to detect intracellular Lawsonia antibodies, the problems of inaccuracy and insensitivity in existing technologies are solved, enabling early and accurate antibody detection, suitable for large batches of samples.

CN119044482BActive Publication Date: 2025-11-18HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411081438.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-08
Publication Date
2025-11-18
Estimated Expiration
2044-08-08

AI Technical Summary

Technical Problem

Currently, there is a lack of commercially available blocking ELISA kits for the rapid and accurate detection of intracellular Lawsonia solani antibodies. Existing methods, such as PCR and indirect immunoassay, involve cumbersome and complex procedures. PCR detection is not suitable for testing large numbers of samples, nor is it suitable for detecting bacteria during the shedding period in infected animals. Indirect immunoassay and other methods are also unsuitable for detecting infected animals. Serological diagnostic methods are not suitable for testing large numbers of samples and are prone to false negatives due to the influence of medication.

Method used

A blocking ELISA kit is provided, comprising an ELISA plate coated with LI-OmpA recombinant antigen peptide and horseradish peroxidase-labeled LI-OmpA recombinant antigen peptide monoclonal antibody 5F2. The kit detects LI infection by detecting antibodies in serum, using the conserved, thermostable and immunogenic LI-OmpA recombinant antigen peptide as the coating antigen and the specific monoclonal antibody 5F2 as the enzyme-labeled secondary antibody.

Benefits of technology

It improves the accuracy and sensitivity of the test, enabling the detection of antibodies at an earlier stage after infection. It is suitable for testing large numbers of samples and has good specificity, sensitivity and repeatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119044482B_ABST
    Figure CN119044482B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of livestock pathogenic bacteria diagnosis, and particularly relates to a blocking ELISA kit and method for detecting Lawsonia intracellularis antibody. The kit comprises an LI-OmpA recombinant antigen peptide coated ELISA plate, an enzyme-labeled antibody, a positive control, a negative control, a sample diluent, a 20-fold concentrated washing solution, a substrate color developing solution and a termination solution. The method comprises using the LI-OmpA recombinant antigen peptide as a coating antigen and the enzyme-labeled LI-OmpA recombinant antigen peptide monoclonal antibody 5F2 as an enzyme-labeled antibody to establish the blocking ELISA method for the Lawsonia intracellularis antibody. The blocking ELISA kit for the Lawsonia intracellularis antibody provided by the application has the characteristics of high sensitivity and specificity, good repeatability and the like, and is suitable for the detection of high-throughput animal serum samples.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of livestock pathogenic bacteria diagnosis, and particularly relates to a blocking ELISA kit and method for detecting Lawsonia intracellularis antibodies. BACKGROUND

[0002] Lawsonia intracellularis (LI) mainly causes porcine proliferative enteropathy (PPE), which has typical symptoms of proliferative hemorrhagic enteropathy (PHE) and porcine intestinal adenomatosis (PIA).

[0003] At present, the methods for diagnosing Lawsonia intracellularis infection at home and abroad mainly include serology and various PCR methods for detecting fecal samples. PCR is the most commonly used pathogen detection method in laboratories and clinics. PCR is only suitable for detecting fecal samples of infected animals during the excretion period. The genome extraction step in feces is relatively cumbersome, is not suitable for detecting a large number of samples, and is prone to false negatives due to drug use. Serological diagnosis mainly relies on enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence test (IFA). These two methods have high sensitivity and specificity, and the specific antibodies against Lawsonia intracellularis can exist in the body for a longer time. The disadvantage is that the antibodies can be detected at least two weeks after infection.

[0004] Since there is no commercial blocking ELISA detection kit for serological diagnosis in China, it is necessary to provide a blocking ELISA kit to fill the gap in the field. SUMMARY

[0005] The purpose of the present application is to provide a blocking ELISA kit for detecting Lawsonia intracellularis antibodies conveniently and quickly. The detection kit has good sensitivity and specificity, and the detection result is accurate.

[0006] Specifically, the technical scheme of the present application is as follows:

[0007] A blocking ELISA kit for detecting Lawsonia intracellularis antibodies, comprising an ELISA plate coated with LI-OmpA recombinant antigen peptide, the amino acid sequence of which is shown in SEQ ID NO: 1, and horseradish peroxidase-labeled LI-OmpA recombinant antigen peptide monoclonal antibody 5F2, i.e., enzyme-labeled antibody, against the LI-OmpA recombinant antigen peptide monoclonal antibody 5F2 (monoclonal antibody 5F2 is produced by hybridoma cell strain 5F2, which was deposited by the applicant with the China Center of Typical Culture Collection of Wuhan University in Wuhan, China on September 15, 2023; the deposit number is CCTCC NO: C2023263).

[0008] As an optional or preferred technical solution, in the above-mentioned kit, the LI-OmpA recombinant antigen peptide nucleotide sequence is shown in SEQ ID NO: 2.

[0009] As an optional or preferred technical solution, in the above-mentioned kit, the LI-OmpA recombinant antigen peptide can be prepared by the following method steps:

[0010] 1) Obtain the LI.N343 strain ompA nucleic acid and amino acid sequence from the NCBI website, and extract DNA from the bacterial solution in the pig ileitis live vaccine

[0011] as a template, and use the nucleotides shown in SEQ ID NO: 3-4 as primers to clone the ompA sequence without the signal peptide and transmembrane region.

[0012] 2) After double digestion of the target gene and the vector pET 30a(+), respectively, and then ligation, a pet 30a-ompA prokaryotic expression vector is obtained, which is transformed into Escherichia coli BL21, cultured, and positive clones are identified.

[0013] 3) After correct identification, inoculate the recombinant plasmid into LB medium containing kanamycin and culture at 37°C with shaking until the logarithmic growth phase.

[0014] 4) Add IPTG to a final concentration of 0.8 mmol / L, induce at 25°C for 16 h, and obtain the expressed LI-OmpA recombinant antigen peptide.

[0015] 5) After centrifugal filtration of the supernatant after bacterial collection and disruption, purify it by His-tag affinity chromatography, dialyze and concentrate the harvested antigen solution, and then LI-OmpA recombinant antigen peptide is obtained, which is aliquoted and stored at -70°C or below for future use.

[0016] As an optional or preferred solution, in the above kit, the coating method of the LI-OmpA recombinant antigen peptide is as follows: the LI-OmpA recombinant antigen peptide is diluted to 1 μg / mL with a coating solution at pH 9.6, added to a coating plate, 100 μL / well, placed at 4°C overnight, washed with PBST for 3 times, then a blocking solution is added for overnight blocking, the next day, the blocking solution is discarded, naturally dried at a humidity of 40% and room temperature, and the coating plate is sealed with a sealing machine to complete the coating.

[0017] As an optional or preferred solution, in the above kit, the horseradish peroxidase-labeled LI-OmpA recombinant antigen peptide monoclonal antibody 5F2 is prepared by the following method:

[0018] 1) The prepared LI-OmpA recombinant antigen peptide is used for subcutaneous multi-point injection immunization of Balb / C mice, and the serum antibody titer is detected 7 days after 3 times of immunization. The mouse with the highest antibody titer is selected for challenge immunization, and the bone marrow tumor cells SP2 / 0 and the spleen cells of the immunized mouse are fused 3 days after the challenge immunization.

[0019] 2) After cell fusion, the positive clone wells are screened out by the indirect ELISA method when the cloned cells grow to cover 1 / 2 area of the well bottom 10-14 days after fusion, and the positive hybridoma cell strain 5F2 is established by four rounds of subcloning by the limited dilution method.

[0020] 3) The monoclonal antibody 5F2 is labeled by the periodate oxidation method, and the concentration of the harvested enzyme-labeled antibody after dialysis is adjusted to 4±0.05 mg / ml. After adding an equal volume of glycerol as a stock solution, it is divided into 1 ml / tube and stored at -70°C and below for long-term storage.

[0021] 4) The enzyme-labeled antibody stock solution is diluted 5000 times with a protective agent, and filtered with a 0.22 μm filter to remove bacteria, which is the enzyme-labeled antibody in the above kit.

[0022] 4) The enzyme-labeled antibody stock solution is diluted 5000 times with a protective agent, and filtered with a 0.22 μm filter to remove bacteria, which is the enzyme-labeled antibody in the above kit.

[0023] As an optional or preferred solution, in any of the above kits, the following are further included:

[0024] Positive control serum: SPF pig serum diluted 1:32 times with a protective agent after immunization with a live vaccine for swine ileitis;

[0025] Negative control serum: serum obtained from an SPF pig, diluted 1:32 times with a protective agent;

[0026] ​Sample diluent: sodium chloride (NaCl) 8.00 g, sodium phosphate dibasic 2.90 g, potassium phosphate monobasic 0.20 g, potassium chloride 0.20 g, sodium thiomersalate 0.20 g, add water for injection to 1000 ml, to form a clear solution;

[0027] Preparation of 20-fold concentrated washing solution: Tween 20 10.00 ml, sodium chloride 160.00 g, sodium phosphate dibasic 58.00 g, potassium phosphate monobasic 4.00 g, potassium chloride 4.00 g, sodium thiomersalate 4.00 g, add water for injection to 1000 ml, to form a clear solution;

[0028] Substrate color developing solution: commercial reagent TMB color developing solution.

[0029] Termination solution: take 27.20 ml of concentrated sulfuric acid and add to 900 ml of water for injection to form a clear solution, and add water for injection to 1000 ml.

[0030] Description:

[0031] pET-30a(+): an expression vector containing an anti-kana mycin gene, the corresponding expression host bacteria is Escherichia coli, which is used to express the target gene, and the genome contains protein tags N-His, N-T7 or C-His, which can be induced by IPTG or lactose and its analogues.

[0032] Escherichia coli BL21: a widely used host bacteria for protein expression, also known as Escherichia coli BL21(DE3) bacteria. The chromosome carries a T7 RNA polymerase gene controlled by the lacUV5 promoter, which can efficiently express the T7 promoter driven foreign target gene under the induction of IPTG.

[0033] IPTG: isopropyl-β-D-thiogalactoside, chemical formula C9H18O5S, which can cause the transcription process of lactose operon, so as to induce the expression of the protein corresponding to the gene downstream of the lactose operon.

[0034] Coating solution: sodium carbonate 1.59 g, sodium bicarbonate 2.93 g, add water for injection 900 ml, adjust pH to 9.6, and dilute to 1000 ml.

[0035] Blocking solution: bovine serum albumin (BSA) 5.00 g, commercially available; sodium chloride 8.00 g, commercially available; sodium phosphate dibasic 2.90 g, commercially available; potassium phosphate monobasic 0.20 g, commercially available; potassium chloride 0.20 g, commercially available; Tween 20 0.5 ml, commercially available; sodium thiomersalate 0.20 g, commercially available; add water for injection to 1000 ml, store at 2-8℃ for standby.

[0036] Protective agent bovine serum albumin (BSA) 5.00 g, commercially available; Tween-20 (Tween-20) 0.50 ml, commercially available; sodium chloride (NaCl) 8.00 g, commercially available; sodium phosphate dibasic dodecahydrate (Na2HPO4·12H2O) 2.90 g, commercially available; potassium dihydrogen phosphate (KHPO4) 0.20 g, commercially available; potassium chloride 0.20 g, commercially available; sucrose 2.00 g, commercially available; sodium mercurothiolate 0.20 g, commercially available; add water for injection to 1000 ml, store at 2-8℃ for standby.

[0037] Compared with the prior art, the present application has the following beneficial effects:

[0038] The blocking ELISA kit for detecting intracellular Lawsonia antibody provided by the present application uses LI-OmpA recombinant antigen peptide with good conservative type, thermal stability and immunogenicity as a coating antigen, and uses specific monoclonal antibody 5F2 against LI-OmpA recombinant antigen peptide as an enzyme-labeled secondary antibody, so that it can detect whether there is LI infection by detecting the antibody in the serum. Compared with pathogen detection, the antibody in the serum lasts longer, which can effectively improve the accuracy of detection. Moreover, the specificity, sensitivity and repeatability of the kit are good.

[0039] Description of the present application

[0040] Biological preservation name: hybridoma cell line 5F2

[0041] Latin name: Hybridoma cell line 5F2

[0042] Preservation number: CCTCC NO: C2023263

[0043] Preservation unit: China Center for Type Culture Collection

[0044] Preservation address: China. Wuhan. Wuhan University, postcode 430072

[0045] Preservation date: September 15, 2023 BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 : The present application pET30a-ompA plasmid construction diagram;

[0047] Figure 2 : The present application PCR amplification of ompA target fragment identification diagram;

[0048] Figure 3 : The present application pET30a-ompA plasmid double enzyme digestion identification diagram;

[0049] Figure 4: The SDS-PAGE Coomassie brilliant blue staining identification result schematic diagram of the 5F2 ascites monoclonal antibody purification in the application shows that the SDS-PAGE Coomassie brilliant blue staining identification result schematic diagram of the 5F2 ascites monoclonal antibody purification in the application shows that

[0050] Figure 5 : The columnar chart of blocking ELISA detection of the serum antibody level after Lawsonia intracellularis attack in the application shows that the columnar chart of blocking ELISA detection of the serum antibody level after Lawsonia intracellularis attack in the application shows that

[0051] Explanation of the sequence table:

[0052] (1) The sequence table SEQ ID NO:2 is the amino acid sequence table of ompA in the pET30a-ompA recombinant plasmid in Example 1 of the application, and the specific amino acid sequence is as follows:

[0053]

[0054] (2) The sequence table SEQ ID NO:1 is the nucleotide sequence table of ompA in the pET30a-ompA recombinant plasmid in Example 1 of the application, and the specific nucleotide sequence is as follows:

[0055]

[0056]

[0057] (3) The sequence table SEQ ID NO:3 is the upstream primer ompA-F for amplifying the LI-ompA gene in Example 1 of the application, and the specific nucleotide sequence is as follows.

[0058] gtggatccgttacagctagttgtactaaac

[0059] (4) The sequence table SEQ ID NO:4 is the downstream primer ompA-R for amplifying the LI-ompA gene in Example 1 of the application, and the specific nucleotide sequence is as follows.

[0060] Cggcggccgcctaatcaaaaaagacaagttct。 DETAILED DESCRIPTION

[0061] The application will be further described in conjunction with specific examples, and the advantages and characteristics of the application will be more clear with the description. However, it should be understood that the described examples are only exemplary, and do not constitute any limitation on the scope of the application. Those skilled in the art should understand that the details and forms of the technical solutions of the application can be modified or replaced without departing from the spirit and scope of the application, and these modifications or replacements all fall within the protection scope of the application.

[0062] Example 1 Cloning and expression of LI OmpA gene, protein purification

[0063] 1.1 Strains and plasmids

[0064] The pET30a(+) plasmid was preserved in the laboratory, a commonly used plasmid. It was used to construct the LI-OmpA recombinant antigen peptide; the encoding nucleotide sequence of the ompA gene is shown in SEQ ID NO: 2.

[0065] 1.2 Main experimental reagents and consumables

[0066] The SDS-PAGE kit was purchased from Yaenzyme Company; the RBCA protein quantification kit and BeyoGold TM His-tag Purification Resin (reduction-resistant chelating type) and IPTG were purchased from Biyun Tian Company; Tween-20 was purchased from Nanjing Wingsky Biological Technology Co., Ltd.; LB solid powder was purchased from Oxoid Company; the protein was prepared from Proteintech Company; cell culture plates were purchased from Biofil Company; other chemical reagents were commercially available common reagents. The reagents used in the laboratory of the Animal Science and Technology College and the College of Animal Medicine of the applicant were prepared on site, and the purity of the reagents was analytical pure.

[0067] 1.3 Construction of LI-ompA prokaryotic expression plasmid

[0068] 1.3.1 Cloning of LI ompA gene

[0069] According to the prediction results of LI ompA bioinformatics, the signal peptide and transmembrane region ompA were designed, and the recombinant plasmid map was constructed using snapGene3.2.1 (see Figure 1 ) and the upstream and downstream primers ompA-F and ompA-R were designed. The primers contain the enzyme digestion sites BamH-Ⅰ and Not-Ⅰ, and the primers were synthesized by Wuhan Qikexing Biological Technology Co., Ltd. The sequence information is shown in SEQ ID NO: 3-4. The PCR reaction system for amplifying the ompA gene is shown in Table 1:

[0070] Table 1 PCR reaction system for amplifying the ompA gene

[0071]

[0072] According to the above reaction system, the target fragment was amplified by the reaction program of 98℃ pre-denaturation for 3 min, 98℃ denaturation for 15 s, 50℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles, and 72℃ extension for 3 min. The size of the amplified fragment was 1023 bp (see Figure 2 ).

[0073] 1.3.2 Construction of recombinant plasmid pET30a-ompA

[0074] When the 1% agarose gel is identified as positive, the ompA fragment is recovered by cutting the gel. After the reaction sample is mixed with 5xLoading Buffer and identified by 1% agarose gel electrophoresis, the target band is cut off, and the target gene is recovered and purified according to the instructions of the DNA purification recovery kit. The pET30a is used as a carrier, and the pET30a(+) and the above-mentioned PCR amplification product are cut by BamH-Ⅰ and Not-Ⅰ enzymes and connected to construct the recombinant plasmid pET30a-ompA. The double enzyme cutting identification result shows that the recombinant plasmid is successfully constructed (see Figure 3 ).

[0075] 1.4 Expression and purification of LI OmpA recombinant antigen peptide

[0076] First, the E. coli containing the pET30a-ompA recombinant plasmid stored in the ultra-low temperature freezer is recovered. 100 μL of the bacteria is uniformly coated on a Kana-resistant plate and cultured at 37°C overnight. A single colony is picked up in 700 μL of LB liquid medium with Kana resistance and shaken at 37°C for 8-12 hours. 100 μL of the above-mentioned bacterial solution is inoculated in 10 ml of LB liquid medium with Kana resistance and shaken at 37°C for 8-12 hours to obtain the recovered recombinant expression bacteria. The recovered bacteria are inoculated in 1 L of LB liquid medium with Kana resistance and shaken at 37°C until the OD value is 0.6-0.8. The expression of OmpA recombinant protein is induced by 0.8 mmol / L of IPTG at 25°C for 16 hours. The purified LI-ompA recombinant antigen is obtained by His-tag affinity chromatography. After the recombinant protein is dialyzed and concentrated, the protein concentration is determined by the BCA method (routine method), and the 1.5 ml Ep tube is divided and stored at -80°C for standby. 450nm

[0077] Example 2 Preparation and ELISA of LI OmpA recombinant antigen peptide monoclonal antibody 5F2

[0078] 2.1 Cell lines and experimental animals

[0079] The myeloma cell SP2 / 0 is preserved in the laboratory of the Animal Science and Technology College and the College of Animal Medicine of the applicant; and the 6-8 week old female Balb / c mice are purchased from Henan Skbio Biological Technology Co., Ltd.

[0080] 2.2 Main reagents and experimental consumables

[0081] ​PMI Medium 1640 basic (lx) was purchased from Gibco company; Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), DMSO were purchased from Sigma company; FBS serum was purchased from Yeasen company; HRP labeled goat anti-mouse IgG antibody; horseradish peroxidase (HRP), other chemical reagents were commercially available common reagents. The reagents were prepared by the laboratory of the Animal Science and Technology College and the Laboratory of Animal Medicine College of the applicant, and the purity was analytical pure.

[0082] 2.3 Test method

[0083] 2.3.1 Mouse immunization: The immunogen was the prepared LIOmpA recombinant antigen peptide, and the immunization procedure was as follows: 200 μg of LIOmpA recombinant antigen peptide was emulsified with Freund's complete adjuvant at a ratio of 1:1, and then subcutaneously injected into Balb / C mice for multiple point immunization. The same dose of recombinant protein was emulsified with Freund's incomplete adjuvant at a ratio of 1:1 for the second and third immunization at 14 and 28 d. The serum antibody titer was detected 7 d after the third immunization. The mouse serum antibody titer reached 1:12800 by using the conventional indirect ELISA method, and the mouse with the highest antibody titer was selected for challenge immunization. The bone marrow tumor cells SP2 / 0 and the spleen cells of the immunized mice were fused 3 d after the challenge immunization, and the hybridoma cells were screened by using HAT complete culture medium.

[0084] 2.3.2 Establishment of positive hybridoma cell strain: 10-14 d after cell fusion, when the cloned cells of the fusion cells grew to cover 1 / 2 area of the bottom of the well, the positive clone well was screened by using the indirect ELISA method, and the positive hybridoma cell strain 5F2 was established by using the limited dilution method for four rounds of subcloning. The culture medium was changed to HT complete culture medium during subcloning.

[0085] 2.3.3 Identification of monoclonal antibody: the monoclonal positive hybridoma cells were cultured, and the hybridoma cell chromosome count, monoclonal antibody subclass identification, and monoclonal antibody reactivity analysis were performed. The chromosome number of the 5F2 hybridoma cell strain was 100-110, the antibody subclass was IgG2a / κ, and the 5F2 could bind to L. intracellularis by WB verification, and had good reactivity. After the identification of protein electrophoresis, the band was clear after the antibody purification, and the purity was >85%, indicating that the antibody had high purity (see Figure 4 ). The LIOmpA recombinant antigen peptide monoclonal antibody 5F2 was determined as the raw material of the detection method in the application.

[0086] 2.3.4 Labeling of monoclonal antibody 5F2: 5 mg of horseradish peroxidase (HRP) was weighed into 1 ml of double distilled water, 500 μl of freshly prepared NaIO4was added, and the solution was allowed to react at 2-8°C for 30 min. The solution was greenish grass, and 0.5 ml of ethylene glycol was added. After mixing, the solution was allowed to react at room temperature for 30 min in the dark. Then, 5 mg of purified 5F2 monoclonal antibody was added, and the solution was dialyzed in a carbonate buffer at pH 9.5 at 2-8°C for 15 h. The next day, 0.2 ml of freshly prepared NaBH4was added to the solution, and the solution was mixed and allowed to react at 2-8°C for 2 h. An equal volume of saturated ammonium sulfate solution was added, and the solution was allowed to stand at 2-8°C for 30 min. The solution was centrifuged at 7000 r / min for 10 min, the supernatant was discarded, and the residue was resuspended in PB. The solution was dialyzed in PB at 2-8°C for 1.5 h. The content of the dialysis bag was collected, and the concentration of the enzyme-labeled antibody was adjusted to 4 mg / ml. An equal volume of glycerol was added as an enzyme-labeled antibody stock solution, which was divided into 1 ml / tube, and stored at -70°C or below for later use.

[0087] Example 3 Preparation, assembly and use of a blocking ELISA kit for L. intracellularis antibodies

[0088] 3.1 Preparation and assembly of kit components

[0089] 3.1.1 Preparation of antigen-coated plates: The coating antigen was diluted with coating solution to a final concentration of 1 μg / ml, and 100 μl was added to each well of a 96-well enzyme-labeled plate, which was coated at 2-8°C for 15 h. The coating solution was discarded, 200 μl of blocking solution was added to each well, and the plate was blocked at 37°C for 2 h. The plate was then dried at 37°C for 2 h, sealed with a wrapping film, and stored at 2-8°C for later use.

[0090] 3.1.2 Preparation of enzyme-labeled antibody: The enzyme-labeled antibody stock solution was diluted 5000-fold with a protective agent, and filtered with a 0.22 μm filter to remove bacteria, to obtain the enzyme-labeled antibody.

[0091] 3.1.3 Preparation of positive control: 7-8-week-old healthy SPF pigs were selected, and the LI was detected by PCR to be negative. The pigs were immunized with a porcine ileitis live vaccine The vaccine was diluted, and each pig was orally immunized with 10 doses. The pigs were boosted once at an interval of 14 days, and blood was collected 14 days after the second immunization. The blood was collected aseptically, and centrifuged at 4000 r / min for 10 min after the blood was fully coagulated. The serum was separated, inactivated at 60°C for 30 min, and stored at -70°C or below after the addition of 0.01% sodium thiomersal. The positive control was diluted 60-fold with a protective agent, and detected to be positive by a commercial indirect ELISA detection kit. The solution was filtered with a 0.22 μm filter to obtain the positive control.

[0092] 3.1.4 Preparation of negative control: Blood was collected from 7-8 week old healthy SPF pigs by intravenous aseptic method. After the blood was fully coagulated, it was centrifuged at 4000 r / min for 10 min to separate serum. The serum was inactivated at 60°C for 30 min, and then 0.01% sodium thiomersalate was added. The mixture was stored at -70°C or below for later use. The negative control was prepared by diluting the protective agent 60 times, and then detecting it with a commercial indirect ELISA kit. The sample was filtered through a 0.22 μm filter, and then it was used as the negative control.

[0093] 3.1.5 Preparation of sample diluent: Sodium chloride (NaCl) 8.00 g, sodium phosphate dibasic (Na2HPO4-12H2O) 2.90 g, potassium phosphate monobasic (KH2PO4) 0.20 g, potassium chloride (KCl) 0.20 g, and sodium thiomersalate 0.20 g (all reagents were commercially available) were added to 1000 ml of water for injection to form a clear solution.

[0094] 3.1.6 Preparation of 20-fold concentrated washing solution: Tween-20 10.00 ml, sodium chloride (NaCl) 160.00 g, sodium phosphate dibasic (Na2HPO4-12H2O) 58.00 g, potassium phosphate monobasic (KH2PO4) 4.00 g, potassium chloride (KCl) 4.00 g, and sodium thiomersalate 4.00 g (all reagents were commercially available); and 1000 ml of water for injection was added to form a clear solution.

[0095] 3.1.7 Preparation of substrate color developing solution: The substrate color developing solution used in the kit was a commercially available reagent TMB color developing solution, which was a clear solution.

[0096] 3.1.8 Preparation of termination solution: 27.20 ml of concentrated sulfuric acid was added to 900 ml of water for injection to form a clear solution, and water for injection was added to 1000 ml.

[0097] 3.1.9 Assembly of the kit: The components of each kit were assembled according to the following table

[0098] (1) Antigen-coated plate 2 or 5 (96 wells / block)

[0099] (2) Enzyme-labeled antibody 1 bottle (10 ml / bottle or 25 ml / bottle);

[0100] (3) Positive control 1 tube (1 ml / tube or 2 ml / tube);

[0101] (4) Negative control 1 tube (1 ml / tube or 2 ml / tube);

[0102] (5) Sample diluent 1 bottle (50 mL or 100 mL);

[0103] (6) 20-fold concentrated washing solution 1 bottle (30 ml / bottle or 75 ml / bottle);

[0104] (7) Substrate color developing solution 1 bottle (20 ml / bottle or 50 ml / bottle);

[0105] (8) Stop solution 1 bottle (10 ml / bottle or 25 ml / bottle).

[0106] 3.2 Use of the kit and judgment

[0107] 3.2.1 Use of the kit

[0108] (1) Sample preparation: Take the whole blood of the animal, and after the blood is coagulated, centrifuge at 4000 r / min for 10 minutes to collect the serum; or after the blood is coagulated, the serum is naturally separated, and then the serum is collected. The serum should be clear and not hemolyzed.

[0109] (2) Preparation of washing solution: Before use, dilute the 20-fold concentrated washing solution 20 times with distilled water or pure water (for example: add 190 ml of pure water to 10 ml of concentrated washing solution), and mix well. Store at 2-8°C, which can be stored for 7 days.

[0110] (3) Dilution of the serum to be tested and controls: Dilute the serum to be tested 1:1 in the serum dilution plate (for example: add 100 μl of sample diluent to 100 μl of serum to be tested), and do not dilute the negative and positive controls.

[0111] (4) Take the antigen-coated plate (according to the amount of sample, it can be opened and used in batches): first wash the antigen-coated plate with 1x washing solution once, add 100 μl of diluted serum to be tested, negative control and positive control to the antigen-coated plate, respectively, set 1 hole for the serum to be tested, 2 holes for the negative and positive controls, gently shake the sample in the hole, and incubate at 37°C for 1 hour.

[0112] (5) Discard the liquid in the hole, add 200 μl of 1x washing solution to each hole, repeat the washing 5 times, and pat dry at the last time.

[0113] (6) Add 100 μl of enzyme-labeled reagent to each hole, and incubate at 37°C for 30 minutes. (6) Discard the liquid in the hole, wash 5 times, and pat dry at the last time.

[0114] (7) Add 100 μl of substrate color developing solution to each hole, and develop color at 20-25°C for 15 minutes.

[0115] (8) Add 50 μl of stop solution to each hole, and measure the results within 10 minutes (shake gently on the shaker before measurement).

[0116] 3.2.2 Determination: Measure the OD450nm value of each well using a microplate reader. The conditions for the experiment to be valid are: the average OD450nm value of the negative control > 1.0, and the inhibition rate of the positive control > 50%.

[0117] S = Sample well OD 450nm Value, N = negative control OD 450nm value.

[0118] PI value = (1 - S / N) × 100%.

[0119] If the inhibition rate of the tested sample is <30%, the sample is considered negative for Lawsonia intracellularis antibodies. If the inhibition rate of the tested sample is ≥30%, the sample is considered positive for Lawsonia intracellularis antibodies.

[0120] (Note: If the OD of the sample is...) 450nm Value > Negative control OD 450nm (The inhibition rate is considered to be 0.00%.)

[0121] Example 4: Performance Analysis of the Intracellular Lawsonia Antibody Blocking ELISA Kit

[0122] 4.1 Sensitivity Test

[0123] One kit from each of the three batches of the experimentally prepared blocking ELISA kits was randomly selected and tested with intracellular Lawsonia solani positive sensitivity control serum from 2... 0 Serial dilution to 2 4 Following the instructions and precautions of the kit, the OD450nm value of each serum dilution was measured and the blocking rate was calculated. The results showed that at a serum dilution of 2... 3 The blocking rates were 48.13%, 41.62%, and 46.43%, respectively, and were still considered positive (see Table 2). Therefore, this method can detect up to 8-fold dilutions.

[0124] Table 2 Sensitivity test of blocking ELISA

[0125]

[0126] 4.2 Specificity test

[0127] The OD450nm values of the corresponding blood were detected and the blocking rates were calculated by using the blocking ELISA kit. The blocking rates of the positive serum of the antibodies of the other pathogens were all less than 30% (see Table 3) except the positive serum of the antibodies of Lawsonia intracellularis.

[0128] Table 3 Specificity test of blocking ELISA

[0129]

[0130]

[0131] 4.3 Repetitive test

[0132] 4.3.1 Intra-batch repetitive test

[0133] Three kits from the same batch of the prepared kit were randomly selected, and 8 sera of clinical negative, weak positive and strong positive were detected respectively to calculate the blocking rate. The coefficient of variation CV was calculated according to the PI value, so as to know whether the intra-batch repeatability is good. The coefficient of variation of the blocking rate of the 3 times repetition of different sera in the intra-batch was less than 10%, indicating that the coefficient of variation in the intra-batch was good (see Table 4).

[0134] Table 4 Intra-batch repetitive test

[0135]

[0136] 4.3.2 Inter-batch repetitive test

[0137] One kit from each of the three batches of the prepared kit was randomly selected, and 8 sera of clinical negative, weak positive and strong positive were detected respectively to calculate the blocking rate. The coefficient of variation CV was calculated according to the PI value, so as to know whether the inter-batch repeatability is good. The coefficient of variation of the blocking rate of the 3 times repetition of different sera in the inter-batch was less than 15%, indicating that the coefficient of variation in the inter-batch was good (see Table 5).

[0138] Table 5 Inter-batch repetitive test

[0139]

[0140] 4.4 Coincidence rate of blocking ELISA and commercial ELISA detection

[0141] The 150 clinical serum samples were detected by using the commercialized indirect ELISA detection kit and the antibody blocking ELISA kit for L. intracellularis prepared in the application. The use and result determination of the antibody blocking ELISA kit for L. intracellularis prepared in the application refer to the use and matters needing attention of the kit in Example 3.2, and the coincidence rate is calculated by comparing the detection results of the commercialized indirect ELISA (see Table 6).

[0142] Table 6 Coincidence rate of sample detection by blocking ELISA and commercialized ELISA

[0143]

[0144] Example 5 Application of antibody blocking ELISA kit for L. intracellularis in evaluation of immune antibody level

[0145] Ten SPF pigs were randomly divided into two groups, five in each group, and normally raised for 3 days to adapt to the environment. The intestinal tissues detected positive in clinic were collected, the mucosa was scraped, the ileum and colon were mixed at a ratio of 1:1, the diluent was added and mixed thoroughly, and then stored at 4°C for standby. From the 4th day, the above solution was orally administered, the bacterial amount was 10 7 copies / ml, 30 ml per pig, twice a day. At the same time, the control group of pigs was orally administered with the same amount of normal saline. Before the challenge (0d) and 7d, 14d, 21d and 28d after the challenge, blood was collected from all test pigs to separate serum and detect antibody level. The results showed that all pigs were positive for serum antibody 21d and 28d after the challenge, and the antibody of the unchallenged control group was negative, indicating that the antibody blocking ELISA kit for L. intracellularis can be used for antibody potency evaluation after challenge of L. intracellularis (see Figure 5 ).

[0146] The above is only a specific embodiment of the application, but the protection scope of the application is not limited thereto. Any person skilled in the art can understand and think of changes or substitutions within the technical scope disclosed by the application, which should be covered within the scope of the application. Therefore, the protection scope of the application should be subject to the protection scope of the claims.

Claims

1. A blocking ELISA kit for detecting intracellular Lawsonia solani antibodies, characterized in that, The ELISA plate is coated with a recombinant LI-OmpA antigen peptide and an enzyme-labeled antibody. The amino acid sequence of the LI-OmpA recombinant antigen peptide is shown in SEQ ID NO:

1. The enzyme label is a monoclonal antibody against the LI-OmpA recombinant antigen peptide, produced by hybridoma cell line 5F2. The hybridoma cell line 5F2 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C2023263.

2. The reagent kit according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the LI-OmpA recombinant antigen peptide is shown in SEQ ID NO:

2.

3. The reagent kit according to claim 1, characterized in that, The coating concentration of the LI-OmpA recombinant antigen peptide was 1 μg / mL.

4. The reagent kit according to claim 1, characterized in that, The dilution ratio of the enzyme-labeled antibody was 1:5000.

5. The reagent kit according to claim 1, characterized in that, The test kit also includes a positive control, a negative control, a sample diluent, a 20-fold concentrated washing solution, a substrate chromogenic solution, and a stop solution.

6. A blocking ELISA method for detecting intracellular Lawsonia solani antibodies, characterized in that, The detection method is based on the blocking ELISA kit for detecting intracellular Lawsonia antibodies according to any one of claims 1-5.

7. The blocking ELISA method for detecting intracellular Lawsonia antibodies according to claim 6, characterized in that, The method includes the following steps: Coating: The purified LIOmpA protein was diluted to 1 μg / mL with 0.05 mol / L pH 9.6 carbonate buffer and coated with ELISA plates. 100 μL was added to each well and incubated overnight at 4°C. Washing: Shake off the liquid in the plate, add 300 μL of PBST per well and wash 5 times, then pat dry; Sealing: Add 200 μL of sealing solution to each well and seal at 37°C for 2 h; Washing: Shake off the liquid in the plate, add 300 μL of PBST per well and wash 5 times, then pat dry; Drying and sealing: Dry at 37℃ for 2 hours, seal the antigen-coated plate with packaging film, and store the antigen-coated plate at 2-8℃ for later use; Sample preparation: Dilution of serum to be tested and controls: Dilute the serum to be tested in a serum dilution plate at a volume ratio of 1:

1. Negative and positive controls are not diluted. Sample addition: Depending on the amount of sample, it can be used in batches or in multiple batches. The steps are as follows: Take the antigen-coated plate, first use 1× washing buffer, which is diluted from 20 times concentrated washing buffer; wash the antigen-coated plate once, add 100 μL each of the diluted serum to be tested, negative control and positive control to the antigen-coated plate, set 1 well for each serum to be tested, and set 2 wells for each negative and positive control, gently shake the samples in the wells, and incubate at 37°C for 1 hour; Washing: Discard the liquid in the well, add 1×200μL of washing solution to each well, repeat washing 5 times, and pat dry on the last wash; Antibody incubation: Add 100 μL of enzyme-labeled reagent to each well and incubate at 37°C for 30 minutes; Washing: Discard the liquid in the hole, wash 5 times, and pat dry on the last wash; Color development: Add 100 μL of substrate development solution to each well and incubate at 20-25℃ in the dark for 15 minutes. Termination: Add 50 μL of stop solution to each well and measure the results within 10 minutes; Reading: Measure the OD of each well on the microplate reader. 450nm value.

8. The blocking ELISA method for detecting intracellular Lawsonia antibodies according to claim 7, characterized in that, The experiment was established when the mean OD of the negative control was... 450nm If the value is >1.0, the inhibition rate of the positive control is >50%; if the inhibition rate of the tested sample is <30%, the sample is judged to be negative for Lawsonia intracellularis antibody; if the inhibition rate of the tested sample is ≥30%, the sample is judged to be positive for Lawsonia intracellularis antibody.

Citation Information

Patent Citations

  • Fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe group for detecting swine bacterial diarrhea pathogens

    CN117144029A

  • ELISA (enzyme-linked immunosorbent assay) detection kit and method for lawsonia intracellularis antibody

    CN118112239A