Use of glycyrrhizin flavone C and active phenolic acid or pharmaceutically acceptable salt thereof in preparation of medicine or inhibitor against segmented RNA virus

Abstract

This invention discloses the application of glycyrrhizin C and active phenolic acids or their pharmaceutically acceptable salts in the preparation of drugs or inhibitors against segmented RNA viruses, relating to the field of antiviral technology. Glycyrrhizin C and active phenolic acids exert broad-spectrum antiviral activity by targeting Cap-dependent endonucleases of segmented RNA viruses, making them well-defined broad-spectrum antiviral drug candidates. This invention provides a valuable reference for the development of antiviral drugs. Furthermore, this invention also conducted anti-segmented RNA virus experiments on analogs of glycyrrhizin C. The results showed that various glycyrrhizin C analogs exhibited cellular-level anti-segmented RNA virus activity and in vitro inhibition of segmented RNA virus endonuclease activity, enriching the types of broad-spectrum antiviral drugs proposed in this invention.

Description

Technical Field

[0001] This invention relates to the field of antiviral technology, and more specifically, to the use of glycyrrhizin C and active phenolic acids or their pharmaceutically acceptable salts in the preparation of drugs or inhibitors against segmented RNA viruses. Background Technology

[0002] Segmented negative-sense RNA viruses are mainly distributed in the families Orthomyxoviridae, Leukoviridae, Nairoviridae, and Arenaviridae. Representative viruses include influenza A virus (IAV), Severe fever with thrombocytopenia syndrome virus (SFTSV), and Lymphocytic choriomeningitis virus (LCMV). Segmented negative-sense RNA viruses rely on a unique "cap-snatching" mechanism during transcription. Taking Bunyavirus as an example, the cap-snatching process is carried out by the virus-encoded L protein. The L protein has an N-terminal endonuclease (EN) domain, an RNA-dependent RNA polymerase (RdRP) in the middle, and a C-terminal cap-binding domain (CBD). With the synergistic effect of the CBD, the EN cleaves the cap of the host mRNA. The oligonucleotides containing the 5' cap structure obtained from cleavage were used as primers for RdRP transcription, thus EN can serve as an important target for viral intervention. However, currently only one EN inhibitor targeting influenza virus, baloxavir, is on the market, and more antiviral drugs targeting EN urgently need to be discovered.

[0003] Traditional Chinese medicine (TCM), as a traditional medicine of my country, possesses a wealth of pharmacologically active ingredients and exhibits significant preventive and therapeutic effects against viral infections. In the treatment of COVID-19, antiviral TCM preparations have played a crucial role. These TCM preparations, due to their novelty, multi-component nature, and multi-target characteristics, have become a valuable source for new drug development. While some progress has been made in recent years in the study of the antiviral mechanisms of TCM, many questions remain to be explored in depth. Therefore, the screening of effective antiviral components of TCM and the evaluation of their pharmacological efficacy are important directions for future research.

[0004] Flavonoids, also known as flavonoid bodies, are widely distributed in various plant tissues and are an important class of plant secondary metabolites that help plants resist invasion by bacteria, fungi, and other pathogens. The basic skeleton of flavonoids is C6-C3-C6, with the parent nucleus consisting of two benzene rings linked by a heterocyclic pyran ring. Different flavonoids have shown significant antiviral properties in in vitro and in vivo studies. For example, baicalin and baicalein can inhibit viral replication by suppressing the activity of 3CLpro, an important protease in the novel coronavirus.

[0005] Phenolic acids are aromatic carboxylic acid compounds with multiple phenolic hydroxyl groups substituted on a benzene ring. They are widely found in various plants, especially some common traditional Chinese medicines such as Danshen, honeysuckle, and forsythia. Currently, phenolic acids have significant effects in anti-inflammation, anti-oxidation, anti-tumor, and antibacterial / fungal activity, but there are few reports on their clinical use in antiviral applications, and their mechanisms of action are poorly understood. Therefore, the development of these substances has broad prospects.

[0006] In view of the above, based on the structural diversity and pharmacological activity of monomeric compounds in traditional Chinese medicine, the discovery and development of drugs against segmented negative-sense RNA viruses is of great value. Therefore, this invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to provide the use of glycyrrhizin C and active phenolic acids or their pharmaceutically acceptable salts in the preparation of medicaments or inhibitors against segmented RNA viruses.

[0008] This invention is implemented as follows:

[0009] In a first aspect, the present invention provides the use of glycyrrhizin C or a pharmaceutically acceptable salt thereof in the preparation of medicaments against segmented RNA viruses or Cap-dependent endonuclease inhibitors.

[0010] Secondly, this invention provides the use of an active phenolic acid or a pharmaceutically acceptable salt thereof in the preparation of a medicament against segmented RNA viruses or a Cap-dependent endonuclease inhibitor, wherein the active phenolic acid is selected from at least one of salvianolic acid A, salvianolic acid B, and salvianolic acid C, and the segmented RNA virus is selected from the order Bunyavirales (…). Bunyavirales The virus in ).

[0011] Thirdly, the present invention provides the use of flavonoids or pharmaceutically acceptable salts thereof in the preparation of drugs against segmented RNA viruses or Cap-dependent endonuclease inhibitors, wherein the flavonoids are selected from at least one of glycyrrhizin A, glycyrrhizin isoflavone A, glycyrrhizin B, glycyrrhizin alcohol, glycyrrhizin alcohol, northwestern glycyrrhizin isoflavone, luteolin, morin, matrine A, dehydrated icariin, isodehydroicariin, isopsoralen dihydroflavonoid, isoflavone alcohol, and mulberry flavonol F.

[0012] The present invention has the following beneficial effects:

[0013] This invention screened natural monomeric compounds with broad-spectrum resistance to segmented RNA viruses. Among them, glycyrrhizin C is derived from the traditional Chinese medicine licorice, and salvianolic acid A, B, and C are derived from the traditional Chinese medicine tanshinone, both possessing multiple pharmacological activities. Experiments have demonstrated that these two types of compounds exert broad-spectrum antiviral effects by targeting the Cap-dependent endonucleases of segmented RNA viruses, making them well-targeted broad-spectrum antiviral candidate drugs. This invention provides a valuable reference for the development of antiviral drugs.

[0014] In addition, the present invention also conducted anti-segmented RNA virus experiments on analogs of glycyrrhizin C (flavonoids). The results showed that various analogs of glycyrrhizin C (flavonoids) had anti-segmented RNA virus activity at the cellular level and the effect of inhibiting segmented RNA virus endonuclease activity in vitro. The present invention enriches the types of broad-spectrum antiviral drugs. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 The figure shows the results of detecting the inhibitory effects of glycyrrhizin C and salvianolic acid A, B, and C on the enzyme activity of segmented negative-strand RNA viruses SFTSV, HRTV, GTV, LCMV, and IAV endonuclease EN.

[0017] Figure 2 The graph shows the results of detecting the antiviral activities of glycyrrhizin C and salvianolic acid A, B, and C against SFTSV, HRTV, GTV, LCMV, and IAV.

[0018] Figure 3 Figure 1 shows the results of antiviral activity detection of glycyrrhizin C and salvianolic acid A, B, and C in a mouse model.

[0019] Figure 4 Figure 1 shows the results of anti-SFTSV experiments of 16 flavonoid natural extracts at the in vitro and cellular levels. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0021] In a first aspect, the present invention provides the use of glycyrrhizin C or a pharmaceutically acceptable salt thereof in the preparation of medicaments against segmented RNA viruses or Cap-dependent endonuclease inhibitors.

[0022] Anti-segmented RNA virus (ARV) effects include, but are not limited to: inhibiting the viral load of segmented RNA viruses in the host, reducing viral copy number, inhibiting the expression level of viral genomic RNA, and inhibiting the activity of viral endonucleases.

[0023] The viral copy number refers to the copy number of the RNA fragment encoding hemagglutinin (HA), the copy number of the RNA fragment encoding neuraminidase (NA), etc.

[0024] The inventors demonstrated through in vivo and in vitro experiments that glycyrrhizin C possesses significant anti-segmented RNA virus activity, inhibiting the activity of cap-dependent endonucleases of segmented RNA viruses. Viral RNA-dependent RNA polymerases consist of three subunits: PB1, PB2, and PA, which are highly conserved in influenza A, B, and C viruses and are responsible for viral genome replication and transcription. PB2 captures host cell mRNA through a "cap-snatching" mechanism, while the N-terminal domain of the PA subunit cleaves this mRNA, exerting endonuclease activity to produce capped oligonucleotides for viral mRNA generation and transcription. Therefore, PA plays a crucial role in influenza virus replication; inhibiting PA activity effectively suppresses influenza virus replication, thereby controlling influenza virus transmission. This invention inhibits influenza virus replication by suppressing the activity of cap-dependent endonucleases in segmented RNA viruses, thus achieving viral inhibition. Therefore, cap-dependent endonuclease inhibitors have good potential for treating segmented RNA viruses, including influenza.

[0025] Licorice flavonoid C or a pharmaceutically acceptable salt thereof shows promising potential for the prevention and / or treatment of diseases caused by viruses with Cap-dependent endonucleases, in an alternative embodiment of which the disease is a related illness or symptom caused by an influenza virus, etc.

[0026] In a preferred embodiment of the present invention, the segmented RNA virus is selected from the order Bunyavirales (…). Bunyavirales) and Orthomyxoviridae ( Orthomyxoviridae At least one of the viruses in ).

[0027] Segmented RNA viruses are segmented negative-strand RNA viruses.

[0028] In a preferred embodiment of the present invention, the segmented RNA virus is selected from the Leukoviridae family within the Bunyavirales order (…). Phenuiviridae ), Nairoviridae ( Nairoviridae ) and Arenaviridae ( Arenaviridae At least one of the viruses in ).

[0029] Segmented RNA viruses are selected from the Severe Fever and Thrombocytopenia Syndrome Virus (SFTS) of the Leukoviridae family. Severe fever with thrombocytopenia syndrome virus SFTSV), inland virus ( Heartland virus , HRTV) and Gurtu virus ( Guertu virus At least one virus from the genera Geckoviruses, Pasiviruses, Termitesviruses, and Fibrinoviruses. Viruses in the family Fibrinoviridae include, but are not limited to, the genera Geckoviruses, Pasiviruses, Termitesviruses, and Fibrinoviruses.

[0030] In a preferred embodiment of the present invention, the segmented RNA virus is selected from Pineridge Virus (Pineridge Virus) of the Nairoviridae family. Songling virus, SGLV), Crimean-Congo hemorrhagic fever virus ( Crimean Congo hemorrhagic fever virus At least one virus among (CCHFV);

[0031] In a preferred embodiment of the present invention, the segmented RNA virus is selected from lymphocytic choroid plexus meningitis virus (LCMV) and matechus virus (MCV) under the Arenaviridae family. Machupo virus MACV and Lassa virus ( Lassa virus At least one of the following viruses;

[0032] In a preferred embodiment of the present invention, the segmented RNA virus is selected from at least one virus from the genera of influenza A virus, influenza B virus, influenza C virus, and Togovirus within the family Orthomyxoviridae.

[0033] In a preferred embodiment of the present invention, the application includes: glycyrrhizin C inhibits viral activity by targeting the Cap-dependent endonuclease of segmented RNA viruses.

[0034] Secondly, this invention provides the use of an active phenolic acid or a pharmaceutically acceptable salt thereof in the preparation of a medicament against segmented RNA viruses or a Cap-dependent endonuclease inhibitor, wherein the active phenolic acid is selected from at least one of salvianolic acid A, salvianolic acid B, and salvianolic acid C, and the segmented RNA virus is selected from the order Bunyavirales (…). Bunyavirales The virus in ).

[0035] In vivo and in vitro experiments have confirmed that active phenolic acids have good inhibitory activity against segmented RNA viruses.

[0036] In a preferred embodiment of the present invention, the segmented RNA virus is selected from the Leukoviridae family within the Bunyavirales order (…). Phenuiviridae ), Nairoviridae ( Nairoviridae ) and Arenaviridae ( Arenaviridae At least one of the viruses in ).

[0037] In a preferred embodiment of the present invention, the segmented RNA virus is selected from the fever with thrombocytopenia syndrome virus (FSTS) of the Leukoviridae family (Leukoviridae). Severe fever with thrombocytopenia syndrome virus SFTSV), inland virus ( Heartland virus , HRTV) and Gurtu virus ( Guertu virus At least one virus in GTV.

[0038] In a preferred embodiment of the present invention, the segmented RNA virus is selected from Pineridge Virus (Pineridge Virus) of the Nairoviridae family. Songling virus, SGLV), Crimean-Congo hemorrhagic fever virus ( Crimean Congo hemorrhagic fever virus At least one of the viruses (CCHFV).

[0039] In a preferred embodiment of the present invention, the segmented RNA virus is selected from lymphocytic choroid plexus meningitis virus (LCMV) and matechus virus (MCV) under the Arenaviridae family. Machupo virus MACV and Lassa virus ( Lassa virus At least one of the viruses in ).

[0040] In a preferred embodiment of the present invention, the application includes: active phenolic acid inhibits viral activity by targeting the Cap-dependent endonuclease of segmented RNA viruses.

[0041] Thirdly, the present invention provides the use of flavonoids or pharmaceutically acceptable salts thereof in the preparation of drugs against segmented RNA viruses or Cap-dependent endonuclease inhibitors, wherein the flavonoids are selected from at least one of glycyrrhizin A, glycyrrhizin isoflavone A, glycyrrhizin B, glycyrrhizin alcohol, glycyrrhizin alcohol, northwestern glycyrrhizin isoflavone, luteolin, morin, matrine A, dehydrated icariin, isodehydroicariin, isopsoralen dihydroflavonoid, isoflavone alcohol, and mulberry flavonol F.

[0042] Through screening and verification, the inventors discovered that the above-mentioned flavonoids have good anti-segmented RNA virus effects at both in vitro and cellular levels.

[0043] In a preferred embodiment of the present invention, the segmented RNA virus is selected from the Leukoviridae family within the Bunyavirales order (…). Phenuiviridae ), Nairoviridae ( Nairoviridae ) and Arenaviridae ( Arenaviridae At least one of the viruses in ).

[0044] Segmented RNA viruses are selected from the Severe Fever and Thrombocytopenia Syndrome Virus (SFTS) of the Leukoviridae family. Severe fever with thrombocytopenia syndrome virus SFTSV), inland virus ( , HRTV) and Gurtu virus ( Heartland virus At least one virus from the genera Geckoviruses, Pasiviruses, Termitesviruses, and Fibrinoviruses. Viruses in the family Fibrinoviridae include, but are not limited to, the genera Geckoviruses, Pasiviruses, Termitesviruses, and Fibrinoviruses.

[0045] In a preferred embodiment of the present invention, the segmented RNA virus is selected from Pineridge Virus (Pineridge Virus) of the Nairoviridae family. Guertu virus SGLV), Crimean-Congo hemorrhagic fever virus ( Songling virus, Crimean Congo hemorrhagic fever At least one virus among (CCHFV);

[0046] In a preferred embodiment of the present invention, the segmented RNA virus is selected from lymphocytic choroid plexus meningitis virus (LCMV) and matechus virus (MCV) under the Arenaviridae family. virus MACV and Lassa virus ( Machupo virus At least one of the following viruses;

[0047] In a preferred embodiment of the present invention, the segmented RNA virus is selected from at least one virus belonging to the genera *Influenza A*, *Influenza B*, *Influenza C*, and *Togovirus* within the family Orthomyxoviridae. In a preferred embodiment of the present invention, the application includes: flavonoids inhibiting viral activity by targeting the Cap-dependent endonuclease of the segmented RNA virus.

[0048] In a preferred embodiment of the present invention, the drug also includes pharmaceutically acceptable excipients.

[0049] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0050] Example 1

[0051] This embodiment describes an experiment to detect the inhibitory effect of the target compound on the enzyme activity of the segmented negative-strand RNA viruses SFTSV, HRTV, GTV, LCMV, and IAV endonuclease EN.

[0052] The experimental steps are as follows:

[0053] 1. The RNA single-stranded substrate used in the experiment is SEQ ID NO:1: 5'-FAM-AGGAAGAUUAAUAAUUUUCCU-BHQ1-3', which is suitable for the detection of SFTSV, HRTV, GTV, LCMV and IAV endonuclease activities.

[0054] 2. Configuration containing Mn 2+ The reaction buffer consisted of 50 mM HEPES pH 7.8, 150 mM KCl, and 1 mM MnCl2.

[0055] 3. Preparation of experimental reaction system: Dilute the drug to 10 mM (10×) using DMSO, and then perform three-fold serial dilutions of the drug using DMSO, resulting in 6 or 7 concentrations. Dilute the endonuclease protein to 1.25 μM (1.25×) using reaction buffer. The total reaction volume is 25 μl. Add 2.5 μl of the corresponding drug stock solution to each reaction. Add 2.5 μl of DMSO to the negative control group, then add 20 μl of protein dilution solution. Mix well in the ELISA plate and incubate at 37°C for 30 min.

[0056] 4. Turn on the ELISA reader (BioTek SYNERGY H1 microplate reader) in advance, set λex / λem = 485 nm / 535 nm, and preheat at 37℃;

[0057] 5. Reaction: Dilute the RNA single-stranded substrate to 1 μM with reaction buffer, add 2.5 μl to each reaction system to make the RNA concentration 100 nM. After mixing, place the mixture in a microplate reader and check the fluorescence intensity every minute.

[0058] 6. The reaction rate at the first five minutes of the reaction (reaction rate is the change in fluorescence per unit time, reaction rate = change in fluorescence / reaction time) represents the endonuclease activity. Using the endonuclease reaction rate in the DMSO wells as a reference, the inhibition rate of the drug-treated group is calculated as (1 - drug-treated group reaction rate / DMSO-treated group reaction rate) × 100%. Based on the inhibition rates of different drug concentrations, Prism 8.0 software is used to fit the drug-enzyme activity inhibition curves, and the half-maximal inhibitory concentration (IC50) of each drug on the endonuclease is calculated. The fitted curves and the IC50 values ​​for each drug are then obtained. 50 Reference Lassa virus .

[0059] The results showed that glycyrrhizin C significantly inhibited the activities of SFTSV, HRTV, GTV, LCMV, and IAV endonuclease EN. Tanshinone A, B, and C also significantly inhibited the activities of segmented negative-strand RNA virus SFTSV, HRTV, GTV, and LCMV endonuclease EN.

[0060] Example 2

[0061] This embodiment presents an experiment to detect the antiviral activity of the target compound against SFTSV, HRTV, and GTV.

[0062] Vero cells in logarithmic growth phase were divided into groups of 4 × 10⁻⁶. 4 Cells were seeded in 48-well cell culture plates and cultured at 37°C in a 5% CO2 incubator for 14–18 h. The initial drug concentration was 150 μM, and the drug was serially diluted three-fold with DMEM containing 2% fetal bovine serum (FBS) in six or seven concentration gradients. A control group was set up using dimethyl sulfoxide (0.1% DMSO, diluted with DMEM containing 2% FBS). After removing the cell supernatant, 200 μl of the drug solution was added to the cells and incubated at 37°C for 1 h. 10 μl of virus dilution (MOI = 0.1) was added to each well, and the cells were infected at 37°C for 1 h. After thoroughly removing the infection material, the cells were washed once with 200 μl of PBS. 200 μl of the corresponding concentration of drug medium or DMSO medium was added to the wells, and the cells were cultured for another 36 h. 150 μl of cell culture supernatant was collected. Viral copy number was determined by qRT-PCR. All nucleic acids were extracted using the DNA / RNA Extraction Kit (Prepackaged, Novizan), and copy number was detected using the HiScript II One StepqRT-PCR SYBR Green Kit (Novozymes).

[0063] Copy number detection was performed using a standard curve method: For SFTSV, a known copy number of SFTSV NP plasmid was used as a standard, with specific primers targeting the NP region (SEQ ID NO:2(SFTSV-NP-F): TGCCTTCACCAAGACTATCAATGT; SEQ ID NO:3(SFTSV-NP-R): GGGTCCCTGAAGGAGTTGTAAA); For GTV, a known copy number of NP plasmid was used as a standard, with specific primers targeting the conserved NP region (SEQ ID NO:4(GTV-NP-F): TTGCCCTCACTCGAGGAAAC; SEQ ID NO:5(GTV-NP-R): TGAGGCTCATAACAGCTGGC); For HRTV, a known copy number of NP plasmid was used as a standard, with specific primers targeting the conserved NP region (SEQ ID NO:6(HRTV-NP-F): GTTGAGATTGGCAACGAGCC; SEQ ID NO:7(HRTV-R): GGATCCAGGCCCTCATAAGC). The copy number of each sample was calculated based on the standard curve. Using the DMSO group copy number as a reference, the inhibition rate of the drug-treated group was calculated as ((1 - viral copy number of the drug-treated group / viral copy number of the DMSO group) × 100%). Based on the inhibition rates of different drug concentrations, Prism 8.0 software was used to fit drug inhibition rate curves, and the half-maximal inhibitory concentrations (IC50) of glycyrrhizin C and salvianolic acid A, B, and C against SFTSV, GTV, and HRTV were calculated. The results are as follows: Figure 1 As shown in the ad, the results indicate that glycyrrhizin C and salvianolic acid A, B, and C can significantly inhibit the replication and amplification of SFTSV, GTV, and HRTV.

[0064] Example 3

[0065] This embodiment provides an experimental study to detect the antiviral activity of the target compound glycyrrhizin C and salvianolic acid A, B, and C against LCMV.

[0066] The activity assay for anti-LCMV virus was performed as described in Example 1, with A549 cells used and an MOI of 0.01. The initial concentration of the anti-LCMV drug was 150 μM, with three-fold serial dilutions and a total of seven drug gradients. A control group was set up using dimethyl sulfoxide (DMSO, diluted 0.1% with DMEM containing 2% fetal bovine serum). Supernatant was collected 48 h after viral infection for subsequent assays. A plasmid with a known copy number of the L fragment was used as a standard for LCMV. Specific primers targeted the conserved L region (SEQ ID NO:8 (LCMV-LF): GTAGTGGTCATGGCATCTTACC; SEQ ID NO:9 (LCMV-LR): GAGAGGAGAAAGGCACCAATAG). The administration method, assay method, and inhibition rate calculation method remained consistent with Example 2. Results were as follows. Figure 2 As shown in the ad, the results indicate that glycyrrhizin C and salvianolic acid A, B, and C have significant anti-LCMV virus activity.

[0067] Example 4

[0068] This embodiment provides an experimental test to detect the antiviral activity of the target compound glycyrrhizin C against IAV.

[0069] The activity assay for IAV virus was performed as described in Example 1, with MDCK cells used instead of IAV cells. The MOI was 0.01, and IAV cell maintenance culture medium was used as the diluent. Supernatant was collected 48 h after virus infection for subsequent assays. IAV used a plasmid containing the HA fragment of known copy number as a standard, and specific primers targeting HA were used (SEQ ID NO:10(IAV-HA-F): GGGTCCCTGAAGGAGTTGTAAA; SEQ ID NO:11(IAV-HA-R): GAAGCAGTGGGTCGCATTCT). The drug dilution factor, administration method, assay method, and inhibition rate calculation method were consistent with those for SFTSV in Example 2. Results are as follows: Figure 2 As shown in Figure a. The results showed that glycyrrhizin C had significant anti-IAV activity.

[0070] Example 5

[0071] This embodiment provides an experiment to detect the antiviral activity of the target compounds glycyrrhizin C and salvianolic acid A in a mouse model.

[0072] The in vivo antiviral activity (SFTSV) of glycyrrhizin flavonoid C was tested using 8-week-old female C57BL / 6 mice. Four mice were assigned to each group: a solvent control group, a positive control group (T-705 group (favipiravir group), 150 mg / kg / dose), and three drug groups (5 mg / kg / dose, 10 mg / kg / dose, and 20 mg / kg / dose). Mice were infected with 1E4 PFU of SFTSV virus via intraperitoneal injection. Half an hour after challenge, mice received 100 μl of the drug via tail vein injection. The solvent control group received the same volume of solvent (5% DMSO + 15% Solutol HS 15 + 80% saline) via tail vein injection, while the positive control group received 100 μl of the drug via gavage (solvent: 0.5% sodium carboxymethyl cellulose, autoclaved). The same administration was repeated every 12 hours, and body weight changes were observed. Forty-eight hours after challenge, mice were euthanized, blood was collected, and the spleen, liver, and kidneys were dissected and removed. RNA was extracted from each tissue by grinding and lysis, and the expression level of viral genomic RNA was detected by qRT-PCR.

[0073] The in vivo antiviral (LCMV) assay of salvianolic acid A was performed using 8-week-old female Balb / c mice. Four mice were assigned to each group: a solvent control group, a positive control group (T-705 group, 300 mg / kg / dose), and two drug groups (20 mg / kg / dose and 40 mg / kg / dose). Mice were infected with 1E5 PFU of LCMV virus via intraperitoneal injection. Half an hour after challenge, mice received 100 μl of the drug via tail vein injection. The solvent control group received the same volume of solvent (5% DMSO + 95% saline) via tail vein injection, while the positive control group received 100 μl of the drug via gavage (solvent: 0.5% sodium carboxymethyl cellulose, autoclaved). The drugs were administered in the same manner every 24 hours, and changes in body weight were observed. Seventy-two hours after challenge, mice were euthanized and dissected, and the spleen and liver were removed. RNA was extracted from each tissue by grinding and lysis, and the expression level of viral genomic RNA was detected by qRT-PCR.

[0074] All mouse experiments were conducted in an animal biosafety level 2 (ABSL-2) environment, and all procedures and ethical guidelines involving animals in the experiments were reviewed and approved by the institution's Animal Welfare and Ethics Committee.

[0075] Figure 2 Figure a in the diagram is an overview of the experimental procedure for drug administration and injection of SFTSV. Figure 3 Figure b in the figure shows the changes in mouse body weight after challenge with the drug. Figure 3 Figure c in the figure shows the expression levels of viral genomic RNA in mouse spleen, kidney, liver, and whole blood under different treatment methods.Figure 3 Figure d in the diagram is an overview of the experimental procedure for drug administration and injection of LCMV. Figure 3 Figure e in the figure shows the changes in mouse body weight after challenge and administration of the drug. Figure 3 Figure f in the figure shows the expression levels of viral genomic RNA in mouse spleen and liver under different treatment methods.

[0076] The results showed that glycyrrhizin C and salvianolic acid A had good antiviral activity in mouse models.

[0077] Example 6

[0078] The effects of 16 flavonoid natural extracts on their anti-SFTSV endonuclease activity at the in vitro level and anti-SFTSV virus activity at the cellular level were tested using the same experimental methods as in Examples 1 and 2.

[0079] Results reference Figure 3 Figure 4 As shown, the results indicate that glycyrrhizin C analogues such as glycyrrhizin A, glycyrrhizin isoflavone A, glycyrrhizin B, glycyrrhizin alcohol, glycyrrhizin alcohol, northwestern glycyrrhizin isoflavone, luteolin, morin, matrine alcohol A, dehydrated epimedium, isodehydroepiandrosterone, isopsoralen dihydroflavonoid, isoflavol, and mulberry flavonol F exhibit anti-SFTSV activity at the cellular level and inhibition of SFTSV endonuclease activity in vitro.

[0080] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The use of glycyrrhizin C or a pharmaceutically acceptable salt thereof in the preparation of a medicament against segmented RNA viruses, characterized in that, The segmented RNA virus is selected from at least one of the following viruses: fever with thrombocytopenia syndrome virus, terrestrial virus, Gurtu virus, lymphocytic choriomeningitis virus, and influenza A virus.

2. The application according to claim 1, characterized in that, The application includes: the licorice flavonoid C inhibits viral activity by targeting the Cap-dependent endonuclease of segmented RNA viruses.

3. The application according to any one of claims 1-2, characterized in that, The drug also includes pharmaceutically acceptable excipients.

Images