High-temperature-resistant alkaline alpha-galactosidase mutant and preparation method thereof
By site-directed mutagenesis of α-galactosidase in Bacillus aeruginosa, a high-temperature and high-alkalinity α-galactosidase mutant was prepared, solving the problem of enzyme activity reduction under high-temperature and high-alkalinity conditions, improving the enzyme's catalytic ability and application range, and meeting the needs of the food, pharmaceutical and biofuel fields.
Patent Information
- Application Number
- CN202411443601.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-16
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-10-16
AI Technical Summary
Existing α-galactosidases exhibit reduced enzyme activity under high temperature and high alkalinity conditions, limiting their potential applications in food, pharmaceutical, and biofuel production.
A high-temperature and high-alkali resistant α-galactosidase mutant was prepared by site-directed mutagenesis of α-galactosidase derived from Bacillus aeruginosa, specifically by replacing amino acids at positions 444, 457, and 509 of the amino acid sequence with phenylalanine, methionine, and tryptophan.
After being treated at 95°C for 2 hours in a pH 11 buffer solution, the mutant exhibited a 635% increase in enzyme catalytic activity, expanding its application range under wider pH and higher temperature conditions. This improved the raw material utilization rate and product quality in the lactose processing industry, while reducing production costs.
Smart Images

Figure CN119060990B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of enzyme engineering and genetic engineering, in particular to a high-temperature-resistant alkaline alpha-galactosidase mutant and a preparation method thereof. BACKGROUND
[0002] Alpha-galactosidase, also known as melibiose hydrolase (1,6-alpha-d-galactoside galactohydrolase; EC 3.2.1.22), is an exoglycosidase that hydrolyzes alpha-galactoside bonds. It can specifically catalyze the hydrolysis of alpha-1,6 galactoside bonds at the end of sugar chains in polysaccharides, glycolipids, and glycoproteins. It can not only hydrolyze oligosaccharides such as raffinose and stachyose, but also hydrolyze heteropolysaccharides containing alpha-galactoside, thereby playing an important role in carbohydrate metabolism and helping to break down complex polysaccharides into absorbable monosaccharides. Its unique three-dimensional structure contains specific catalytic active sites, enabling it to efficiently recognize and catalyze substrates. Alpha-galactosidase has a very wide range of applications, especially in the food industry, where it can effectively break down legumes and other foods rich in galactosides, helping to reduce indigestion and bloating. In the field of biological medicine, alpha-galactosidase is used to treat genetic diseases such as galactosemia. For this disease, alternative therapies based on alpha-galactosidase have been developed to help patients better metabolize galactose. In addition, the enzyme plays a key role in the production of biofuels by converting complex sugars in plant materials into fermentable sugars, thereby increasing the yield of biofuels.
[0003] Currently, the commercialization of alpha-galactosidase has formed a complete industrial chain, including microbial fermentation, enzyme preparation production, market promotion and application, covering various applications in the fields of food additives, pharmaceutical products and biotechnology. These commercial products not only promote the development of related industries, but also provide consumers with more health options. With further research on its functions and applications, the market potential of alpha-galactosidase will be even greater in the future.
[0004] Alpha-galactosidase is widely present in various microorganisms, and its main sources include bacteria (Bacillus pasteurii and Escherichia coli), fungi (Aspergillus) and yeast. The high-temperature and alkali-resistant properties of alpha-galactosidase vary among different sources of microorganisms. Alpha-galactosidase derived from thermophilic bacteria generally exhibits good activity at 50°C to 75°C, and some enzymes can maintain optimal activity in neutral to weakly alkaline environments at pH 6 to 8, but the enzyme activity decreases at pH 9 or higher. SUMMARY
[0005] The first object of the present application is to provide a mutant of alpha-galactosidase which is resistant to high temperature and high alkalinity; and the second object of the present application is to provide a preparation method of the mutant of alpha-galactosidase.
[0006] The mutant of the present application is obtained by performing site-directed mutagenesis on alpha-galactosidase derived from Anoxybacillus vitaminiphilus, and substituting at least one amino acid in the three positions of 444th, 457th and 509th in the amino acid sequence shown in SEQ ID No. 1; the 444th asparagine Asn is substituted by phenylalanine Phe, the 457th aspartic acid Asp is substituted by methionine Met, and the 509th arginine Arg is substituted by tryptophan Trp.
[0007] Preferably, the mutant includes N444F, D457M, R509W, D457M / R509W or N444F / D457M / R509W.
[0008] The wild-type alpha-galactosidase is derived from Anoxybacillus vitaminiphilus WMF1, and the amino acid sequence is SEQ ID No. 1, and the gene sequence is SEQ ID No. 2.
[0009] The mutant N444F is that the 444th asparagine Asn is substituted by phenylalanine Phe.
[0010] The mutant D457M is that the 457th aspartic acid Asp is substituted by methionine Met.
[0011] The mutant R509W is that the 509th arginine Arg is substituted by tryptophan Trp.
[0012] The mutant D457M / R509W is that the 457th aspartic acid Asp is substituted by methionine Met, and the 509th arginine Arg is substituted by tryptophan Trp.
[0013] The mutant N444F / D457M / R509W is that the 444th asparagine Asn is substituted by phenylalanine Phe, the 457th aspartic acid Asp is substituted by methionine Met, and the 509th arginine Arg is substituted by tryptophan Trp.
[0014] The nucleotide sequence of the present application is a gene sequence for encoding the mutant alpha-galactosidase protein.
[0015] The vector of the present application comprises the nucleotide sequence as described above. The vector can amplify or express the nucleotide sequence.
[0016] The vector comprises a cloning vector or an expression vector. The vector can be a plasmid or a virus, etc.
[0017] The recombinant bacteria of the present application comprises the nucleotide sequence as described above or the vector as described above.
[0018] Preferably, the host bacteria is E. coli DH5a.
[0019] The method for preparing the alpha-galactosidase mutant of the present application comprises the following steps:
[0020] (1) using the alpha-galactosidase gene as a template, and using the point mutation primer to perform PCR reaction to obtain the alpha-galactosidase mutant gene;
[0021] (2) inserting the alpha-galactosidase mutant gene into an expression vector, and then transferring it into a host cell to obtain a recombinant cell;
[0022] (3) collecting the recombinant cell expressing the alpha-galactosidase mutant, resuspending the bacterial body, breaking the cells, centrifuging to obtain the supernatant, and then obtaining the crude enzyme solution containing the alpha-galactosidase mutant.
[0023] Preferably, the 3D model of the original alpha-galactosidase is predicted by computer modeling, and the primer of the related mutation site is designed. The point mutation primer is as shown in Table 1.
[0024] Table 1 Point mutation primer
[0025]
[0026]
[0027] The underlined part in the primer is the mutation site.
[0028] The system of the PCR reaction is as shown in Table 2:
[0029] Table 2 PCR reaction system
[0030]
[0031] The conditions of the PCR reaction are as shown in Table 3:
[0032] Table 3 PCR reaction conditions
[0033]
[0034] Preferably, in step (2), the DNA homologous recombination method is used to insert the alpha-galactosidase mutant gene into the expression vector.
[0035] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: (1) by site-directed mutagenesis of the α-galactosidase derived from Anoxybacillus vitaminiphilus WMF1, the α-galactosidase mutant obtained has good thermal stability and alkali stability, and the ability of the enzyme mutant to catalyze the hydrolysis of α-galactosidic bond is significantly improved in a buffer solution at pH 11 and at a high temperature of 95℃ for 2h, and the specific enzyme activity of the enzyme mutant is increased by 635% compared with the original enzyme; (2) the α-galactosidase mutant increases the availability of α-galactosidase under wider pH and higher temperature conditions, has remarkable effects on improving the raw material utilization rate and product quality in the lactose processing industry, reducing production cost, meeting the demand for acid-resistant α-galactosidase in the fields of energy, food and feed, and has important social and economic benefits, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 is a schematic diagram of the protein structure of the original α-galactosidase and the 444th, 457th and 509th amino acid sites;
[0037] Figure 2 is a standard curve for determining enzyme activity by colorimetry;
[0038] Figure 3 is a schematic diagram of the specific enzyme activity of the original α-galactosidase under different pH conditions;
[0039] Figure 4 is a schematic diagram of the relative enzyme activity of the original enzyme and the enzyme mutant under different temperature conditions. DETAILED DESCRIPTION
[0040] The technical solutions of the present application are further described below in combination with examples.
[0041] The materials used in the examples were obtained as follows:
[0042] 1. Strains and plasmids
[0043] The synthesis of the pET-22b(+) plasmid with the original Anoxybacillus vitaminiphilus WMF1 α-galactosidase gene, the synthesis of the mutagenic primer and the plasmid construction primer, and the sequencing of the gene sequence in the plasmid were completed by Jinweizhi (Suzhou). The pET-22b(+) plasmid for expressing the α-galactosidase mutant was constructed by the applicant.
[0044] Strain E. coli DH5a was used for plasmid construction (purchased from Shenzhen Kangti Life Science and Technology Co., Ltd.), and strain E. coli BL21 (DE3) was used for foreign protein expression (purchased from Shenzhen Kangti Life Science and Technology Co., Ltd.).
[0045] 2. Experimental reagents and culture medium
[0046] The main experimental reagents include: enzymes and buffer components for PCR from MutUFO Fast Mutagenesis Kit rapid mutation kit (Nanjing Jujia Biological), plasmid extraction kit (Shanghai Sangon), DNA Marker (Shanghai Sangon), pNPG reagent, endonuclease DpnI (Adamas Company), and other conventional reagents are domestic analytical pure. The composition of the LB culture medium is: yeast powder 5 g / L, tryptone 10 g / L, NaCl 5 g / L, and 15 g / L agar powder is additionally added if solid medium is used. TB liquid medium: yeast powder 12 g / L, tryptone 12 g / L, glycerol 4 ml / L, potassium phosphate 12.5 g / L, potassium dihydrogen phosphate 2.3 g / L.
[0047] Example 1: a-galactosidase mutant N444F
[0048] The a-galactosidase of Anoxybacillus vitaminiphilus (Anoxybacillus vitaminiphilus WMF1) was used as the original enzyme, and the asparagine Asn at the N-terminal 444th position of the amino acid sequence shown in SEQ ID No. 1 was mutated to phenylalanine Phe. The preparation method of the mutant N444F is: 1. Constructing a recombinant plasmid; 2. Expressing enzyme mutants; 3. Preparing crude enzyme solution. The specific steps are as follows:
[0049] 1. Constructing a recombinant plasmid
[0050] The N444F mutation site primer is shown in Table 4. The pET-22b(+) plasmid with the original a-galactosidase gene was used as the template for PCR, and the PCR system is shown in Table 5, and the PCR reaction conditions are shown in Table 6.
[0051] Table 4 Point mutation primer and plasmid construction primer
[0052] Primer name Sequence (5'-3') N444F-F GCGAAGGCCGCTTTCAGCTGATTCTGGATTATAG N444F-R CAGCTGAAAGCGGCCTTCGCTGCGGCTGCGGTTC
[0053] Note: The underlined part in the primer is the mutation site, and "F" represents the upstream primer and "R" represents the downstream primer.
[0054] Table 5 PCR reaction system
[0055]
[0056] Table 6 PCR reaction conditions
[0057]
[0058] After the PCR products were verified by nucleic acid electrophoresis, the templates were digested using endonuclease Dpnl. The reaction system was prepared as shown in Table 7, and the digestion was performed at 37°C for 1-2 h.
[0059] Table 7 Template digestion system
[0060] Component Amount DpnI 1 μl PCR product 0.06 pmol
[0061] After the templates were digested, the products were subjected to DNA homologous recombination. The reaction system was prepared as shown in Table 8, and one-step cloning was performed at 37°C for 30 min to construct an expression plasmid of the mutant enzyme.
[0062] Table 8 Homologous recombination system
[0063] Component Amount DpnI digest 0.06 pmol 5x UFO Buffer 4 μl UvsXase 2 μl ddH2O to 20 μl
[0064] The obtained plasmid was transformed into engineering bacteria E. coli DH5a, and after amplification, the recombinant plasmid was extracted and verified by sequencing.
[0065] 2, Expression of enzyme mutants
[0066] The recombinant plasmid was transformed into the expression host E. coli BL21(DE3), and was plated on LB plates containing 100 ng / mL ampicillin for screening. The transformant was inoculated into 5 mL of LB liquid medium containing 100 ng / mL ampicillin, and was cultured overnight at 37°C and 140 rpm. 2.5 mL of the bacterial solution was inoculated into 50 mL of TB liquid medium containing 100 ng / mL ampicillin, and was cultured at 37°C and 140 rpm for 6 h. Filter-sterilized IPTG was added to the fermentation broth to a final concentration of 0.4 mM, and the culture was continued at 22°C and 140 rpm for 22 h.
[0067] 3, Preparation of crude enzyme solution
[0068] The fermentation broth of the recombinant bacteria was transferred to a centrifuge tube, and the bacterial cells were collected by centrifugation at 11,000 rpm. The bacterial cells were resuspended with 20 mL of buffer at pH 11.0, and were broken by ultrasonic treatment for 10 min. The cells were again centrifuged at 11,000 rpm, and the cell debris was removed. The obtained supernatant was the crude enzyme solution containing the enzyme mutants.
[0069] Example 2: α-galactosidase mutant D457M
[0070] This example takes the α-galactosidase of Anoxybacillus vitaminiphilus WMF1 as the original enzyme as a template, and the aspartic acid Asp at the 457th position of the N-terminal amino acid sequence is mutated to methionine Met, and the rest of the preparation method is the same as that of Example 1.
[0071] The point mutation primers and plasmid construction primers thereof are as shown in Table 9.
[0072] Table 9 Point mutation primers and plasmid construction primers
[0073] Primer name Sequence (5'-3') D457M-F CGAAGTGTGCATGTATGTGATTAAAGCGGTG D457M-R ATCACATACATGCACACTTCGCGGCGGCTATAATC
[0074] Example 3: α-galactosidase mutant R509W
[0075] This example takes the α-galactosidase of Anoxybacillus vitaminiphilus WMF1 as the original enzyme as a template, and the arginine Arg at the 509th position of the N-terminal amino acid sequence is mutated to tryptophan Trp, and the rest of the preparation method is the same as that of Example 1.
[0076] The point mutation primers and plasmid construction primers thereof are as shown in Table 10.
[0077] Table 10 Point mutation primers and plasmid construction primers
[0078] Primer name Sequence (5'-3') R509W-F GCTGGGCCTGTATTGGGTGATGGAAGAAATTACG R509W-R CATCACCCAATACAGGCCCAGCATATAGCGATG
[0079] Example 4: α-galactosidase mutant D457M / R509W
[0080] This example takes the α-galactosidase of Anoxybacillus vitaminiphilus WMF1 as the original enzyme as a template, and the aspartic acid Asp at the 457th position of the N-terminal amino acid sequence is mutated to methionine Met, and the arginine Arg at the 509th position of the N-terminal amino acid sequence is mutated to tryptophan Trp, and the rest of the preparation method is the same as that of Example 1.
[0081] The point mutation primers and plasmid construction primers thereof are as shown in Table 11.
[0082] Table 11 Point mutation primers and plasmid construction primers
[0083] Primer name Sequence (5'-3') D457M-F CGAAGTGTGCATGTATGTGATTAAAGCGGTG D457M-R ATCACATACATGCACACTTCGCGGCGGCTATAATC R509W-F GCTGGGCCTGTATTGGGTGATGGAAGAAATTACG R509W-R CATCACCCAATACAGGCCCAGCATATAGCGATG
[0084] Example 5: α-galactosidase mutant N444F / D457M / R509W
[0085] The plasmid of the enzyme mutant N444F constructed in Example 1 was used as a template, and the aspartic acid at position 457 of the N-terminal amino acid sequence was mutated to methionine, and the arginine at position 509 of the N-terminal amino acid sequence was mutated to tryptophan. The remaining preparation method was the same as in Example 1.
[0086] The point mutation primers and plasmid construction primers are shown in Table 12.
[0087] Table 12 Point mutation primers and plasmid construction primers
[0088] Primer name Sequence (5'-3') N444F-F GCGAAGGCCGCTTTCAGCTGATTCTGGATTATAG N444F-R CAGCTGAAAGCGGCCTTCGCTGCGGCTGCGGTTC D457M-F CGAAGTGTGCATGTATGTGATTAAAGCGGTG D457M-R ATCACATACATGCACACTTCGCGGCGGCTATAATC R509W-F GCTGGGCCTGTATTGGGTGATGGAAGAAATTACG R509W-R CATCACCCAATACAGGCCCAGCATATAGCGATG
[0089] Performance test
[0090] 1. Enzyme activity test of the original α-galactosidase under different pH conditions
[0091] The original α-galactosidase crude enzyme solution was treated with 0.1M glycine-sodium hydroxide buffer at pH 8.0, 9.0, 10.0, 11.0, and 12.0 at room temperature, and the residual enzyme activity was determined by the pNPG method. pNPG is a common substrate for the detection of galactosidase activity. The specific method is as follows:
[0092] Dissolve pNPG in 0.1M buffer to a final concentration of 1g / L. The reaction system contains 30μL of crude enzyme solution and 120μL of substrate. After preheating the substrate at the reaction temperature for 5min, add the enzyme solution and react for another 10min, then add 150μL of 1M Na2CO3 to terminate the reaction, cool to room temperature, and then measure the released pNP at a wavelength of 405nm. One enzyme unit (U) is defined as the amount of enzyme required to decompose 1μmol of pNPG per minute. One unit (U) is defined as the amount of enzyme required to decompose 1μmol of galactose per minute under given conditions.
[0093] Draw a standard curve: prepare 0.7000, 0.6000, 0.5000, 0.4000, 0.3000, 0.2000, 0.1000, and 0.0000mmol / L pNP standard solutions, respectively, and process and measure the absorbance values using the above method to obtain the 405nm standard curve (y=4.9489x+0.0375, R 2 =0.9997) as shown in Figure 2 , and the data results are shown in Figure 3 .
[0094] From Figure 3It can be seen that the original enzyme still has high enzyme activity in the buffer with pH 11.0 compared with other pH buffers, so the original enzyme has good alkali resistance, and the following heat-resistant reaction is carried out in the buffer with pH 11.0.
[0095] 2. Enzyme activity test of α-galactosidase and its mutants at different temperatures under pH 11.0
[0096] The original α-galactosidase and the crude enzyme solution prepared in Examples 1-5 were respectively treated with 0.1M glycine-sodium hydroxide buffer with pH 11.0 at 75℃, 85℃ and 95℃ for 2h, and then the residual enzyme activity was determined by pNPG method. The test results are shown in Table 13. Figure 4 and Table 13.
[0097] Table 13 Enzyme activity of α-galactosidase at different temperatures under pH 11.0
[0098]
[0099]
[0100] It can be seen that the original enzyme still has high enzyme activity in the buffer with pH 11.0 compared with other pH buffers, so the original enzyme has good alkali resistance, and the following heat-resistant reaction is carried out in the buffer with pH 11.0. Figure 4 It can be seen that the original enzyme still has high enzyme activity in the buffer with pH 11.0 compared with other pH buffers, so the original enzyme has good alkali resistance, and the following heat-resistant reaction is carried out in the buffer with pH 11.0.
Claims
1. A high-temperature resistant alkaline α-galactosidase mutant, characterized in that, The mutant is N444F, D457M, R509W, D457M / R509W or N444F / D457M / R509W; the mutant N444F is that the asparagine (Asn) at position 444 in the amino acid sequence shown in SEQ ID No. 1 is mutated into phenylalanine (Phe); the mutant D457M is that the aspartic acid (Asp) at position 457 in the amino acid sequence shown in SEQ ID No. 1 is mutated into methionine (Met); the mutant R509W is that the arginine (Arg) at position 509 in the amino acid sequence shown in SEQ ID No. 1 is mutated into tryptophan (Trp); the mutant D457M / R509W is that the aspartic acid (Asp) at position 457 in the amino acid sequence shown in SEQ ID No. 1 is mutated into methionine (Met) and the arginine (Arg) at position 509 is mutated into tryptophan (Trp); the mutant N444F / D457M / R509W is that the asparagine (Asn) at position 444 in the amino acid sequence shown in SEQ ID No. 1 is mutated into phenylalanine (Phe), the aspartic acid (Asp) at position 457 is mutated into methionine (Met) and the arginine (Arg) at position 509 is mutated into tryptophan (Trp).
2. A polynucleotide, comprising, The polynucleotide is a gene sequence encoding the mutant alpha-galactosidase protein of claim 1.
3. A vector, characterized in that, The vector comprises the polynucleotide of claim 2.
4. The carrier of claim 3, wherein, The vector comprises a cloning vector or an expression vector.
5. A recombinant bacterium, characterized in that, The recombinant bacteria comprise the polynucleotide of claim 2 or the vector of claim 3.
6. The heavy bacteria of claim 5, wherein, The host bacteria are E. coli DH5α.
7. A method for preparing the α-galactosidase mutant according to claim 1, characterized in that, The method comprises the following steps: (1) using a point mutation primer to perform PCR reaction with alpha-galactosidase gene as a template to obtain alpha-galactosidase mutant gene; (2) inserting the alpha-galactosidase mutant gene into an expression vector, and then transferring into host cells to obtain recombinant cells; (3) collecting the recombinant cells expressing alpha-galactosidase mutant, resuspending the bacterial cells, breaking the cells, centrifuging to obtain supernatant, and then obtaining crude enzyme solution containing alpha-galactosidase mutant.
8. The method of claim 7, wherein, In step (2), the DNA homologous recombination method is used to insert the alpha-galactosidase mutant gene into the expression vector.
Citation Information
Patent Citations
Alpha-galactosidase mutant Gal27B-A16 and coding gene and application thereof
CN107988185A
Alpha-galactosidase mutant and application thereof
CN117925579A