Shark eu6-1 promoter for mediating gene knockdown and application thereof

By using the elephant shark EU6-1 promoter to construct a recombinant expression vector, the species restriction problem of the transcriptional activity of the U6 promoter in fish was solved, and the application of efficient gene knockdown and gene editing technology in fish was realized.

CN119061012BActive Publication Date: 2025-10-17SUN YAT SEN UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202411166574.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-23
Publication Date
2025-10-17
Estimated Expiration
2044-08-23

AI Technical Summary

Technical Problem

The existing U6 promoter has species-restricted transcriptional activity in fish, which makes it difficult to widely apply vector-mediated RNAi and gene editing technologies in fish and lacks suitable promoters with high transcriptional activity.

Method used

The elephant shark EU6-1 promoter, whose sequence was derived from the Ensembl database and contained an 8bp OCT element, a 23bp SPH element, a 21bp PSE element, and an 8bp TATA Box element, was used to construct a recombinant expression vector and connect the shRNA sequence through double enzyme digestion and homologous recombination to mediate gene knockdown.

Benefits of technology

The elephant shark EU6-1 promoter significantly inhibits target gene expression in different fish cell lines and embryos, achieving efficient gene knockdown, making it suitable for studying gene function and pathway mechanisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119061012B_ABST
    Figure CN119061012B_ABST
Patent Text Reader

Abstract

The present invention discloses a kind of elephant shark EU6-1 promoter that mediates gene knockdown, and the sequence of elephant shark EU6-1 promoter is shown in SEQ ID NO.1. Also provided is the application of elephant shark EU6-1 promoter and recombinant expression vector in mediating gene knockdown.And the method for knocking down gene is realized using elephant shark EU6-1 promoter. The elephant shark EU6-1 promoter in the present invention is co-constructed into a vector with the shRNA of the target gene that needs to be knocked down. After the vector enters the cell, the transcription of shRNA can be efficiently driven, thereby significantly inhibiting the expression amount of the target gene and achieving the purpose of gene knockdown; the elephant shark EU6-1 promoter and the vector constructed with the target gene shRNA can be used as a molecular biology tool for a class of fish RNAi research. After the constructed vector is transferred into cells or embryos, the expression level of the target gene can be reduced, so as to study the function and pathway mechanism of the gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to a U6-1 promoter of elephant shark and application of the U6-1 promoter in mediating gene knockdown. BACKGROUND

[0002] RNA interference (RNAi) and gene editing technology play an important role in the research of gene function of species, genetic improvement and disease control. The U6 promoter can accurately and efficiently transcribe small fragments of base sequences, and is often used in vector-mediated RNAi system to drive the transcription of short hairpin RNA (shRNA) or double-stranded RNA (dsRNA), or in vector-mediated CRISPR / Cas9 gene editing system to drive the transcription of guide RNA (gRNA).

[0003] Similar to other type III promoters, the main elements of the U6 promoter are distal sequence element (DSE), proximal sequence element (PSE) and TATA Box, wherein the PSE and TATA Box together form the core element region of transcription, and determine the transcription efficiency of the promoter, which is the most important part of the whole promoter. The DSE is located at the most upstream of the promoter, and contains SPH (SphI Post-octamer Homology domain) element and OCT (Octamer motif) element, the former mainly binds with SBF (SPH-binding factor) during transcription, and the OCT is a highly conserved sequence that binds with OCT-1 protein, both of which have the function of enhancing and improving the transcription activity of the promoter. All U6 promoters have PSE and TATA Box elements, but the number and types of enhancers are different, for example, the U6 promoters of human, mouse and cow contain SPH and OCT elements, while the U6 promoter of zebrafish only contains SPH element and lacks OCT element. Due to the advantage of U6 promoter that it can continuously transcribe small fragments of RNA in cells, with the development of liposome and other gene delivery materials, the application of U6 promoter in vector-mediated gene knockdown and gene editing system will have a broader prospect.

[0004] Although the structure of U6 promoter is relatively conserved among species, studies have found that the transcriptional activity of U6 promoter may have species restriction. For example, the U6 promoter of mammals is not suitable for fish. Even the U6 promoter of fish, when used in closely or distantly related fish, the transcriptional activity has a large variation. The inventors of the present application found in early research that the transcriptional activity of zebrafish U6 promoter in grouper cell lines is not high, and the effect of RNAi mediated by the zebrafish U6 promoter is not significant. The zebrafish U6 promoter also failed to transcribe enough gRNA in tilapia brain cell lines to achieve gene editing. Zhang et al. found that the gene editing effect mediated by the U6 promoters of zebrafish and tilapia in medaka cell lines was much worse than that of the U6 promoter of medaka. Therefore, the species restriction of the transcriptional activity of U6 promoter also leads to the difficulty of the application of vector-mediated RNAi and gene editing technology in fish. At present, there are few U6 promoters identified and suitable for fish. Therefore, screening U6 promoters with low species restriction and high transcriptional activity is of great significance for the application of RNAi and gene editing technology in fish. SUMMARY

[0005] The present application aims to provide a shark EU6-1 promoter for efficiently mediating gene knockdown technology.

[0006] The present application also aims to provide the application of the above-mentioned shark EU6-1 promoter in mediating gene knockdown.

[0007] The last purpose of the present application is to provide a method for knocking down genes using the shark EU6-1 promoter.

[0008] The first purpose of the present application can be achieved by the following technical solution: a shark EU6-1 promoter for mediating gene knockdown, the sequence of the shark EU6-1 promoter is shown in SEQ ID NO. 1.

[0009] The sequence of the shark EU6-1 promoter for mediating gene knockdown of the present application is derived from Ensembl database (https: / / asia.ensembl.org / index.html).

[0010] The DNA sequence of the shark EU6-1 promoter of the present application is 300 bp in length, containing an 8 bp OCT element, a 23 bp SPH element, a 21 bp PSE element and an 8 bp TATA Box element.

[0011] The present application also provides a recombinant expression vector carrying the shark EU6-1 promoter.

[0012] The above-mentioned second object of the present application can be realized by the following technical solution: the above-mentioned shark EU6-1 promoter and the recombinant expression vector are applied in mediating gene knockdown, especially in vector-mediated gene knockdown.

[0013] The above-mentioned last object of the present application can be realized by the following technical solution: a method for knocking down genes by using the shark EU6-1 promoter, comprising the following steps:

[0014] (1) EU6-1 promoter synthesis: synthesize the EU6-1 promoter and connect it to the vector PUC57;

[0015] (2) Construction of knockdown vector Pbasi-EU6-1-shRNA: by the method of double enzyme digestion, the EU6-1 sequence and the HU6 sequence are cut from the vectors PUC57 and Pbasi-HU6 respectively, the cut EU6 sequence is connected to the Pbasi plasmid, thereby constructing the Pbasi-EU6-1 vector, and then the shRNA sequence of the target gene is connected to the Pbasi-EU6-1 by the method of double enzyme digestion and homologous recombination, thereby constructing the Pbasi-EU6-1-shRNA vector;

[0016] (3) Construction of overexpression vector Psi-check2-ORF: first, extract the RNA of zebrafish and grouper muscle, tail and grouper spleen tissue, perform reverse transcription, design primers, and clone the open reading frame region of the corresponding target gene, and then use the method of double enzyme digestion and homologous recombination to connect the target gene fragment into the Psi-check2 vector, thereby constructing the overexpression vector Psi-check2-ORF;

[0017] (4) Detection of knockdown efficiency of EU6-1 promoter: the Pbasi-EU6-1-shRNA vector constructed in step (2) and the overexpression vector Psi-check2-ORF in step (3) are co-transfected into the human HEK-293T cell line, the double luciferase reporter system is used to detect the knockdown efficiency of the gene, and then the Pbasi-EU6-1-shRNA vector constructed in step (2) is transfected into the GS cell line of the grouper, and then real-time fluorescence quantitative detection is used to detect the expression of the target gene, thereby verifying the knockdown efficiency of the gene;

[0018] (5) Detection of knockdown efficiency of EU6-1 promoter at the embryonic level: the Pbasi-EU6-1-shRNA constructed in step (2) is injected into zebrafish 1-cell stage embryos by microinjection, and after the injection is completed, the embryos are placed in an embryo incubator for further culture, the development of the control group and the injection group embryos is observed, and a microscope is used to take pictures.

[0019] In the above method for knocking down genes using the shark EU6-1 promoter:

[0020] Preferably, in step (1), the EU6-1 promoter sequence is obtained from the website Ensembl database (https: / / asia.ensembl.org / index.html) and then synthesized by a company (GenScript, China) and connected to the vector PUC57.

[0021] Preferably, the target gene in step (2) is a TNF-a target gene of Epinephelus, a MSTN target gene of Epinephelus, a MSTN target gene of Danio, a NTL target gene of Epinephelus, and a NTL target gene of Danio.

[0022] The shRNA sequences of these target genes are the corresponding shRNA sequences with high knockdown efficiency of the target genes TNF-a (Epinephelus), MSTN (Epinephelus), MSTN (Danio), NTL (Epinephelus), and NTL (Danio) previously studied by the reference laboratory. Preferably, the target gene in step (3) is a TNF-a of Epinephelus, a MSTN of Epinephelus, a MSTN of Danio, a NTL of Epinephelus, and a NTL of Danio.

[0023] In step (3), the primers for cloning the target genes TNF-a (Epinephelus), MSTN (Epinephelus), MSTN (Danio), NTL (Epinephelus), and NTL (Danio) were cloned from the open reading frame (ORF) region of the corresponding target genes.

[0024] Preferably, in step (4), the dual-luciferase reporter system is used to detect the knockdown efficiency of the gene, and the results show that the EU6-1 promoter has a knockdown effect on the TNF-a of Epinephelus, the MSTN of Epinephelus, the MSTN of Danio, and the NTL of Epinephelus, and the EU6-1 promoter has an RNA interference effect in the HEK-293T cell line.

[0025] Preferably, in step (4), the Pbasi-EU6-1-shRNA vector is Pbasi-EU6-1-TNF-a178shRNA, and real-time fluorescent quantitative detection is used to detect the expression of the target gene, and the results show that after transfection of Pbasi-EU6-1-TNF-a178shRNA, the expression level of the TNF-a gene is significantly reduced.

[0026] Preferably, the Pbasi-EU6-1-TNF-alpha 178 shRNA is constructed by the method in step (2), and specifically comprises the following steps: EU6-1 sequence and HU6 sequence are respectively cut from vectors PUC57 and Pbasi-HU6-1 by double enzyme digestion, the cut EU6-1 sequence is connected to the Pbasi plasmid, thereby constructing the Pbasi-EU6-1 vector, and then the shRNA sequence of the target gene TNF-alpha is connected to the Pbasi-EU6 by double enzyme digestion and homologous recombination, thereby constructing the Pbasi-EU6-1-TNF-alpha 178 shRNA vector.

[0027] Preferably, the Pbasi-EU6-1-shRNA in step (5) is Pbasi-EU6-1-NTL 220 shRNA, the development of embryos in the control group and the injection group is observed, and a microscope is used to take pictures, and the results show that the embryos in the control group develop normally, then the embryos in the knockdown group have tail development deformity, and the EU6-1 promoter plays an RNA interference role in zebrafish embryos.

[0028] The Pbasi-EU6-1-NTL 220 shRNA is constructed by the method in step (2), and specifically comprises the following steps: EU6-1 sequence and HU6 sequence are respectively cut from vectors PUC57 and Pbasi-HU6-1 by double enzyme digestion, the cut EU6-1 sequence is connected to the Pbasi plasmid, thereby constructing the Pbasi-EU6-1 vector, and then the shRNA sequence of the target gene NTL is connected to the Pbasi-EU6-1 by double enzyme digestion and homologous recombination, thereby constructing the Pbasi-EU6-1-NTL 220 shRNA vector.

[0029] The present application has the following advantages:

[0030] (1) The shark EU6-1 promoter in the present application is constructed together with the shRNA of the target gene to be knocked down on the vector, when the vector enters the cell, the transcription of the shRNA can be efficiently driven, thereby significantly inhibiting the expression amount of the target gene, and achieving the purpose of gene knockdown;

[0031] (2) The shark EU6-1 promoter in the present application and the vector constructed by the shark EU6-1 promoter and the shRNA of the target gene can be used as a molecular biology tool for fish RNAi research, after the constructed vector is transferred into the cell or the embryo, the expression level of the target gene can be reduced, so as to study the function and path mechanism of the gene. BRIEF DESCRIPTION OF DRAWINGS

[0032] The present application will be further described below with reference to the accompanying drawings and embodiments.

[0033] Figure 1 Figure 6 is a PCR gel electrophoresis map of the elephant shark EU6-1 promoter in Example 1;

[0034] Figure 2 Figure 7 is a map of the Pbasi-EU6-1 vector in Example 1;

[0035] Figure 3 Figure 8 is a target position of each gene shRNA in Example 1; grouper: Epinephelus awoara; zebrafish: Danio rerio; data represent the designed position of shRNA on the target gene;

[0036] Figure 4 Figure 9 is the knockdown efficiency of EU6-1 promoter driven shRNA in HEK-293T cells in Example 1, wherein the vertical coordinate is Relative Luciferase activity;

[0037] Figure 5 Figure 10 is the knockdown efficiency of EU6-1 promoter driven shRNA in GS cells in Example 1, wherein the vertical coordinate is Relative mRNA level; control: control; EU6-178 shRNA: knockdown group;

[0038] Figure 6 Figure 11 is the knockdown phenotype of EU6-1 promoter driven NTL shRNA in zebrafish embryos in Example 1, and three different malformation phenotypes appeared are shown in the three figures other than the control. DETAILED DESCRIPTION

[0039] The present application is further described in conjunction with the following specific examples. The following examples and figures are only for illustrative purposes and should not be construed as limiting the scope of the present application. Unless otherwise specified, the reagents and raw materials used in the following examples are conventional commercially available or obtained by commercial means, and unless otherwise specified, the methods and devices used in the following examples are conventional methods and devices used in the art.

[0040] The following examples are further illustrations of the present application and are not intended to limit the present application.

[0041] Example 1

[0042] The present application is further described in conjunction with the following specific examples. It should be understood that the following examples are only for illustrative purposes and should not be construed as limiting the scope of the present application.

[0043] 1. Search and obtain of elephant shark EU6-1 promoter sequence

[0044] (1) Whole genome search for fish U6 promoter

[0045] With zebrafish U6 snRNA gene as reference, find the U6 promoter of 76 fish on the website https: / / asia.ensembl.org / index.html, then analyze the core elements of each U6 promoter sequence.

[0046] (2) Synthesis and PCR of shark EU6-1 promoter

[0047] The EU6 promoter sequence found on the website was synthesized by GenScript and connected to the vector PUC57, then sequenced and verified. The sequence of shark EU6-1 promoter is shown as SEQ ID NO. 1, and the gel electrophoresis of shark EU6-1 promoter PCR is shown as Figure 1 .

[0048] The sequencing sequence is as follows:

[0049]

[0050] (300bp, as shown in SEQ ID NO. 1).

[0051] Among them, the underlined is the OCT element, the double underlined is the SPH element, the wavy line is the PSE element, and the boxed is the TATA Box element.

[0052] The full-length DNA sequence of shark EU6-1 promoter is 300bp, containing an 8bp OCT element, a 23bp SPH element, a 21bp PSE element and an 8bp TATA Box element.

[0053] 2. Construction of EU6-1 promoter knockdown plasmid

[0054] 2.1 First, use plasmid PUC57 as template, design primers (Table 1) to amplify the EU6-1 promoter sequence, then use BamH I and EcoR I restriction endonuclease to double enzyme cut Pbasi-HU6 plasmid (TaKaRa, Japan), add homologous arms to EU6-1 promoter, use the previous primers (Table 1) to connect it to Pbasi plasmid, then transfer it to DH5α E. coli and select positive clones for sequencing. After sequencing and verifying that the EU6 promoter is correct, the Pbasi-EU6-1 vector construction is completed. The vector map of Pbasi-EU6-1 is shown as Figure 2 .

[0055] Table 1 EU6-1 promoter cloning primers

[0056] Primer name Sequence (from 5' to 3') EU6-1-F TACGAATTATCGATGAATTCACACTGACCACGTGGCCATG (as set forth in SEQ ID NO. 2) EU6-1-R CAGGTCGACTCTAGAGGATCCCAGCACAACAGGGCGGCC (as set forth in SEQ ID NO. 3)

[0057] That is, first, the EU6-1 sequence and the sequence of HU6 are respectively cut from the vectors PUC57 and Pbasi-HU6-1 by double enzyme digestion, and then the cut EU6-1 sequence is connected to the PBAsi plasmid, thereby constructing the Pbasi-EU6-1 vector.

[0058] 2.2 The corresponding shRNA sequence with higher knockdown efficiency of the target genes TNF-α (grouper), MSTN (grouper), MSTN (zebrafish), NTL (grouper), NTL (zebrafish) previously studied by the reference laboratory (Yan et al., Molecular Characterization of U6 Promoters from Orange-Spotted Grouper (Epinephelus coioides) and Its Application in DNA Vector-Based RNAi Technology. Marine Biotechnology. 2023. doi:10.1007 / s10126-023-10212-9, same below) was used. The appropriate shRNA target site and target sequence of the target genes TNF-α, MSTN, NTL of grouper and MSTN, NTL of zebrafish (Yan et al., 2023) were connected to the Pbasi-EU6-1 vector by double enzyme digestion and homologous recombination, and then the Pbasi-EU6-1-shRNA vector was obtained by sequencing verification, such as Pbasi-EU6-1-MSTN (grouper) 909 shRNA, Pbasi-EU6-1-MSTN (zebrafish) 550 shRNA, Pbasi-EU6-1-NTL (grouper) 88 shRNA, Pbasi-EU6-1-NTL 220 shRNA, Pbasi-EU6-1-TNF-α (grouper) 178.

[0059] The target positions of each gene shRNA are shown in Figure 3 grouper: grouper; zebrafish: zebrafish; data represent the design position of shRNA on the target gene.

[0060] That is, then the corresponding shRNA sequence with higher knockdown efficiency of the target genes TNF-α, MSTN (grouper), MSTN (zebrafish), NTL (grouper), NTL (zebrafish) previously studied by the reference laboratory was connected to Pbasi-EU6-1 by double enzyme digestion and homologous recombination, thereby constructing the Pbasi-EU6-1-shRNA vector.

[0061] 3. Construction of overexpression vector of target gene

[0062] 3.1 Extraction of total RNA from tissues of zebrafish and grouper

[0063] Healthy zebrafish and grouper were selected and anesthetized in MS-222 solution, and then the spleen, fin, muscle and other tissues were collected. The total RNA was extracted according to the method of Trizol kit.

[0064] 3.2 Synthesis of first strand cDNA

[0065] (1) RNA denaturation

[0066] First, the volume of 500 ng total RNA was calculated according to the RNA concentration, and was recorded as X. Then it was incubated at 65℃ for 5 min, and then quickly placed on ice for denaturation.

[0067] (2) Removal of genomic DNA

[0068] The genomic DNA was removed by DNase digestion (37℃, 5 min). The reaction reagents were prepared as shown in Table 2:

[0069] Table 2 DNAse digestion reaction reagents

[0070]

[0071]

[0072] Then 2 μL 5×RT Master Mix II was added to the reaction solution of the previous step for reverse transcription reaction. The reaction program was as shown in Table 3:

[0073] Table 3 Reverse transcription reaction program

[0074] Temperature Time 37℃ 15 min 50℃ 5 min 98℃ 5 min 4℃ ∞

[0075] The sample after reverse transcription was stored in a refrigerator at -20℃.

[0076] 3.3 Cloning of ORF sequence of target gene

[0077] TNF-a (grouper), MSTN (grouper), MSTN (zebrafish), NTL (grouper), NTL (zebrafish) were selected as target genes for knockdown, and the primers used for the complete ORF cloning region were referred to previous studies (Yan et al., 2023). After the cloned fragments were recovered, they were connected to the Psi-check2 plasmid (TaKaRa, Japan) by homologous recombination, then transformed into DH5a E. coli, and positive clones were selected for sequencing. After sequencing, the Psi-check2-ORF vector construction was completed.

[0078] 4. Investigation of EU6-1 promoter gene knockdown efficiency

[0079] The constructed Pbasi-EU6-1-shRNA vector and Psi-check2-ORF vector were transfected into HEK-293T cells, and the cells were placed in a 48-well plate for culture. When the cells were cultured to 70-80%, transfection was started. First, the cell culture medium in the well was aspirated with a gun head, then the transfection reagent (viafect, promega), Pbasi-EU6-1-shRNA vector, Psi-check2-ORF vector and serum-free opti-MEM medium were added. After 6 hours of transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum, and after 18 hours of continuous culture, the dual luciferase reporter system was used to detect the knockdown efficiency.

[0080] The results are shown in Figure 4 Figure 4 The TNF-a (grouper) knockdown efficiency was 62%; the MSTN (grouper) knockdown efficiency was 70%; the MSTN (zebrafish) knockdown efficiency was the highest at 61%; the NTL (grouper) knockdown efficiency was 67%; and the NTL (zebrafish) knockdown efficiency was 76%. The results showed that the recombinant expression vector driven by the EU6-1 promoter had knockdown effects on the target genes of TNF-a (grouper), MSTN (grouper), MSTN (zebrafish) and NTL (grouper), suggesting that the EU6-1 promoter can exert high-efficiency RNA interference in the HEK-293T cell line.

[0081] Pbasi-EU6-1-TNF-a178shRNA was transfected into grouper GS cell line, and after incubation in serum-free opti-MEM medium for 6 hours, the medium was replaced with DMEM medium containing 1 mg / mL lipopolysaccharide. After 24 hours of continuous incubation, total RNA was extracted and reverse transcribed, and the mRNA expression of TNF-a was detected by fluorescent quantitative PCR.

[0082] The results are shown in​Figure 5 As shown, compared with the control group (transfection plasmid is Pbasi-EU6-1), the expression level of TNF-α gene was significantly reduced after transfection of Pbasi-EU6-1-TNF-α178shRNA.

[0083] 5. Study on EU6-1 promoter-mediated gene knockdown in zebrafish embryos

[0084] First, sexually mature male and female zebrafish were selected for mating and spawning. Zebrafish embryos that had developed to the 1-cell stage were collected. The Pbasi-EU6-1-NTL 220shRNA plasmid was then diluted to approximately 200 ng / μL and injected into the animal pole of the zebrafish embryos using microinjection. After injection, the zebrafish embryos were cultured in a 28°C incubator. Dead eggs were removed and the embryo culture water was replaced daily. Embryonic development was observed every 6 hours and photographed.

[0085] The results are as follows Figure 6 As shown, Figure 6 After silencing the NTL gene, 24 hours after hatching, embryos in the control group developed normally, while 60% of the embryos in the knockdown group showed tail malformations. This result confirms that the EU6-1 promoter can effectively interfere with RNA in zebrafish embryos.

[0086] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention. Any improvements and modifications based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection shall be subject to the claims.

Claims

1. A gene knockdown-mediated elephant shark EU6-1 promoter, characterized in that: The sequence of the elephant shark EU6-1 promoter is shown in SEQ ID NO.

1.

2. The elephant shark EU6-1 promoter for mediating gene knockdown according to claim 1, characterized in that The DNA sequence of the elephant shark EU6-1 promoter is 300 bp in length and contains an 8 bp OCT element, a 23 bp SPH element, a 21 bp PSE element and an 8 bp TATA Box element.

3. A recombinant expression vector, characterized in that: The recombinant expression vector carries the elephant shark EU6-1 promoter according to claim 1.

4. Use of the elephant shark EU6-1 promoter according to claim 1 or 2 and the recombinant expression vector according to claim 3 in constructing a gene knockdown-mediated vector.

5. A method for constructing a gene knockdown vector using the elephant shark EU6-1 promoter according to claim 1 or 2, characterized in that: The following steps are involved: (1) EU6-1 promoter synthesis: synthesize the EU6-1 promoter and connect it to the vector PUC57; (2) Construction of knockdown vector Pbasi-EU6-1-shRNA: The EU6-1 sequence and HU6 sequence were cut from the vectors PUC57 and Pbasi-HU6 respectively by double enzyme digestion, and the cut EU6 sequence was connected to the Pbasi plasmid to construct the Pbasi-EU6-1 vector. Subsequently, the shRNA sequence of the target gene was connected to Pbasi-EU6-1 by double enzyme digestion and homologous recombination to construct the Pbasi-EU6-1-shRNA vector; (3) Construction of the overexpression vector Psi-check2-ORF: First, RNA was extracted from the muscle and tail tissues of zebrafish and grouper, as well as the spleen tissues of grouper, and reverse transcription was performed. Primers were designed to clone the open reading frame region of the corresponding target gene. Subsequently, the target gene fragment was connected to the Psi-check2 vector using double enzyme digestion and homologous recombination to construct the overexpression vector Psi-check2-ORF. (4) EU6-1 promoter knockdown efficiency detection: The Pbasi-EU6-1-shRNA vector constructed in step (2) and sequenced and the overexpression vector Psi-check2-ORF in step (3) were co-transfected into the human HEK-293T cell line, and the gene knockdown efficiency was detected using the dual luciferase reporter system. The Pbasi-EU6-1-shRNA vector constructed in step (2) was then transfected into the grouper GS cell line, and the expression of the target gene was then quantitatively detected using real-time fluorescence to verify the gene knockdown efficiency; (5) Detection of knockdown efficiency of EU6-1 promoter at the embryonic level: The Pbasi-EU6-1-shRNA constructed in step (2) was microinjected into zebrafish 1-cell embryos. After the injection, the embryos were placed in an embryo incubator for further culture. The development of the embryos in the control group and the injection group was observed and recorded using a microscope. The target genes described in step (2) are the TNF-α target gene of grouper, the MSTN target gene of grouper, the MSTN target gene of zebrafish, the NTL target gene of grouper and the NTL target gene of zebrafish; The target genes in step (3) are grouper TNF-α, grouper MSTN, zebrafish MSTN, grouper NTL and zebrafish NTL target genes.

6. The method for constructing a gene knockdown vector using the elephant shark EU6-1 promoter according to claim 5, characterized in that: In step (4), a dual luciferase reporter system was used to detect the knockdown efficiency of the gene. The results showed that the EU6-1 promoter had a knockdown effect on the target genes of grouper TNF-α, grouper MSTN, zebrafish MSTN and grouper NTL, and the EU6-1 promoter exerted RNA interference in the HEK-293T cell line.

7. The method for constructing a gene knockdown vector using the elephant shark EU6-1 promoter according to claim 5, characterized in that: The Pbasi-EU6-1-shRNA vector in step (4) is Pbasi-EU6-1-TNF-α 178 shRNA. The expression of the target gene was detected by real-time fluorescence quantitative detection. The results showed that after transfection of Pbasi-EU6-1-TNF-α 178 shRNA, the expression level of the TNF-α gene was significantly reduced.

8. The method for constructing a gene knockdown vector using the elephant shark EU6-1 promoter according to claim 5, characterized in that: The Pbasi-EU6-1-shRNA described in step (5) is Pbasi-EU6-1-NTL 220 shRNA. The development of embryos in the control group and the injection group was observed and photographed using a microscope. The results showed that the embryos in the control group developed normally, while the embryos in the knockdown group showed tail malformation. The EU6-1 promoter played an RNA interference role in zebrafish embryos.

Citation Information

Patent Citations

  • Process for the preparation of vinyl oxirane

    EP0000532A1

  • 4-Hydroxy-2-benzimidazolinone derivatives, process for their preparation and their use in medicaments

    EP0000784A1

  • Process for forming multicomponent oxide complex catalysts

    EP0000835A1

  • Engineered catfish and uses thereof

    US20220338453A1

  • RNA interference in fish

    WO2004085645A1